ID: 1102464632

View in Genome Browser
Species Human (GRCh38)
Location 12:113121335-113121357
Sequence CTCACTGGGTTGTAAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102464632_1102464636 0 Left 1102464632 12:113121335-113121357 CCAGGAACTTACAACCCAGTGAG 0: 1
1: 0
2: 1
3: 36
4: 167
Right 1102464636 12:113121358-113121380 CTTGGACTGTTTGTCCACACAGG 0: 1
1: 0
2: 0
3: 11
4: 114
1102464632_1102464637 1 Left 1102464632 12:113121335-113121357 CCAGGAACTTACAACCCAGTGAG 0: 1
1: 0
2: 1
3: 36
4: 167
Right 1102464637 12:113121359-113121381 TTGGACTGTTTGTCCACACAGGG 0: 1
1: 0
2: 0
3: 18
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102464632 Original CRISPR CTCACTGGGTTGTAAGTTCC TGG (reversed) Intronic
900873655 1:5325430-5325452 CTCACAGTGTGGTGAGTTCCAGG - Intergenic
902394808 1:16126805-16126827 ACCAGTGGGTTGTAAGCTCCAGG + Intronic
903668116 1:25020426-25020448 CTCACTAGAGTGTGAGTTCCAGG - Intergenic
903808090 1:26019703-26019725 CTCCCTGGAGGGTAAGTTCCAGG + Intergenic
904252351 1:29234237-29234259 ATCGCTGGGTTGAGAGTTCCTGG - Intergenic
905193714 1:36257303-36257325 CTCACTAGAATGTCAGTTCCAGG + Intronic
906945433 1:50290544-50290566 CCCACTGGGCAGTAAATTCCTGG - Intergenic
907353196 1:53850393-53850415 ATCACTGGACTGTAAGATCCAGG + Intergenic
907593819 1:55701517-55701539 CTCACTAGACTGTAAGCTCCCGG - Intergenic
908856342 1:68433952-68433974 TTCAATGGATTGGAAGTTCCTGG + Intronic
909402405 1:75248825-75248847 TTCACTTAGTTGTAAGTCCCTGG - Intronic
913277229 1:117150379-117150401 CTCAATGGGATTTAAGTTCCTGG + Intronic
915928581 1:160042993-160043015 CTCACTAGGCTGTGAGTTCTTGG - Intronic
918526075 1:185466506-185466528 ACCACTGGATTGTTAGTTCCTGG + Intergenic
921380477 1:214519431-214519453 CTCACTGTGTTGCAAGTTTGGGG - Intronic
922188630 1:223297748-223297770 CTCACTGGGCTGTGAACTCCTGG + Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1063734603 10:8739070-8739092 CTCTCTGGGTTGTCAGTTCATGG - Intergenic
1064325546 10:14347724-14347746 ATCACTGGTTTGTGAGTTCCAGG + Intronic
1064657670 10:17572105-17572127 CCCACTAGATTTTAAGTTCCTGG + Intergenic
1065021830 10:21508204-21508226 CCCACTGGGTCCTAAGTGCCGGG + Intergenic
1066528064 10:36303747-36303769 CTCAGTGGTTTTTAAGTTCTTGG + Intergenic
1069682612 10:70296070-70296092 TAAACTGGGTTGCAAGTTCCGGG - Intergenic
1073057738 10:100713175-100713197 ACCACTGGGTTGTGAGCTCCTGG + Intergenic
1073108839 10:101048792-101048814 CTCACTGGACTGTGGGTTCCAGG + Intergenic
1074772970 10:116745134-116745156 CCCACTGGGAAGTAAGTCCCAGG + Intergenic
1075895850 10:125994032-125994054 CTCTCTGGGATGCCAGTTCCTGG - Intronic
1075980149 10:126731322-126731344 CTCACTAGAATGTAAGCTCCAGG - Intergenic
1076019768 10:127062980-127063002 CTCACTGGTGTGGAAGTGCCTGG + Intronic
1078916595 11:15784146-15784168 CTCACTGGACTGTAAGAACCAGG - Intergenic
1079025003 11:16940117-16940139 CCTACTGGGCTGTAACTTCCAGG + Intronic
1088650851 11:111957096-111957118 CTCACTGTGCTTTAACTTCCTGG - Intronic
1091940344 12:4474290-4474312 CTTTCTGGGTTGTATGTTCTTGG - Intergenic
