ID: 1102474655

View in Genome Browser
Species Human (GRCh38)
Location 12:113180821-113180843
Sequence CTGGGCCCAGCACTGTGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 317}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102474655_1102474662 5 Left 1102474655 12:113180821-113180843 CCCAACCACAGTGCTGGGCCCAG 0: 1
1: 1
2: 3
3: 32
4: 317
Right 1102474662 12:113180849-113180871 ACATCAGTGATGGAGTGCAGAGG 0: 1
1: 0
2: 1
3: 55
4: 936
1102474655_1102474660 -5 Left 1102474655 12:113180821-113180843 CCCAACCACAGTGCTGGGCCCAG 0: 1
1: 1
2: 3
3: 32
4: 317
Right 1102474660 12:113180839-113180861 CCCAGAGTGGACATCAGTGATGG 0: 1
1: 0
2: 5
3: 13
4: 231
1102474655_1102474663 8 Left 1102474655 12:113180821-113180843 CCCAACCACAGTGCTGGGCCCAG 0: 1
1: 1
2: 3
3: 32
4: 317
Right 1102474663 12:113180852-113180874 TCAGTGATGGAGTGCAGAGGCGG 0: 1
1: 0
2: 1
3: 31
4: 304
1102474655_1102474665 10 Left 1102474655 12:113180821-113180843 CCCAACCACAGTGCTGGGCCCAG 0: 1
1: 1
2: 3
3: 32
4: 317
Right 1102474665 12:113180854-113180876 AGTGATGGAGTGCAGAGGCGGGG 0: 1
1: 0
2: 1
3: 40
4: 372
1102474655_1102474664 9 Left 1102474655 12:113180821-113180843 CCCAACCACAGTGCTGGGCCCAG 0: 1
1: 1
2: 3
3: 32
4: 317
Right 1102474664 12:113180853-113180875 CAGTGATGGAGTGCAGAGGCGGG 0: 1
1: 0
2: 2
3: 42
4: 628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102474655 Original CRISPR CTGGGCCCAGCACTGTGGTT GGG (reversed) Intronic
900279685 1:1858596-1858618 CTGGACTCATCACTGTGGTCTGG - Intronic
900529106 1:3144127-3144149 CTGGACCCAGCACTATGGGAGGG + Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
900898989 1:5504129-5504151 CTGGGCTCAGCCCTGGGGCTGGG + Intergenic
901920296 1:12531468-12531490 CTGGGCCCTGCCCTGTGGCCAGG - Intergenic
902973145 1:20069995-20070017 CTGAGCCCAGGACTGAGGTAGGG + Intronic
904236310 1:29119609-29119631 CTGGGCCCATCAGTGTGTGTTGG + Exonic
904405681 1:30286567-30286589 CTGGGCCCAGAACTGAGCTCAGG + Intergenic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
906301070 1:44682067-44682089 CTGAGCCGAGCACTGGGCTTGGG - Intronic
907559961 1:55379218-55379240 CTAGGCCCTGCCCTGTGGTGTGG - Intergenic
907761711 1:57367943-57367965 CTGGGTCCACAGCTGTGGTTTGG - Intronic
908104671 1:60829080-60829102 CTGGGTCAAGCACTGTGCTTAGG + Intergenic
910259002 1:85277747-85277769 CTGGGCCCAAGACGGTGGCTTGG + Intergenic
910798398 1:91121038-91121060 CTGAGCTCAGCACTGGGGTTGGG + Intergenic
911078728 1:93907829-93907851 CTGTGCCCAGGCCTGTTGTTGGG - Intronic
913087942 1:115456531-115456553 CTGGGCCAAGCATTGGGGCTTGG - Intergenic
913213797 1:116603280-116603302 CTGGGGCCACCACTATGGCTGGG + Intronic
914079313 1:144391846-144391868 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914099866 1:144574656-144574678 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
914174214 1:145260393-145260415 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914528878 1:148501577-148501599 CTGGGGCCTGCTCTGTGGTGGGG + Intergenic
914637515 1:149565531-149565553 CTGGGGCCTGCTCTGTGGTGGGG - Intergenic
920372794 1:205490122-205490144 CGGGGCCCAGCAGTGTGCTGTGG - Intergenic
922238114 1:223736581-223736603 CTGGACCCAGCACTGTTGAAAGG - Intronic
923236847 1:232042391-232042413 GTGTGCCCAGCACTGTGCTAGGG + Intergenic
