ID: 1102464271

View in Genome Browser
Species Human (GRCh38)
Location 12:113119384-113119406
Sequence CCATTTGCACGTGTGTTTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102464271_1102464282 28 Left 1102464271 12:113119384-113119406 CCCCAAAACACACGTGCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1102464282 12:113119435-113119457 GCCAGGTCCCTGGGAACAGATGG 0: 1
1: 0
2: 1
3: 30
4: 367
1102464271_1102464281 19 Left 1102464271 12:113119384-113119406 CCCCAAAACACACGTGCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1102464281 12:113119426-113119448 TCTCTGGGAGCCAGGTCCCTGGG 0: 1
1: 0
2: 0
3: 43
4: 414
1102464271_1102464284 29 Left 1102464271 12:113119384-113119406 CCCCAAAACACACGTGCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1102464284 12:113119436-113119458 CCAGGTCCCTGGGAACAGATGGG 0: 1
1: 0
2: 2
3: 18
4: 212
1102464271_1102464285 30 Left 1102464271 12:113119384-113119406 CCCCAAAACACACGTGCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1102464285 12:113119437-113119459 CAGGTCCCTGGGAACAGATGGGG 0: 1
1: 0
2: 4
3: 24
4: 284
1102464271_1102464280 18 Left 1102464271 12:113119384-113119406 CCCCAAAACACACGTGCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1102464280 12:113119425-113119447 GTCTCTGGGAGCCAGGTCCCTGG 0: 1
1: 0
2: 5
3: 24
4: 353
1102464271_1102464276 3 Left 1102464271 12:113119384-113119406 CCCCAAAACACACGTGCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1102464276 12:113119410-113119432 AGATGTGCCAGAGATGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 149
1102464271_1102464277 4 Left 1102464271 12:113119384-113119406 CCCCAAAACACACGTGCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1102464277 12:113119411-113119433 GATGTGCCAGAGATGTCTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 192
1102464271_1102464279 11 Left 1102464271 12:113119384-113119406 CCCCAAAACACACGTGCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1102464279 12:113119418-113119440 CAGAGATGTCTCTGGGAGCCAGG 0: 1
1: 0
2: 5
3: 38
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102464271 Original CRISPR CCATTTGCACGTGTGTTTTG GGG (reversed) Exonic
902611644 1:17601333-17601355 CCATTTGCATGTCTGCTCTGTGG + Intronic
902936736 1:19769928-19769950 CCCTAAGCACGTGTGCTTTGTGG - Intronic
903396159 1:23003299-23003321 CCATTTTCAAGTTTGTATTGGGG + Intergenic
905287827 1:36895025-36895047 CCTTCTACACGTGTGTGTTGCGG + Intronic
906875715 1:49536376-49536398 TCATGTGCATGTGTGTGTTGGGG + Intronic
915230369 1:154441436-154441458 CCCTATGCATGTGTGGTTTGAGG + Intronic
915777760 1:158509734-158509756 CCATTTGCAGCTGAGTTTTGGGG - Intergenic
916350766 1:163847316-163847338 CCTTTTAGAAGTGTGTTTTGGGG - Intergenic
924567068 1:245207766-245207788 CGATGTGTACGTGTGTTTGGGGG - Intronic
1063319697 10:5041238-5041260 CCATTTGCCAGAGTGTGTTGGGG + Intronic
1064033950 10:11900515-11900537 CTCTTTGCAGGTGTGATTTGAGG + Intergenic
1071201713 10:83226977-83226999 CCATTTGCACCAGTGTTATAAGG + Intergenic