1093110821 12:15149952-15149974 CTCAGTGGGTTGTAACTCTCAGG - Intronic
1095131135 12:38543846-38543868 TCAACTGTGTTGTAAGTTCCTGG - Intergenic
1097612303 12:61839131-61839153 CTCACCAGACTGTAAGTTCCTGG - Intronic
1099258273 12:80343270-80343292 CTCAGTGGGAGGTTAGTTCCAGG + Intronic
1100431696 12:94536556-94536578 TTCTCTAGGGTGTAAGTTCCAGG + Intergenic
1100661243 12:96701454-96701476 CTCACTGGACTGTAAGCTCCAGG - Intronic
1101748091 12:107559326-107559348 CACACGGGGCTGTCAGTTCCAGG - Intronic
1102464632 12:113121335-113121357 CTCACTGGGTTGTAAGTTCCTGG - Intronic
1102562531 12:113772510-113772532 CCCACTAGAATGTAAGTTCCAGG - Intergenic
1102819291 12:115894385-115894407 CCCACTTGAATGTAAGTTCCAGG - Intergenic
1103481076 12:121249956-121249978 CTCACTGGTCTGGAAATTCCAGG + Exonic
1103914357 12:124368812-124368834 CTCACTAGAATGTAAGTGCCTGG + Intronic
1109159527 13:58955292-58955314 CTTACTGGGTTGTAGGTTTCAGG - Intergenic
1111871644 13:93840361-93840383 CTAACAGGGTTGTATTTTCCAGG - Intronic
1119909566 14:78337376-78337398 TTTACTGGGTTGTAGGTACCAGG + Intronic
1120052582 14:79884428-79884450 CTCCCTGGGTTGTTAGGTACAGG + Intergenic
1120062910 14:80005507-80005529 CTCACTGGGGAGTGAGTTCATGG - Intergenic
1121029473 14:90645872-90645894 CTCACTGGACTGTAGGTTCCAGG - Intronic
1121175480 14:91887695-91887717 CTCACTGACTTGGAAGTTTCAGG + Intronic
1121956916 14:98222764-98222786 CTCACTAGCTTCCAAGTTCCTGG + Intergenic
1122199318 14:100112829-100112851 CTCTCTAGATTGTAAGTTCCAGG + Intronic
1126463237 15:48936267-48936289 CTTACAGGGTTGAAATTTCCTGG - Intronic
1126502730 15:49364337-49364359 CTTAGTAGGTTGTATGTTCCAGG + Intronic
1128761920 15:70222903-70222925 TTCTCTGGGATGTAAGTTCCTGG + Intergenic
1131027392 15:89155967-89155989 CTCACTGGATTTTAGGTTCCTGG + Intronic
1132679121 16:1132569-1132591 CTCGCTGGCTAGTCAGTTCCCGG - Intergenic
1133319530 16:4904367-4904389 CAGACTGGGTTGTGAGTGCCAGG - Intronic
1134795042 16:17027553-17027575 CCCACTGTGTTTAAAGTTCCTGG + Intergenic
1135195481 16:20390600-20390622 CTCACTAGGATGTCAGTTCCAGG + Intronic
1136092512 16:27930463-27930485 CCCACTGGGATGTAAGCTCCAGG + Intronic
1137298690 16:47124388-47124410 CTTAATGGGTTGTTAGTTCCTGG - Intronic
1137592217 16:49700580-49700602 CTCCCTGGGCTGTGAGTTGCAGG - Intronic
1141430132 16:83967229-83967251 CCCACTTGGATGTAAGCTCCAGG + Intergenic
1142664925 17:1457063-1457085 CTCACTGGTCTGTGAGTTCGAGG - Intronic
1143945728 17:10590424-10590446 CTCCCTGGTTTGGAAGTGCCTGG - Intergenic
1145283810 17:21488599-21488621 TTAACTTAGTTGTAAGTTCCAGG - Intergenic
1148452158 17:47786081-47786103 CCCACTGGGATGTAGGGTCCTGG + Intergenic
1151337204 17:73447022-73447044 CTCACTGTGTGGTGAGTTCTAGG + Intronic
1152790097 17:82274025-82274047 CTCACTGGGCTGCCAGTTCCCGG + Intergenic
1154392526 18:13952485-13952507 ATCACTGGGCTGTATTTTCCTGG + Intergenic
1155006156 18:21731182-21731204 CCCACTGGATTATAAGTTTCTGG + Intronic
1156602838 18:38630649-38630671 CCCCCTGGGATGGAAGTTCCTGG + Intergenic
1158198585 18:54915257-54915279 CTCACTAGGCAGTAAGTTCCAGG + Intronic