923320638 1:232829620-232829642 CTGTTCCTAGCACTGTGTTTAGG + Intergenic
923921498 1:238569461-238569483 CTGGGCCATGCATTGTGTTTCGG - Intergenic
924422863 1:243925402-243925424 CTGGGCCCTGCACTGGGGAAGGG + Intergenic
1062835031 10:629730-629752 CTGTGCCCAGCAGTGAGGCTGGG - Intronic
1063379404 10:5574999-5575021 CTGGTCCCTGCAGTGTGGGTGGG - Intergenic
1065247338 10:23771810-23771832 CTGGGCACACCACTGGGCTTTGG - Intronic
1066580324 10:36873479-36873501 CTCGGCTCCACACTGTGGTTTGG - Intergenic
1066662279 10:37748217-37748239 CTGGGGCCAGCACAGAGGTGGGG + Intergenic
1067198654 10:44146257-44146279 CTGGGGCCTGCAGTGGGGTTGGG - Intergenic
1067781277 10:49209215-49209237 CAGGGCCCAGGAGTGGGGTTGGG - Intergenic
1069557259 10:69406563-69406585 CTGGGGCCAGCACAGGGGTGGGG - Intronic
1069730558 10:70609094-70609116 CTGGGCCCACCATTGTATTTTGG + Intergenic
1070890707 10:79940662-79940684 CTGGACCCAGCACTGGCATTGGG - Intronic
1071272031 10:84016745-84016767 CTAGCCTCAGCAGTGTGGTTAGG + Intergenic
1072661007 10:97363512-97363534 GTGTGCCCAGCACTGTGCTGAGG - Intronic
1072717453 10:97761170-97761192 GAGGGCCCAGCACTGGGGGTTGG + Intergenic
1074584497 10:114754140-114754162 CTGCGCCCAGCCCTCTGGTCAGG + Intergenic
1074692412 10:116018334-116018356 ATGTGCCCAGCACTGTGCTGTGG + Intergenic
1074756308 10:116627011-116627033 CTGGGCCCTGTCCTGTGGGTAGG + Intronic
1075398686 10:122145970-122145992 CTGGGCCAATCACTGTGCTAGGG + Intronic
1075479725 10:122769505-122769527 CTGTGCCAAGCACTGGGGATGGG + Intergenic
1076229423 10:128807896-128807918 CTGGGAACAGGAATGTGGTTGGG - Intergenic
1076797174 10:132803999-132804021 CAGGGCCCAGCCCTGTGCTTGGG + Intergenic
1076871164 10:133195826-133195848 CTGGGGCCATGACTGTGGTGTGG - Intronic
1076994428 11:291183-291205 CTGGGACCAGGGCTATGGTTGGG + Intronic
1082725390 11:56728595-56728617 GTTGGCCCAGCACTTTGGTATGG - Intergenic
1083486889 11:62988683-62988705 CTGGGCCCGGAATTGTGTTTGGG + Intergenic
1083656592 11:64232718-64232740 CTGGGACCAGTACTGTGCGTTGG - Exonic
1085012851 11:73153225-73153247 CTGGCCCCAGCCCTGTACTTTGG + Intergenic
1085285519 11:75357549-75357571 CTGGGGGCAGCAATGGGGTTGGG - Intergenic
1085308078 11:75499729-75499751 CTGGGCCCAGAGATGGGGTTGGG + Intronic
1086281683 11:85196622-85196644 CTGGTCCCAGCAGTGTGCTAAGG - Intronic
1087769230 11:102189602-102189624 CTGTGCACAGAACTGTAGTTAGG - Intronic
1089290004 11:117431870-117431892 CTGGGGACAGCGATGTGGTTAGG - Intronic
1089696563 11:120219510-120219532 CTGTGCTCAGCACTGAGGGTGGG - Intronic
1089998099 11:122928093-122928115 TTGGGCAAAGCACTGTGGTAGGG - Intronic
1090137232 11:124210512-124210534 CTGGGCCCAGCATGGTGCTGTGG - Intergenic
1090632207 11:128659580-128659602 CTGAACCAATCACTGTGGTTGGG + Intergenic
1090965304 11:131592834-131592856 CTGAGCCCAGCATTGTGGGGAGG - Intronic
1091180670 11:133601574-133601596 CTGTGCCCAGCACTGTGCCAGGG + Intergenic
1092015926 12:5158078-5158100 CTGTGACCAGCACTGTACTTGGG + Intergenic
1094394847 12:29994602-29994624 CCGAGACAAGCACTGTGGTTGGG - Intergenic
1094451473 12:30587050-30587072 CTGGGCCCAGCCATGGAGTTAGG - Intergenic
1095802198 12:46281116-46281138 CTGGACCCAGCAGTGTGGCCAGG + Intergenic
1095991198 12:48035765-48035787 CTGAGCCCATCACTGTGGTTTGG - Intergenic
1097169653 12:57105600-57105622 CTGGGGCCAGGACAGTGGTCAGG + Intronic