1072905514 10:99449665-99449687 CCACTTGCTCCTGTGTTTTGAGG - Intergenic
1074021796 10:109592261-109592283 CCAATTCCTCGTGTCTTTTGAGG - Intergenic
1074196231 10:111187907-111187929 CCATTTACAAGACTGTTTTGTGG + Intergenic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1077852214 11:6084620-6084642 ACATTTACAGGTGTGCTTTGTGG + Intergenic
1082092314 11:48100052-48100074 CCACTGGCAGGTGTGTGTTGTGG + Intronic
1086102829 11:83119079-83119101 TCATTTGCAAATGTGTTTTTAGG - Intergenic
1088683089 11:112261163-112261185 ACTTCTGCATGTGTGTTTTGGGG - Intronic
1088789129 11:113208730-113208752 TCATTTGCATATTTGTTTTGGGG + Intronic
1088849330 11:113692480-113692502 CCACATGCACGTGTGTGTCGGGG + Intronic
1088936236 11:114402972-114402994 CTATTTACTCATGTGTTTTGAGG - Intronic
1092040849 12:5382812-5382834 CTATTTGCAGGTGTCTTCTGAGG + Intergenic
1093769563 12:23003007-23003029 ACATTTGCATGTCTGTTTTCTGG + Intergenic
1093975841 12:25421068-25421090 CCACTTGCAGGTTTCTTTTGTGG + Intronic
1094799403 12:34015467-34015489 TCATTTAAAAGTGTGTTTTGTGG - Intergenic
1095112191 12:38309737-38309759 TCATTTAAAAGTGTGTTTTGTGG - Intergenic
1095828034 12:46550741-46550763 CCATATGCACTTGTTTTTTATGG + Intergenic
1098979367 12:76938419-76938441 CCAACTGGATGTGTGTTTTGCGG - Intergenic
1100456893 12:94760300-94760322 TCATTTGCTCATGTGTTTTAAGG - Intergenic
1102464271 12:113119384-113119406 CCATTTGCACGTGTGTTTTGGGG - Exonic
1102649914 12:114433266-114433288 ACATCTGCATGTGTGGTTTGGGG - Intergenic
1103330362 12:120149945-120149967 CCATCTGCTCCTGTGCTTTGGGG - Exonic
1105038050 12:132940779-132940801 CCATGTGCAGGTTTGTTTTGTGG + Intronic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106410317 13:29506715-29506737 CCATTTGCTCCTTTGTTATGTGG - Intergenic
1107426586 13:40299736-40299758 TTATTGACACGTGTGTTTTGTGG + Intergenic
1107718009 13:43219740-43219762 CCATTTGTACATGTGATTAGAGG - Intronic
1108058889 13:46513214-46513236 CCATTTGTACGTCTTCTTTGGGG + Intergenic
1108503704 13:51090501-51090523 CCATGTGGAGGTGGGTTTTGAGG - Intergenic
1110967006 13:81712994-81713016 GCATTTGCAGCTGTGTTCTGTGG + Intergenic
1111455205 13:88473671-88473693 AAATTTCCACATGTGTTTTGAGG + Intergenic
1112160174 13:96858994-96859016 CCATATCCACTTGTGTATTGGGG + Intergenic
1113036994 13:106061778-106061800 CGTTTTCCACGTGTATTTTGGGG - Intergenic
1113075674 13:106465998-106466020 CAATTGGCTCATGTGTTTTGAGG - Intergenic
1114325112 14:21581234-21581256 CCATTTGTATGTGTATTTTATGG - Intergenic
1114393883 14:22339106-22339128 CCTTTTCCTCGTGTGTTTTCAGG - Intergenic
1115553133 14:34522463-34522485 CCATTTGCTACTGTGTCTTGTGG + Intronic
1116195537 14:41720673-41720695 CCATGTGCTTGTGTGGTTTGGGG + Intronic
1116520511 14:45841200-45841222 CCATTTGCTGGTGTGGATTGTGG - Intergenic
1117151653 14:52894599-52894621 CCATATGTAGGTCTGTTTTGGGG - Intronic
1117171110 14:53098212-53098234 GCATTTGCAGTTGTGTTTTGAGG - Intronic
1117174027 14:53129806-53129828 CCATTATCAAGTTTGTTTTGGGG - Intronic
1118372947 14:65153265-65153287 CCAGTTGCTCGTGTTTATTGAGG - Intergenic