1159894845 18:73986378-73986400 GGCACTGGGTTGTAGCTTCCTGG + Intergenic
1160232572 18:77058964-77058986 CTCAGGGGGTTGTAAGTTGGTGG - Intronic
1166609181 19:44173897-44173919 CTCACTGGAGTGTAATCTCCAGG + Intronic
925488788 2:4368923-4368945 CTCACTGGGATCTAGGCTCCAGG - Intergenic
925695460 2:6572843-6572865 CTCGCTGGGCTGTGAGCTCCAGG + Intergenic
926326508 2:11788749-11788771 CTCACTGGGCTCTGAGGTCCTGG - Intronic
926783711 2:16499366-16499388 CCCACTGGGTTGAAGGATCCTGG + Intergenic
927260974 2:21089700-21089722 CTCACTTGAGTGTAAGTTCAAGG - Intergenic
928996311 2:37295213-37295235 CCTACTAGATTGTAAGTTCCTGG - Intronic
929940636 2:46331243-46331265 CTGACTGGGCTGTCAGTTCCTGG + Intronic
930008926 2:46919881-46919903 CTCAATGGGTTGCATGTTCTAGG + Intronic
930596078 2:53389835-53389857 ATTTCTGGGTTGTCAGTTCCAGG - Intergenic
931285687 2:60829776-60829798 CTCACTAGATTGTAAGCTCTGGG - Intergenic
935923416 2:108040138-108040160 GTCAATGTCTTGTAAGTTCCAGG + Intergenic
936476958 2:112847788-112847810 CTCACCAGTGTGTAAGTTCCTGG + Intergenic
937081152 2:119140871-119140893 CTCACTTGAGAGTAAGTTCCTGG - Intergenic
937951293 2:127389756-127389778 CTCACAGGATTCTGAGTTCCTGG - Intergenic
938740967 2:134231867-134231889 CTCACTGGGTGTAAAGTACCAGG - Intronic
940674071 2:156707238-156707260 CTCACTGAGTTGGTAGTTCAGGG + Intergenic
947614849 2:231549327-231549349 CCCTCTGGTCTGTAAGTTCCAGG + Intergenic
947788504 2:232846947-232846969 CTCAGTGGATTGAAAGTTCCAGG + Intronic
948942615 2:241203809-241203831 CTCCCTAGGATGGAAGTTCCTGG - Intronic
1169702530 20:8464061-8464083 TGCACTGGGTTTTCAGTTCCCGG + Intronic
1170686363 20:18573321-18573343 CTCAGTGGGTTCTTAGTTCATGG + Intronic
1170993300 20:21325635-21325657 CTCACTCTCTTGTAAGTTCCTGG - Intronic
1171297984 20:24035511-24035533 CTCAGTGGGCTGGAAGTTCAAGG + Intergenic
1171879049 20:30603156-30603178 CTCTATGGGTTGTCAGCTCCTGG - Intergenic
1172032814 20:31993736-31993758 CACAGTGGGTTGTAACTGCCTGG - Intronic
1172277803 20:33689759-33689781 CCCACTGGACTGTGAGTTCCAGG - Intergenic
1172952282 20:38729811-38729833 CTCACTAGACTGTAAGCTCCCGG - Intergenic
1173173145 20:40743383-40743405 CTCTCTGGGTTTTCAGTTACTGG + Intergenic
1173186278 20:40842932-40842954 CCCACTAGGTGGTAAGTTCCAGG - Intergenic
1173564385 20:44028611-44028633 ATCACTGGAATGTAAGCTCCAGG - Intronic
1174598857 20:51707752-51707774 CTCACTGGATTATAACTTCCTGG + Intronic
1174871395 20:54186120-54186142 ATCACTGGGTTGTGAAGTCCAGG - Intergenic
1175011379 20:55740915-55740937 ATCACTGGGCTGTATGTACCAGG + Intergenic
1175155847 20:56971085-56971107 CTCACAGGGCTTTAGGTTCCAGG + Intergenic
1175516181 20:59571736-59571758 CTCCCTGGGTTGCAGATTCCAGG + Intergenic
1175924360 20:62464782-62464804 CTCAGTGGGTGGTCTGTTCCAGG + Exonic
1178342624 21:31799174-31799196 CACACTGGGTTTTAAATACCTGG - Intergenic
1181687858 22:24541990-24542012 CTTGCTGTGTTGTAAGATCCTGG + Intronic
950122918 3:10493804-10493826 CTCTCTTTGTTGTAAGCTCCTGG - Intronic
950908841 3:16566412-16566434 CTCACTGGCCTGTAGATTCCTGG - Intergenic