1098490708 12:71073697-71073719 CTGGGCTCATCACTGCGGTTGGG + Intronic
1098551280 12:71764031-71764053 ATGTGCCAAGCACTGTGCTTGGG - Intronic
1102474655 12:113180821-113180843 CTGGGCCCAGCACTGTGGTTGGG - Intronic
1104067874 12:125320109-125320131 CTGGGTCCTGCACTGAGCTTTGG + Intronic
1105217027 13:18293831-18293853 CTGGGGCCACCACTATGGCTGGG + Intergenic
1105746718 13:23383897-23383919 CTGTGCCAGGCACTGGGGTTGGG - Intronic
1105966461 13:25388954-25388976 TTGGGCCAAGCTCTGTGGTGTGG + Intronic
1107033158 13:35873723-35873745 CTGGGTCCCTCACTGAGGTTAGG + Intronic
1110645434 13:77877846-77877868 CTGTGCCCAGCATTGTGATGGGG + Intergenic
1111280236 13:86013359-86013381 CTGGCCCCAGCACTGGATTTGGG + Intergenic
1112186791 13:97135547-97135569 GTGAGCCCAGAACTGTGCTTAGG + Intergenic
1112393734 13:99009400-99009422 CTGGTCACAGCACCATGGTTTGG - Intronic
1113873785 13:113582025-113582047 CTGGGTTCAGCCCTATGGTTGGG - Intergenic
1114089463 14:19272108-19272130 CTGACCCCAGCAGTGTGGCTTGG + Intergenic
1118725808 14:68628411-68628433 CCTGGCCCAGCACAGTGCTTGGG + Intronic
1120182868 14:81363872-81363894 CTGGGCCCTCCACTCTGGTTTGG + Intronic
1122269073 14:100560318-100560340 TTGGGCCCAGCTCTGTGTCTTGG + Intronic
1122272003 14:100572490-100572512 GGGGGCCAAGCACTGGGGTTGGG - Intronic
1122482126 14:102054146-102054168 CTGTGCCCAGCACTGCGTTGAGG - Intergenic
1122695008 14:103548237-103548259 CTGGGGGCAGCAGTGGGGTTGGG - Intergenic
1122830423 14:104393085-104393107 CTGGGGCCAGCACTGTGTGGGGG + Intergenic
1122846661 14:104503991-104504013 CTGGGCCCAGCACTGTGGCTCGG - Intronic
1123049295 14:105532869-105532891 CTGGGTGCACCAGTGTGGTTTGG + Intergenic
1123935195 15:25190705-25190727 CGTGGCCCAGCTCTGTGTTTAGG + Intergenic
1123936550 15:25196838-25196860 CATGGCCCAGCTCTGTGTTTGGG + Intergenic
1124103093 15:26713473-26713495 CTGAACCCAGCATTGTGTTTCGG - Intronic
1124177340 15:27438820-27438842 CTGGGCCAAGCACCCTGGCTGGG - Intronic
1124208062 15:27740228-27740250 CTGTGACCAGCCCTGTGCTTGGG + Intergenic
1124797482 15:32795961-32795983 CAGGGCACAACTCTGTGGTTCGG - Intronic
1127349684 15:58138185-58138207 CAGGGCCCGTCACTGTGATTTGG + Exonic
1128087501 15:64896098-64896120 CAGTGCCCAGCACTGGTGTTAGG + Intronic
1130031449 15:80318037-80318059 CTTTGACCAGCACTGTGGATTGG + Intergenic
1130336211 15:82959192-82959214 CTGAGCCCATCACTGTGGCCAGG + Intronic
1132110484 15:99099154-99099176 CTGGGCCAGGCACAGTGGTGTGG - Intronic
1132305244 15:100807412-100807434 CTGGGTCCACAACTGTGGTTTGG - Intergenic
1132676215 16:1122413-1122435 CTGGGCCCAGCTCTGCGGTACGG + Intergenic
1132958380 16:2608687-2608709 CTGGACCCTGCACTGTGGGGAGG + Intergenic
1132970992 16:2688783-2688805 CTGGACCCTGCACTGTGGGGAGG + Intronic
1133194536 16:4159549-4159571 CTGGGCCAAGGACTGTGTGTAGG + Intergenic
1134007201 16:10825885-10825907 CTGTGCCCAGCACGCTGGTGTGG + Intergenic
1134180901 16:12046912-12046934 ATGGACCCAACACTGTGGTCGGG - Intronic
1135307642 16:21380673-21380695 ATGGACCCAACACTGTGGTTGGG - Intergenic
1136304386 16:29359793-29359815 ATGGACCCAACACTGTGGTTGGG - Intergenic
1138420086 16:56893159-56893181 CTGGGCCCAGCAGTGAGCTCAGG + Intronic
1138984573 16:62312534-62312556 CTGAACCAATCACTGTGGTTAGG - Intergenic
1139915356 16:70424931-70424953 CTGGACCAGGCACTGTGGCTGGG + Intronic
1140903370 16:79390793-79390815 CTGGACCAAGCACTGTGGCCCGG - Intergenic