1124112220 15:26801604-26801626 CAATTTTCACATGTGTTTTTTGG - Intronic
1127618191 15:60707994-60708016 CCATTTGCAGGCCTTTTTTGTGG + Intronic
1127742488 15:61925190-61925212 CTATTTGCATGCGTGTGTTGTGG - Intronic
1129058339 15:72838390-72838412 CCATTTGCAAGTGTGCTTGCAGG + Intergenic
1131987174 15:98054278-98054300 CCATTTTCACTTGAGTTTTGAGG + Intergenic
1132014125 15:98300870-98300892 ACACATGCATGTGTGTTTTGTGG + Intergenic
1132507755 16:320552-320574 AAATTTGCACGTGTGTGTTAAGG - Intronic
1133111008 16:3548418-3548440 CCATTTGGAGGTGTCTTTTCTGG - Intronic
1134619938 16:15680233-15680255 CTCTGTGCACGTGTGGTTTGGGG + Intronic
1137603231 16:49770579-49770601 CCCTTTGCACGTGAGTCTTCTGG - Intronic
1138252305 16:55510425-55510447 ACATTTGTCCGTGTGTTCTGCGG + Intronic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1140892145 16:79294092-79294114 CCTTCTGCACGAGTGTTCTGAGG + Intergenic
1140918158 16:79512381-79512403 CCATCTGCACATGAGCTTTGAGG + Intergenic
1141675041 16:85513382-85513404 CCATTTGCTCCTGAGTATTGTGG + Intergenic
1142296617 16:89227462-89227484 CCCTTTGCATGTGTGGTTTGCGG + Exonic
1144703189 17:17351683-17351705 CCATTTGCACCTGTGCTGTGGGG + Intergenic
1144796229 17:17893057-17893079 CCGTTTGAAGGTATGTTTTGAGG + Intronic
1146589546 17:34116837-34116859 CCTTTTGCAAGTGTGTGTGGGGG + Intronic
1150700082 17:67438990-67439012 CCATTTGGACCTGTATTTTGTGG - Intronic
1152576686 17:81144249-81144271 CCATTTGTTTGTGTGATTTGGGG - Intronic
1152602733 17:81273057-81273079 CCATGTGTGCGTGTGTTTGGGGG - Intronic
1158560111 18:58506328-58506350 CCATGTGCAGGTGTGTTACGTGG - Intronic
1158851221 18:61496955-61496977 CCATTTGGACCTGTGTTCTCAGG - Intronic
1165347603 19:35258701-35258723 CCATTATCACTTCTGTTTTGTGG - Intronic
1166285351 19:41822813-41822835 CCATGTGCTGGTGTGTTTTCTGG + Intergenic
925361592 2:3284058-3284080 CCATTTGCACGTCTGCTTCCTGG - Intronic
928454270 2:31405097-31405119 CCTTTTGCTAGTGTGTTCTGGGG - Intronic
929022107 2:37563626-37563648 GCCTTTGCACGTCTGCTTTGAGG + Intergenic
930957495 2:57219930-57219952 TCATTTGCACGTGCATTTTGAGG + Intergenic
937034867 2:118772632-118772654 ACATGTGCCTGTGTGTTTTGAGG + Intergenic
941737595 2:168996332-168996354 ACATTTGCAGGTGTGTTTGTAGG - Intronic
942406667 2:175663246-175663268 CTATGTGCACGTGTGTGTGGAGG - Intergenic
942642835 2:178077562-178077584 CCATTTTTACGTTTGTTATGTGG - Intronic
943785707 2:191876205-191876227 CGATTTGCTCATGTGTTTTTAGG + Intergenic
945466181 2:210172179-210172201 CCAGGTGCAGGTTTGTTTTGTGG - Intergenic
947348626 2:229219999-229220021 CCATTTGTCCTTTTGTTTTGGGG + Intronic
948058912 2:235029450-235029472 CCATGTCCACCTGTGCTTTGAGG + Intronic
1169797362 20:9478058-9478080 CCAAATGCACGTATCTTTTGAGG - Intronic
1170995660 20:21354767-21354789 TCATTTGCACTTGTTTTTTCAGG + Exonic
1172973281 20:38888711-38888733 CCCTTTGCACGTGGGTTCAGGGG + Intronic
1175522638 20:59611865-59611887 CGATTTGAATGTGTATTTTGCGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1178642133 21:34353427-34353449 CCATGTTCGTGTGTGTTTTGGGG + Intergenic