951148847 3:19263267-19263289 CTCACTGGGTTGTAGAGTCAAGG + Intronic
952785133 3:37146307-37146329 CTCACTGATTTTTAAGTTCTGGG + Intronic
954671755 3:52294754-52294776 GGCACTGGGTTCCAAGTTCCAGG + Intergenic
955535285 3:59916911-59916933 CCCACTGAGTGGTAAGTTTCTGG - Intronic
956751256 3:72345773-72345795 CTCTCTGGGCTGCAAGCTCCTGG + Intergenic
959173174 3:102869056-102869078 CTCACTGGTTTGTAAGTTCAAGG + Intergenic
959877892 3:111407395-111407417 CTCACTGGGTGGTTAGATCCAGG + Intronic
959946430 3:112130359-112130381 CTCACTGGGATGTGAAGTCCAGG + Intronic
961358936 3:126355834-126355856 CTTTCTGGGTTGTCAGTGCCTGG - Intronic
962939681 3:140114436-140114458 CTCACTGGCCTGTAAGTTCTTGG + Intronic
964213482 3:154253868-154253890 ATGACTGGTTTGAAAGTTCCCGG + Intronic
964345021 3:155746257-155746279 CTTACTCGTTTGTAACTTCCTGG - Intergenic
966363301 3:179152868-179152890 CTCTCTTGGTTGAAACTTCCAGG - Intronic
967296037 3:187965932-187965954 AACAATGAGTTGTAAGTTCCTGG + Intergenic
967681688 3:192371038-192371060 CTCACTGGGTTACAACTCCCTGG + Intronic
967848498 3:194063775-194063797 CTGACTGGGATGTAAGATCCAGG - Intergenic
970856475 4:20654809-20654831 CTAAGAGGGTTGTAATTTCCAGG - Intergenic
971435471 4:26618176-26618198 CCAACTGGGATGTAAGTTCCAGG - Intronic
974403770 4:61439022-61439044 CTCACTGGGTGGTAAGTTGAAGG + Intronic
974685573 4:65223311-65223333 CTCAATGTGTTGTAAGTTCGGGG - Intergenic
975809175 4:78147898-78147920 CTTTCTGGGTTGTGAGTTTCTGG + Intronic
982219593 4:153113154-153113176 GTCACAGGGTCGCAAGTTCCAGG + Intergenic
984850495 4:184148144-184148166 TTCACTGGATGGTAAGTTCTCGG + Intronic
986065131 5:4227910-4227932 CTCACTGGTTTGTTATTTCTAGG - Intergenic
986712831 5:10500220-10500242 CTCACTGTGTTCTATGTACCTGG - Intergenic
991479899 5:67066996-67067018 GTCACTGGGTACAAAGTTCCTGG - Intronic
995108052 5:108397960-108397982 TTCACTGGGTTGTAAATTCTGGG + Intergenic
996940543 5:129000006-129000028 ATCACTAGGGTGAAAGTTCCTGG + Intronic
997408749 5:133673748-133673770 CTCACTAGATTGTGAGTCCCTGG - Intergenic
998122548 5:139590741-139590763 CAAGCTGGGTTGTAAGTTCATGG + Intronic
1006058497 6:31403191-31403213 CTCACTGGCTTGTTCCTTCCAGG - Intronic
1006070935 6:31497736-31497758 CTCACTGGCTTGTTCCTTCCGGG - Intronic
1006707403 6:36032730-36032752 CCCACTAGGCTGTAAGTTCCAGG - Intronic
1006896553 6:37475079-37475101 CTCACTGGGTTTGAGGTTCAAGG + Intronic
1009767236 6:68095325-68095347 TTCACTGGGTTTTATGTTTCTGG - Intergenic
1014286378 6:119503500-119503522 CTCAGTGGGGTGTGAGGTCCTGG + Intergenic
1016359412 6:143251556-143251578 GTCACTGGGCTGTAAGCTCTGGG + Intronic
1016625946 6:146169417-146169439 CTCAGTGTTGTGTAAGTTCCAGG + Intronic
1017382523 6:153846844-153846866 GTCACAGTGTTGTAAGGTCCTGG + Intergenic
1017895063 6:158672392-158672414 TTCACTGGGTTTTAAGTCCTGGG + Intronic
1019785606 7:2975274-2975296 CCCACTGGGTCGTCAGTTCCTGG - Intronic
1020403837 7:7808295-7808317 CTCCCTGAGCTGTAAGTTACAGG - Intronic
1021868007 7:24978413-24978435 CTCATTAGGATGTAAGTACCAGG - Intronic