1141309860 16:82903243-82903265 TTTGGCCCAGCACCTTGGTTAGG + Intronic
1142190397 16:88714702-88714724 CTGGGCCCAGCGCTGTGGCCAGG + Exonic
1142225271 16:88874112-88874134 CTGGGGTCAGGACTGTGGTGGGG - Intergenic
1142583514 17:956382-956404 CTGTGCCCAGCACTATGTTCAGG + Intronic
1143070867 17:4292031-4292053 CTGGGCCGGGCACAGTGGCTCGG + Intronic
1143371755 17:6444761-6444783 CTGGGCCCAGCGCTGAAGCTCGG + Intronic
1144223999 17:13127148-13127170 CTGTGCCCAGTCCTGTGGTGTGG - Intergenic
1144669996 17:17127468-17127490 CTGGGCTCAGCACTGCGCTCAGG - Intronic
1144836765 17:18160598-18160620 CTGGGCCAATCACTGTGGCCAGG + Intronic
1145915821 17:28573494-28573516 CTGGGCCAAGGGCTGTGGTATGG + Exonic
1145919759 17:28601495-28601517 GTGGGCCAGGCACAGTGGTTTGG + Intronic
1146057117 17:29587059-29587081 CTGGCCCCACTCCTGTGGTTAGG + Intronic
1146939633 17:36835587-36835609 CAGGGCCTATCACTGTGGTCAGG - Intergenic
1148024203 17:44574465-44574487 CTGGACCCAGCACTTTGCATGGG + Intergenic
1148053287 17:44779647-44779669 CAGGGCCCAGCACTGAGCTCCGG + Intronic
1148106817 17:45123419-45123441 CTGGGATGAGCACTGTGGTGAGG - Intronic
1148146349 17:45367397-45367419 CAGAGCCCAGGAGTGTGGTTCGG - Intergenic
1149556729 17:57578694-57578716 CAGGGGCCAGCAGTGTGGGTTGG + Intronic
1149658171 17:58320947-58320969 CTGGGCCCAGCACTGGGTCCAGG - Intronic
1149697122 17:58624888-58624910 CAGGACCCAGGAATGTGGTTTGG + Intronic
1151149035 17:72067781-72067803 CTGTAACCAGCACTGGGGTTGGG - Intergenic
1151972779 17:77467426-77467448 CTGAGCCCAGCACTGGGGTTGGG + Intronic
1152853448 17:82650177-82650199 CTCGCCCCAGCTCTGTGATTTGG - Intergenic
1155038073 18:22042114-22042136 CTGTGCCAAGCACTGTGCTAGGG - Intergenic
1155198990 18:23501371-23501393 CTGAGCCCAGGAGTTTGGTTTGG - Intergenic
1156807816 18:41208188-41208210 CTGATCCGGGCACTGTGGTTAGG + Intergenic
1157381212 18:47219633-47219655 CATAGCCCAGCACTGTGTTTGGG + Intronic
1157863909 18:51165003-51165025 TTGGGCCCAGCATTCTGCTTGGG - Intergenic
1158503871 18:58028729-58028751 CTGAACCCATCACTGTGGCTGGG + Intergenic
1158923616 18:62225835-62225857 GTGGGCCAAGCACTGTGTTAAGG + Intronic
1160818018 19:1045142-1045164 CGGGGCCCAGGTCTGGGGTTGGG - Exonic
1162345259 19:10114895-10114917 CTGTGGCCAGCGCTGTGGGTGGG - Exonic
1162428568 19:10612685-10612707 CTGGCACCAGCACTGTGACTGGG + Intronic
1162783290 19:13018403-13018425 CTAGACCCAGCACTGGGGTGTGG + Intronic
1163637859 19:18445702-18445724 CAGGGCCCAGCCCTGTAGTCAGG + Intronic
1164180874 19:22817473-22817495 CTGGGCCCAGCAATTAGGTGAGG + Intergenic
1165406391 19:35633711-35633733 CTGGGCCTAGGCCTGGGGTTGGG + Exonic
1165831957 19:38734919-38734941 CTGGGCCAAGCCCTGTGCTAGGG + Intronic
1165878230 19:39024864-39024886 CTGGTCCCAGCCCTGTAGCTCGG + Exonic
1165914452 19:39248942-39248964 CTGGGGCCAGCTCTGATGTTGGG - Intergenic
1166054936 19:40282809-40282831 CTCTGCCCAGCCCTGTGCTTTGG - Intronic
1166504461 19:43362276-43362298 CTGGCCCCAGCGCTGTGGTGGGG + Exonic
1166506100 19:43372764-43372786 CTGGCCCCAGCGCTGTGGTGGGG - Intergenic
1166833733 19:45654042-45654064 AAGTGCCCAGCACAGTGGTTTGG + Intergenic
1166994664 19:46714416-46714438 CCAGGCCCAGCACTGGGGTGGGG + Intronic
1167608030 19:50492255-50492277 CAAGGGGCAGCACTGTGGTTAGG - Intergenic
1167663147 19:50808267-50808289 CTGGGGACAGGACTGTGATTGGG - Intergenic