1180199982 21:46218268-46218290 TCATATGCACGAGTGTTTTCTGG + Intronic
1181428587 22:22861596-22861618 CCATTTGTATGTTTCTTTTGAGG - Intronic
1182025784 22:27117862-27117884 CCATTTGTACATTTGCTTTGGGG - Intergenic
949748507 3:7324156-7324178 CCATTCTCATGTGTGTTTTCAGG + Intronic
951549445 3:23862142-23862164 CCACTTGCAGGTGTGTGATGGGG - Intronic
954633707 3:52060158-52060180 CCATATGAATGTGTGTGTTGGGG - Intergenic
957655960 3:83075642-83075664 ACATATGCAGGTGTGTTATGTGG - Intergenic
960561182 3:119085170-119085192 ACATTTGCACCTGTGTTCTATGG - Intronic
963658993 3:148100422-148100444 CCATTTCTACGTATGTTTTCTGG - Intergenic
966318080 3:178671109-178671131 GTGTTTGTACGTGTGTTTTGGGG - Intronic
966560592 3:181315541-181315563 ACATTTGCAATTTTGTTTTGAGG + Intergenic
968660635 4:1797417-1797439 CCATCTGCCCGTGTGTGGTGGGG - Intronic
968673566 4:1864969-1864991 CCATTTGCAGGTGTGTCGTCCGG - Intergenic
970170187 4:13281600-13281622 CTGTATGCACGTGTGATTTGGGG - Intergenic
970546998 4:17140007-17140029 CCACTTGCACGTCTGTTTATAGG - Intergenic
971784920 4:31088143-31088165 CCTTTTGAATGTGTGTTTTTAGG + Intronic
971867782 4:32195341-32195363 CTATTTGCTAGTGTGATTTGTGG - Intergenic
973641486 4:52907014-52907036 TCATTTCCAAGTGGGTTTTGAGG + Intronic
973938051 4:55871058-55871080 CCATTTGCATGTGTAATTTTGGG - Intronic
977498500 4:97806869-97806891 TCATATGCACTTATGTTTTGAGG - Intronic
977706272 4:100074382-100074404 CCATGTGCAGGTTTTTTTTGTGG + Intergenic
978377525 4:108091235-108091257 CCATACACAAGTGTGTTTTGGGG - Intronic
979113240 4:116786174-116786196 TTATTTGCAGCTGTGTTTTGAGG + Intergenic
979747712 4:124238664-124238686 CTATTTGTCCGTGTGTGTTGCGG + Intergenic
980454651 4:133023036-133023058 GCATTTGCAGCTGTGCTTTGTGG - Intergenic
985090040 4:186353460-186353482 TCATTTGCATGTCAGTTTTGTGG - Intergenic
985442968 4:189997900-189997922 CCATTTGCCCGTGTTTGTTTTGG + Intergenic
985881838 5:2644282-2644304 CCATTTTCACTAGGGTTTTGTGG - Intergenic
986003846 5:3651248-3651270 CCAGGAGCACGTGTGTTTAGGGG - Intergenic
986247144 5:6019540-6019562 CCAGTTTCACGTGAGTTCTGTGG - Intergenic
987915956 5:24214851-24214873 CCATTTGCATGTGTTTAGTGAGG + Intergenic
988224177 5:28390723-28390745 GCACTTGCACGTATCTTTTGAGG + Intergenic
990977722 5:61573903-61573925 CCATGTGCACATGGTTTTTGAGG + Intergenic
992286877 5:75245083-75245105 TCATTTGCAGGTGGATTTTGAGG - Intergenic
993871369 5:93258171-93258193 CCACTTGTAAGTGTATTTTGTGG + Intergenic
994695360 5:103067048-103067070 CCATTTGTACATCTTTTTTGGGG + Intergenic
999250004 5:150176884-150176906 CTGTTTGCATGTGTGTGTTGGGG + Intronic
1000017602 5:157291611-157291633 CCTTTTGGACATGTGTTCTGAGG + Intronic
1004461372 6:15840010-15840032 GCATTTGCACTGGAGTTTTGGGG - Intergenic
1006668887 6:35717413-35717435 CCATGTGCACGTGTGTTTGTGGG + Intronic
1007010454 6:38412329-38412351 GCATATGTTCGTGTGTTTTGGGG - Intronic
1008034599 6:46733247-46733269 CCCTTTGCACTTTTGTTGTGAGG - Intronic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009297472 6:61971137-61971159 CCATTTGTACTTGTATTTTAAGG + Intronic
