ID: 1102476037

View in Genome Browser
Species Human (GRCh38)
Location 12:113189151-113189173
Sequence GTGTAGAGACATTTGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102476030_1102476037 16 Left 1102476030 12:113189112-113189134 CCTTAATTACCTTTAATTAATCT 0: 1
1: 0
2: 0
3: 27
4: 391
Right 1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG 0: 1
1: 0
2: 3
3: 13
4: 198
1102476028_1102476037 30 Left 1102476028 12:113189098-113189120 CCATGTCTGGCCAGCCTTAATTA 0: 1
1: 1
2: 2
3: 21
4: 285
Right 1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG 0: 1
1: 0
2: 3
3: 13
4: 198
1102476031_1102476037 7 Left 1102476031 12:113189121-113189143 CCTTTAATTAATCTAAATAATTA 0: 1
1: 0
2: 8
3: 84
4: 741
Right 1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG 0: 1
1: 0
2: 3
3: 13
4: 198
1102476029_1102476037 20 Left 1102476029 12:113189108-113189130 CCAGCCTTAATTACCTTTAATTA 0: 1
1: 0
2: 2
3: 43
4: 339
Right 1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG 0: 1
1: 0
2: 3
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102476037 Original CRISPR GTGTAGAGACATTTGGGGTT AGG Intronic
901756613 1:11445048-11445070 GAGTAGATACATCTGGGGGTTGG + Intergenic
902462430 1:16588295-16588317 GTGTAGGGGCATTTGGTGGTAGG - Intronic
904051528 1:27642405-27642427 GTATAGTCACATTAGGGGTTAGG + Intergenic
904270478 1:29346632-29346654 GGGTATAGACACTTGGGGTGCGG + Intergenic
905710165 1:40095443-40095465 TTGTAGAGGCATTTGGAGTGTGG - Intronic
905841759 1:41186616-41186638 ATGTAGTCACATTGGGGGTTAGG - Intronic
908519368 1:64926371-64926393 GTGTGGAGCCACTTGGGGGTGGG - Intronic
908592166 1:65646612-65646634 GTGTAGAGATATAAGAGGTTGGG + Intergenic
909242607 1:73234328-73234350 GTCTAGGGGCATTTGGGGTAGGG - Intergenic
909788460 1:79643452-79643474 GTGCAGAGATATAAGGGGTTGGG + Intergenic
909838707 1:80290040-80290062 GTGATGAAACAATTGGGGTTTGG - Intergenic
911153077 1:94613574-94613596 TGGAACAGACATTTGGGGTTGGG + Intergenic
913072378 1:115311484-115311506 GTCTAGAGACATTTTTGGTAAGG + Intronic
915363019 1:155297186-155297208 TTGGAGAGACATTTGGGAGTTGG - Intronic
915837921 1:159192739-159192761 CTGTAGAGACACTGGGGTTTGGG - Intronic
917148164 1:171914905-171914927 AGGTAGAGACATGTGGGGGTGGG + Intronic
921458740 1:215403903-215403925 GTTTTGAGATATTAGGGGTTAGG + Intergenic
921493801 1:215811677-215811699 GTGGGCAGACATTTGAGGTTGGG + Intronic
921687794 1:218110096-218110118 GAGTAGTGACATATGGGATTTGG + Intergenic
922972363 1:229753546-229753568 GTGAGGAGACATTTGGTGTTAGG + Intergenic
923395838 1:233561465-233561487 GTGTGGATACACTGGGGGTTAGG - Intergenic
1064272476 10:13877958-13877980 GTGGGGAGACTTTTGGGTTTGGG - Intronic
1064604422 10:17023987-17024009 GAGTTGAGATATTTGGGGGTAGG - Intronic
1064862492 10:19843082-19843104 TTGTAAAGACATTAGGGGTCCGG - Intronic
1066270845 10:33821191-33821213 GTGTTGGGACTTTTGGAGTTTGG + Intergenic
1066354360 10:34667345-34667367 GTGGAATGACACTTGGGGTTTGG - Intronic
1070499691 10:77060639-77060661 GGGTTGAGACTTTTGGGGATGGG + Intronic