924959284 2:19180-19202 CTGGGCCTGGCACTGGAGTTTGG - Intergenic
926549718 2:14287244-14287266 CTGGGCCCAGCACAATTGTATGG + Intergenic
927812923 2:26190165-26190187 CTGGTCCCAGCTCTGTAGCTGGG - Intergenic
927911603 2:26903777-26903799 CTGGGCCCCGGGCTGGGGTTTGG - Intronic
932223945 2:70024400-70024422 CTGGGCCTGTCACTCTGGTTTGG + Intergenic
932402940 2:71494656-71494678 CTGTGCCTAGCACTGTGCCTTGG + Intronic
936449231 2:112621003-112621025 CTGAGCCCAGCCATGTGGTGTGG - Intergenic
937061733 2:118985060-118985082 CTGGGCCAGGCACTGTGCCTGGG + Intronic
937082151 2:119147830-119147852 GTGTGCCCAGCACCGTGGTGGGG - Intergenic
937150590 2:119683173-119683195 CTGGGCCCCTCACTGTGGGCTGG + Intronic
937239540 2:120451323-120451345 GTGGGGACAGCACTGTGGTGTGG + Intergenic
937298172 2:120822283-120822305 CTGGACCCAGCAGTGTGCTATGG + Intronic
937363623 2:121245565-121245587 CCTGGCCCAGCTCCGTGGTTTGG - Intronic
937463929 2:122112659-122112681 CTGAGCCAAGCACTGTGCTAGGG - Intergenic
938244494 2:129766246-129766268 CTGGGCCCAGCCCTGGTGTGTGG + Intergenic
938928751 2:136067522-136067544 CTCGGCCCAGCACAGTGGCTGGG + Intergenic
943687902 2:190838740-190838762 CTGGGCTCAGCTTGGTGGTTTGG + Intergenic
943723718 2:191231747-191231769 CTTGGCCCAGCAATATGCTTTGG - Intergenic
943895332 2:193350488-193350510 CTGGGCCTATCACTGAGCTTGGG + Intergenic
945065834 2:205946922-205946944 CTGTGCCCAGCACTGAGATTTGG - Intergenic
946019315 2:216629960-216629982 CTGTGCCCAGCAGTGAGGATTGG - Intergenic
947824781 2:233098310-233098332 ATGGGACCAGCACCGTGGATAGG + Intronic
947983594 2:234429887-234429909 CTAGGCCATGCACTGTGCTTTGG + Intergenic
948401342 2:237687876-237687898 CTGCGCCTCCCACTGTGGTTTGG - Intronic
948593444 2:239065291-239065313 CTGGGACCAGCACCTTGGTCTGG + Intronic
948650385 2:239440024-239440046 CAGGGCCCAGATCTGTGGCTTGG - Intergenic
948756798 2:240164815-240164837 CTGTGCCCAGCCCTGTGCTGGGG - Intergenic
948980900 2:241494241-241494263 CTGGCACCAGCAGTGTGGGTGGG + Exonic
1169107738 20:3011341-3011363 GTGTGCCAAGCACTGTGGGTAGG + Intronic
1170111491 20:12808708-12808730 CTGAACCCAGCAGTGTGGCTGGG + Intergenic
1170347704 20:15405424-15405446 ATGGGCCCAGCACCGTGGTGTGG + Intronic
1171517354 20:25747967-25747989 CTGTGACTAGCACTGTGATTGGG + Intergenic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172691986 20:36796479-36796501 TTGGGCCCAGCCCTGTGCTATGG - Intronic
1172842827 20:37912389-37912411 CTGGGTCCAGCACTGTTAGTGGG + Intronic
1172931696 20:38591106-38591128 GTGGGCCCTGCACTGGGGTCTGG + Intergenic
1173340665 20:42149899-42149921 ATGGGCTCAGCTCTGTGGATAGG - Intronic
1173447374 20:43131219-43131241 CAGGGCTCAGCACAGTGGTGTGG - Intronic
1173734122 20:45347811-45347833 CTGGGGCCAGAACTGAGGTTAGG + Intronic
1174707779 20:52674776-52674798 CTGGACCCATCACTGTGGCCAGG + Intergenic
1174786589 20:53438523-53438545 CTGGACCAATCACTGTGGCTAGG + Intronic
1175923689 20:62461859-62461881 TTGCACCCAGCACTGTGGTCTGG + Intergenic
1176050049 20:63114292-63114314 CTGAGACCTGCACTTTGGTTTGG + Intergenic
1178376021 21:32068007-32068029 CAGGGCCCTGCACTGTGAATAGG + Intergenic
1179368131 21:40778391-40778413 CTGGGCCAGGCACGGTGGCTGGG - Intronic
1179727162 21:43347063-43347085 CTGGCCCCCTCACTGTGGTCTGG - Intergenic
1180122550 21:45763641-45763663 CTGCGCCCACCAGTGTGGTCCGG + Intronic