1011140029 6:84142762-84142784 CGACTTGCACGTTTGATTTGGGG - Intronic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1011412533 6:87081035-87081057 TCATTTGCATGTGTATTTTTTGG + Intergenic
1014286758 6:119507634-119507656 CTATTTGCACCTGAGTGTTGGGG - Intergenic
1015424248 6:133047376-133047398 CTATTTGGACTTGGGTTTTGTGG - Intergenic
1017015711 6:150097995-150098017 GAATTTGCATTTGTGTTTTGGGG + Intergenic
1017308902 6:152953969-152953991 TCATATGCACTGGTGTTTTGTGG - Intergenic
1018728923 6:166634624-166634646 TCATTTGCAAATGTTTTTTGAGG + Intronic
1021485890 7:21168180-21168202 CCATGTGCACATGTGTGTGGGGG + Intergenic
1024164035 7:46712393-46712415 CCATTTGCCTGTGTATTTTGAGG - Intronic
1024827508 7:53408979-53409001 CCATTTAGTCATGTGTTTTGGGG + Intergenic
1025065924 7:55856031-55856053 ACATTTGCAGGTTTGTTATGAGG + Intronic
1025252953 7:57364194-57364216 CCATTTGCTGGTTTGCTTTGGGG + Intergenic
1027137038 7:75631868-75631890 CCAGCTGCGCGTGTGTTGTGGGG + Intronic
1029586789 7:101477887-101477909 CCATTTGTCCATTTGTTTTGCGG + Intronic
1030068231 7:105676866-105676888 ACATGTGCAGGTTTGTTTTGGGG - Intronic
1035566121 8:642666-642688 CCACTGGCACGTCTGTTATGAGG + Intronic
1038078099 8:24100874-24100896 CTCTTTGCAGGTGTGTGTTGGGG + Intergenic
1038990441 8:32861429-32861451 CTATTTACTTGTGTGTTTTGTGG - Intergenic
1039085951 8:33779985-33780007 ACATTTGCAGGTTTGTTATGTGG + Intergenic
1039201579 8:35099788-35099810 CCATTAGCACCTGTGTGCTGTGG - Intergenic
1039797694 8:40929161-40929183 CCTTTTCCAAGTGTGTTTTGTGG - Intergenic
1040560796 8:48521748-48521770 CCATTTACACGTGGGTTATCAGG + Intergenic
1041146557 8:54882036-54882058 CAATTAGCACTTGAGTTTTGTGG + Intergenic
1042705956 8:71665751-71665773 CCATTGTCAAGTTTGTTTTGTGG - Intergenic
1044083915 8:87920067-87920089 CCATTTGCAAGAGTATTTTTTGG - Intergenic
1047754155 8:127905881-127905903 CCATTTGCAGCTGTGGTCTGAGG + Intergenic
1049690703 8:143957704-143957726 CCATTCGCAGGTGTGGTGTGGGG - Intronic
1050326528 9:4503155-4503177 CCATTCCCACGTCTGTTCTGTGG + Intronic
1051370086 9:16351833-16351855 TCAACTGCACGTGTGCTTTGTGG - Intergenic
1059185392 9:112265073-112265095 CCAATTCCAAGTGTGTTTTTTGG + Intronic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1188986734 X:36774802-36774824 CAATATGCACTTATGTTTTGTGG + Intergenic
1191188990 X:57645579-57645601 CCATTTGCATGTCTTTTTTTTGG - Intergenic
1192260644 X:69504375-69504397 CCCTGTGCAAGTGTGTTTGGCGG - Intergenic
1193300760 X:79885968-79885990 CTATTTGCACGTCTGTTTATAGG + Intergenic
1196163711 X:112514624-112514646 CTATTTGCTGGTGTGTCTTGTGG - Intergenic
1196611781 X:117723434-117723456 CCATGTGCATGTGTGTATTGTGG + Intergenic
1198242968 X:134802647-134802669 CAATTGGCACATATGTTTTGGGG - Intronic
1199388436 X:147250428-147250450 CCATTTGTGTGTGTGTTGTGGGG + Intergenic
1201071811 Y:10153769-10153791 CCATTTTCTCATGTGTTTTTTGG + Intergenic
1202076694 Y:21043783-21043805 CCATTTTCACGTTTGTATTGGGG + Intergenic