1022992304 7:35720526-35720548 CTTACTTAGTTCTAAGTTCCTGG - Intergenic
1024119174 7:46219999-46220021 CTCCCTGGGATGTATGTTCCAGG + Intergenic
1026847403 7:73705745-73705767 CTCCCTGGGTGCTAAGTACCTGG + Intronic
1029627348 7:101728367-101728389 CTCACTGCTTTGCAAGTCCCGGG - Intergenic
1031115168 7:117659331-117659353 CCCACTGGAGTGGAAGTTCCTGG + Intronic
1031254284 7:119428263-119428285 CTCACTGGGTGAAAACTTCCGGG + Intergenic
1034405659 7:150900997-150901019 CTCGCTGGGTTGAAAGCCCCTGG + Intergenic
1035020860 7:155799482-155799504 CTCCCTGGGATTTATGTTCCAGG - Intergenic
1035746443 8:1964871-1964893 CCCACCGGGTTGTGAGCTCCAGG + Intergenic
1036922038 8:12865711-12865733 CTCACTGTGGTTTTAGTTCCAGG - Intergenic
1039698651 8:39940176-39940198 CTTACTGCGTGGTAAGTTTCTGG + Intronic
1040741602 8:50582362-50582384 CTCACTAGAATGTAAGTTCTAGG - Intronic
1041153870 8:54963691-54963713 CTGAGTGGGTAGTAAGTCCCTGG - Intergenic
1042380217 8:68104700-68104722 CTCACTGGAATGTAACCTCCCGG + Intronic
1042786969 8:72558712-72558734 TTCACTAGATTCTAAGTTCCTGG - Intronic
1045875411 8:106975629-106975651 CTCACCTGATTGTAAGTTCCAGG + Intergenic
1046956802 8:120070366-120070388 CTTGCTGGGTTGTAAGTATCTGG + Intronic
1047367741 8:124227911-124227933 CCCACTGGGCTGTGAGTCCCTGG - Intergenic
1047578062 8:126180203-126180225 CTTACTGGGTTATAAATTCCAGG - Intergenic
1048001777 8:130384903-130384925 CTCACTAGATTATAACTTCCAGG - Intronic
1048600020 8:135909937-135909959 TTCATTGGATTGTAAGTTCCTGG + Intergenic
1049787690 8:144458908-144458930 CTCACTCGGGTGTAAGTGCCGGG - Intronic
1052297652 9:26915878-26915900 CTCACTTGGTATTAAGTTTCAGG + Intronic
1052449194 9:28605530-28605552 CTCACTAAAATGTAAGTTCCTGG + Intronic
1053036838 9:34833302-34833324 CCCACTGGGTTGTGAGATCTTGG + Intergenic
1055677804 9:78682965-78682987 CTCACTAGGTTTTGAGTTCTAGG + Intergenic
1057265358 9:93613894-93613916 CTCTATGGGTTGTCAGCTCCTGG + Intronic
1057991565 9:99776065-99776087 CTCACTGGGTAGTGAGATGCTGG - Intergenic
1058450945 9:105095892-105095914 CCCACTGAGTTGTAAATTCTTGG - Intergenic
1059490468 9:114662330-114662352 CCCACTGGGCTGTGAGTTTCAGG + Intergenic
1059960765 9:119562392-119562414 CTCACTGGCTTACAAGTTCCTGG - Intergenic
1060005730 9:119997870-119997892 CTCACTGGGTCATCAGTTCCTGG + Intergenic
1060425795 9:123504338-123504360 CCCACTGGGAGGTAAGCTCCTGG + Intronic
1186313624 X:8345944-8345966 CTTACTGAGTTGTCAGATCCTGG - Intergenic
1186805779 X:13139197-13139219 CTCACAGGCTTGGAAGTGCCCGG + Intergenic
1186983261 X:14981915-14981937 CTCAGTGGGTTGTATGTGTCTGG - Intergenic
1189253080 X:39616243-39616265 TTCACTGGGCTGTAAGTTTATGG - Intergenic
1191987155 X:66994509-66994531 CTCTCTGGGTTGAAGCTTCCAGG - Intergenic
1192109003 X:68344995-68345017 CTCTTTGGATTGTAAATTCCAGG - Intronic
1194792964 X:98173828-98173850 ATCACTGGGCTGTGAGCTCCTGG + Intergenic
1195596803 X:106700358-106700380 CCCACTAGATTGTAAGTTCCAGG + Intronic
1197346697 X:125332885-125332907 CTCTGGAGGTTGTAAGTTCCTGG - Intergenic
1197991461 X:132322669-132322691 CCCACTGCTTTGTAAGCTCCTGG + Intergenic