1180242341 21:46518346-46518368 CTTGGCCCATCAGTGTGGGTGGG + Intronic
1180491242 22:15850239-15850261 CTGACCCCAGCAGTGTGGCTTGG - Intergenic
1180672862 22:17566692-17566714 CTGGGCCAGGCACGGTGGCTCGG - Intronic
1181015556 22:20066541-20066563 CTGAGCCCAGCAAAGTGGTCTGG - Intergenic
1181310757 22:21943610-21943632 CTGACCCCAACACTTTGGTTCGG + Intronic
1182061050 22:27397715-27397737 CTGGCCCCAGGACTGTGGAGAGG - Intergenic
1182580303 22:31304940-31304962 CTGGCCACAGCCCTGGGGTTTGG - Intergenic
1183947286 22:41333721-41333743 ATGGGCCAAGCACTGAGCTTGGG + Intronic
1184412506 22:44333058-44333080 CGCTGCCCAGCACTGTGGTGAGG - Intergenic
949341425 3:3034837-3034859 CTGGACACAGCACTGTGGCAAGG + Intronic
949448036 3:4155981-4156003 CTGGGCCCAGCAGTCTAGTTAGG + Intronic
950432477 3:12958871-12958893 CTAAGCCCAGCACTGTGGGGTGG + Intronic
950704995 3:14773948-14773970 GTGGGCCCAGCGCAGGGGTTAGG - Intergenic
950858313 3:16125858-16125880 CTGGGACCACCACTGTGCTTTGG + Intergenic
951556941 3:23930316-23930338 CTAAGCCCAGCACTTTGGGTTGG + Intronic
951576274 3:24117466-24117488 CTGAGCCAATCACTGTGGTGAGG - Exonic
953107304 3:39896315-39896337 CTGGGCCCACCCCTGTGCATCGG + Intronic
953493836 3:43370123-43370145 CTTGGGCCAGGGCTGTGGTTAGG - Intronic
954004691 3:47581388-47581410 CTGAGCACAGGACTGTGGTAGGG + Intergenic
954396390 3:50295568-50295590 CTGGGCCCAGCCCTGGTGCTGGG - Exonic
954764309 3:52900248-52900270 CTGGTTCCAGCACTGTCCTTAGG - Intergenic
954861006 3:53690482-53690504 CTGAGCCCAGCCCTGGGGTGTGG + Intronic
954971532 3:54655352-54655374 GTGTGCCCAGCACTGAGCTTGGG - Intronic
956450499 3:69370305-69370327 CTGCACCCGGCCCTGTGGTTGGG - Intronic
956700566 3:71955339-71955361 GTGTGCCCAGCACGGTGGTGTGG + Intergenic
959545438 3:107590831-107590853 CTGTGCCCAGCACTTGGGTTGGG + Intronic
961318670 3:126057522-126057544 CTGAACCCAGCACTGTGGTCGGG + Intronic
961345968 3:126263628-126263650 CTGTGCCCAGCACTGGGGCTAGG - Intergenic
961464811 3:127074878-127074900 CTGGGCTGAGCTCTGTGGTCTGG + Intergenic
961464863 3:127075204-127075226 CTGGGCTGAGCTCTGTGGTTTGG + Intergenic
961545796 3:127632097-127632119 CTGTGCACAGTACTGTGGTCTGG - Intronic
962105343 3:132383366-132383388 CTGGGTCCACAGCTGTGGTTTGG + Intergenic
967412329 3:189179688-189179710 CTGGGCCAAGTACTGTGCTGGGG - Intronic
967506588 3:190259553-190259575 CTGAGACCATCAATGTGGTTAGG + Intergenic
969045470 4:4333460-4333482 CTGGCCCCAGTCCTGTGGTTTGG - Intergenic
969249397 4:5957055-5957077 CTGGGTCTAGCACTTTGGGTCGG - Intronic
970459822 4:16262444-16262466 GTGGGCCCAGCAGTGTGGGGAGG - Intergenic
970776426 4:19679699-19679721 CTGAGCCCAGCCCTGTGGAGGGG + Intergenic
973749404 4:53998645-53998667 CTGTGCCCAGCCCAGTAGTTTGG - Intronic
974630526 4:64481642-64481664 CTGAGCACAGCAGTGTGTTTAGG - Intergenic
975344983 4:73283129-73283151 TTGGGCCCTTCACTGAGGTTTGG + Intergenic
976472401 4:85445070-85445092 ATGGCCCCAGCACTGGGGATAGG + Intergenic
979813113 4:125064638-125064660 CTGGACCCAGCAATGTGGCTGGG + Intergenic
985817170 5:2135617-2135639 CCAGGCCCAGCACTGTGCTGAGG + Intergenic
986977677 5:13411607-13411629 CTGGACCCAGCACAGTGCTGTGG - Intergenic
989193620 5:38694768-38694790 CAGAGCCCAGGCCTGTGGTTTGG - Intergenic
991631491 5:68660789-68660811 CTCGGTCCTGCACTGTGGTGTGG + Intergenic
994288699 5:98001555-98001577 CTGGGCTCAGCTGTGTGGATCGG + Intergenic
997183512 5:131858047-131858069 CTGGCCACAGCACTGTGATGGGG - Intronic
997384984 5:133465482-133465504 CTGGGCTCAGCACCCTGCTTGGG - Intronic
997733603 5:136197826-136197848 CTGGGAACAGGACTGTTGTTTGG + Intergenic
998040247 5:138946938-138946960 CTGGGCACAGCCCTGTGGCCGGG - Exonic
1000240466 5:159403971-159403993 ATGGGCACAGCCCTGTGATTTGG + Intergenic
1001144737 5:169173933-169173955 CTAGACCCATCACTGTGGATGGG - Intronic
1001276800 5:170357201-170357223 CCGGACCCTGCACTGTGGCTCGG + Intronic
1001580685 5:172796248-172796270 GTGGGCCCAGCACTGTGCCAAGG - Intergenic
1001930302 5:175668199-175668221 GTGGGCCAAGCACTGTGGTGTGG + Intronic
1002290874 5:178199902-178199924 CTGGGCCTGGCACTGAGATTTGG - Intergenic
1004315383 6:14582262-14582284 CTGGCACCAGCATTGTGGATGGG - Intergenic
1006069503 6:31488009-31488031 CTGTGCCCAGCACTAGGATTTGG - Intergenic
1006628622 6:35415158-35415180 CTGGGCCCAGCACTGTGCCCAGG + Intronic
1006980549 6:38144486-38144508 CTGGGCGCAGCACAGTGATGGGG - Intronic
1007107837 6:39295649-39295671 CTGGGACCAGCACTGTGTGTGGG + Intergenic
1007744716 6:44036464-44036486 CTGGGCTAAGCATAGTGGTTGGG + Intergenic
1016413078 6:143804131-143804153 CTCGGCCCAGCAGTTTGTTTGGG + Intronic
1016426084 6:143937149-143937171 TTGAGCCCAGCAGTGTTGTTAGG - Intronic
1017352524 6:153459127-153459149 CTGTGCCCTGCACTCTAGTTGGG - Intergenic
1017714571 6:157200127-157200149 CTGGTCCCAGCACTGAGGACAGG - Intronic
1018798009 6:167202218-167202240 CAGGGCCCAGCACCGAGGTAAGG - Intergenic
1018814705 6:167321953-167321975 CAGGGCCCAGCACCGAGGTAAGG + Intergenic
1018835197 6:167477912-167477934 CTGAGCCCAGCACTGTGACCAGG + Intergenic
1019913672 7:4116878-4116900 CTGGGCCCAGCCCTGCTGCTTGG - Intronic
1019924822 7:4185291-4185313 CTGGGCCCAGAACTCTGGCTGGG - Intronic
1020006772 7:4787609-4787631 GTGGGCACAGCACAGCGGTTCGG - Intronic
1025050534 7:55730449-55730471 CAGAGCCCACCCCTGTGGTTTGG + Intergenic
1026399126 7:69991322-69991344 CTGGGCACAGCAATGTGAATTGG + Intronic
1027423319 7:78038193-78038215 ATGTGCCCAGCACTGTGTTAGGG - Intronic
1028427553 7:90707032-90707054 CTGGGCCCAGCTCTGTTTCTAGG + Intronic
1029405570 7:100372584-100372606 ATGGGCCCAGGACTGTGTGTGGG + Intronic
1029546994 7:101215903-101215925 CTGGACCCAGGACTGAGGGTAGG - Exonic
1032332306 7:130991955-130991977 CAGAGCCCAGCTCTGTGGCTCGG - Intergenic
1032708552 7:134443007-134443029 ATGTGCCCAGCACTGTGCCTGGG + Intronic
1033814817 7:145058809-145058831 CTGGGCTCAGCACTGGGGACAGG + Intergenic
1034487396 7:151374427-151374449 CTGGGCCAAGCACTGAGCATGGG - Intronic
1034567183 7:151924545-151924567 CTGGGCCCACCCCTGCGATTTGG - Intergenic
1035430995 7:158821683-158821705 CTGGGCCCAGCAGTGAGGAAAGG - Intronic
1037567076 8:20127024-20127046 CGGGGCCCAGGACTGTGGAGAGG + Intergenic
1038536406 8:28356364-28356386 CTGAGCCCAGCACTTTGGTGGGG - Intronic
1043935555 8:86138102-86138124 CTGGGCCGAGCACTGGAGCTGGG - Intronic
1044529079 8:93287786-93287808 CTGGTCCCAGCACAGTCTTTTGG - Intergenic
1047999734 8:130368512-130368534 CTGGGTCCAGCCCTTTAGTTGGG - Intronic
1048339223 8:133525911-133525933 CTGGGTCCAGAGCTGTGGCTAGG + Intronic
1049069558 8:140345979-140346001 CTGGACACAGCCCTGGGGTTGGG + Intronic
1049108477 8:140628208-140628230 CTGGGCCGAGCTCTGGGGTGGGG - Intronic
1049546559 8:143234440-143234462 CTCCCCCCAGCACTGTGGTTCGG + Intergenic
1049781797 8:144432509-144432531 CTGGGCCCAGAACTTGGGGTGGG - Intronic
1051199066 9:14597326-14597348 CTGGACTCAGCAGTGTGGCTGGG + Intergenic
1051369222 9:16344054-16344076 CTGGCCCCAGCACTTTGCTGGGG + Intergenic
1051503750 9:17805787-17805809 ATGGTCCAAGCACTGTGGTGAGG + Intergenic
1053002592 9:34585580-34585602 CCGGGCACAGCTCTGTGCTTTGG + Intronic
1053521934 9:38789573-38789595 CTGGGTCAAGCTCTGTGGTCTGG - Intergenic
1054194100 9:62013561-62013583 CTGGGTCAAGCTCTGTGGTCTGG - Intergenic
1054644307 9:67575130-67575152 CTGGGTCAAGCTCTGTGGTCTGG + Intergenic
1055030610 9:71768877-71768899 CTGGGCCGGGAACTGTGGATTGG + Exonic
1057268621 9:93634759-93634781 CTGGGCCCAGTACTGGGCATAGG + Intronic
1057555010 9:96081086-96081108 ATGTGCCCAGCACTGTGATAAGG + Intergenic
1059299012 9:113297983-113298005 CTGAGGCCAGCACTGTGGGCTGG + Exonic
1059437176 9:114283912-114283934 CTGGGCCCAGAGCCGTGGTTGGG + Intronic
1060812247 9:126616323-126616345 CTGGCCTCAGCCCTGAGGTTTGG - Intronic
1060820201 9:126657513-126657535 CTGGGGTCAGGACTGGGGTTGGG + Intronic
1061208404 9:129177275-129177297 CTAGGTCCAGCACGGTGGTCTGG + Exonic
1061559337 9:131393102-131393124 CTGGGTCCAGCAGTGTGGCCTGG + Intergenic
1061845319 9:133384977-133384999 CTGGGCCCACCACTGTGCTTCGG - Intronic
1061864270 9:133484551-133484573 GTGTGCCCAGCACTATGGATTGG - Intergenic
1062367555 9:136218471-136218493 CTGTTCCCAGCACTGGGGCTGGG - Intronic
1062489686 9:136799193-136799215 CGGGGCCCAGGACTGGGCTTTGG + Exonic
1062591435 9:137276533-137276555 GTGGCCCCAGCACGGAGGTTGGG - Intergenic
1185642441 X:1596304-1596326 CTGGGTCGTTCACTGTGGTTGGG + Intronic
1186415893 X:9382719-9382741 TTGGGCCCAGCACTGTGTCAGGG - Intergenic
1187376636 X:18761263-18761285 CTGGGCCAAGCACTGTGCTAAGG - Intronic
1189354351 X:40299638-40299660 CTTTGCCTAGCACTTTGGTTTGG + Intergenic
1190735032 X:53250545-53250567 CTGGGCCCAGTGGTGTGGCTGGG - Exonic
1192167120 X:68833167-68833189 CTGGGGCCAACACTTTGGCTTGG - Intronic
1192344647 X:70290859-70290881 ATGTGCCAAGCACTGTGCTTGGG + Intronic
1192566229 X:72165975-72165997 TTGGGCTCAGGACAGTGGTTGGG - Intergenic
1193418159 X:81249650-81249672 CTGGGCCCAGCAGTGTTCTGGGG - Intronic
1195432428 X:104804250-104804272 GGGTGCCCAGCAATGTGGTTGGG + Intronic
1198810761 X:140534053-140534075 CTGAGCTCAGCACTGTGTTATGG + Intergenic
1200052800 X:153443870-153443892 CTGGCCACCGCACTGTGCTTTGG - Intergenic
1200820847 Y:7581086-7581108 CTGGATGCAGCAATGTGGTTGGG + Intergenic
1200893112 Y:8344544-8344566 CTGAGCCCAGCACTCAGGATAGG + Intergenic
1200971956 Y:9162182-9162204 CTTGGCCCTGCACTTTGGCTGGG + Intergenic
1202239459 Y:22751656-22751678 CTGGATGCAGCAATGTGGTTGGG - Intergenic
1202248432 Y:22843290-22843312 CTGAGCCCAGCACTCAGGATAGG + Intergenic
1202252964 Y:22891960-22891982 CTGGGCCCAGCACTAATGTGAGG - Intergenic
1202392446 Y:24385418-24385440 CTGGATGCAGCAATGTGGTTGGG - Intergenic
1202401420 Y:24477038-24477060 CTGAGCCCAGCACTCAGGATAGG + Intergenic
1202405954 Y:24525709-24525731 CTGGGCCCAGCACTAATGTGAGG - Intergenic
1202464826 Y:25144372-25144394 CTGGGCCCAGCACTAATGTGAGG + Intergenic
1202469361 Y:25193048-25193070 CTGAGCCCAGCACTCAGGATAGG - Intergenic
1202478338 Y:25284699-25284721 CTGGATGCAGCAATGTGGTTGGG + Intergenic