1071568910 10:86685868-86685890 GAGTAGAAGCATTTGGGGGTGGG + Intronic
1071715879 10:88094848-88094870 GTGCAGAGAAATGTGGGGTGGGG - Intergenic
1072115502 10:92366742-92366764 GTGCAGAGACACCTGGGGCTGGG + Intergenic
1075482278 10:122792137-122792159 GTGTAGACACAGTTGTGGTTTGG - Intergenic
1078234663 11:9473093-9473115 GAGTAAAGACATTTGGGGCCGGG + Intronic
1078766118 11:14300320-14300342 GTGGAGAAACATTTAGGATTAGG + Intronic
1082765074 11:57161177-57161199 GTATAGAGGGTTTTGGGGTTTGG - Intergenic
1084155359 11:67310120-67310142 GTGTAGAGACTTCAGGGGCTGGG - Exonic
1086284930 11:85236821-85236843 GATTAGACACATTTGGGCTTAGG - Intronic
1090045096 11:123324574-123324596 GAGTATAGAAATTTGGGGGTTGG - Intergenic
1090158589 11:124467532-124467554 GTGTGGTGAGATTTGGGGATGGG + Intergenic
1090341852 11:126030019-126030041 GTTTAGTGACATTTGGACTTTGG - Intronic
1092013880 12:5140236-5140258 GTGTAAACACTTTTGGGGGTGGG + Intergenic
1092668607 12:10836226-10836248 GTGGAGAGACTTTCTGGGTTGGG - Intronic
1093657604 12:21714710-21714732 GTGCAGAAACATTTTGTGTTTGG + Intronic
1095312148 12:40712013-40712035 GTTTAAAGAAATTTGGGGCTGGG - Intronic
1096004271 12:48156588-48156610 TTGTAGAGACGATTGGGTTTTGG - Intronic
1096203499 12:49703404-49703426 GTATTGAGAAGTTTGGGGTTGGG - Intronic
1097169868 12:57106570-57106592 GTGCAGAGACACTGAGGGTTGGG + Exonic
1097424580 12:59427649-59427671 GTGTTGAGAGATTGGGTGTTTGG - Intergenic
1099902888 12:88734556-88734578 GTGTAGAGATAAATGGGGGTGGG - Intergenic
1101921855 12:108939478-108939500 GTATGTAGTCATTTGGGGTTGGG - Intronic
1102184101 12:110934401-110934423 TAGGAGAGACTTTTGGGGTTGGG + Intergenic
1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG + Intronic
1102928731 12:116846448-116846470 TTGTAGAGACATATGGGGCATGG + Intronic
1103048463 12:117758888-117758910 TGGAAGAGGCATTTGGGGTTTGG - Intronic
1103677300 12:122666036-122666058 GTTGATGGACATTTGGGGTTGGG + Intergenic
1104927666 12:132322001-132322023 GAGGAGAGACAGTGGGGGTTTGG - Intronic
1104972513 12:132538370-132538392 GTGAAGAGACAGCTGGGGATGGG - Intronic
1105048992 12:133030822-133030844 TTCTACAGCCATTTGGGGTTTGG + Intergenic
1106900070 13:34346403-34346425 GTGTTGGGATATTTGTGGTTTGG - Intergenic
1107906017 13:45061900-45061922 CTATAGAAACTTTTGGGGTTGGG + Intergenic
1110387085 13:74925442-74925464 GTGTTGAGAGATTTGTGGTGTGG - Intergenic
1113011083 13:105766265-105766287 CTGTAGAATAATTTGGGGTTTGG - Intergenic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1118169445 14:63372588-63372610 GTTTAGAGTTTTTTGGGGTTTGG - Exonic
1118460908 14:65986154-65986176 GTGGGGAGCCATTGGGGGTTTGG + Intronic
1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120438263 14:84504947-84504969 GTGCAGAGATATAAGGGGTTGGG + Intergenic
1120676975 14:87431909-87431931 ATCTAGTGACATTGGGGGTTAGG - Intergenic
1123412524 15:20072408-20072430 GTGTTTACACATATGGGGTTTGG + Intergenic
1123521866 15:21079521-21079543 GTGTTTACACATATGGGGTTTGG + Intergenic
1129114910 15:73359944-73359966 TGCTAGAGACCTTTGGGGTTTGG - Intronic
1132022747 15:98377189-98377211 GGGTAGAGGAATCTGGGGTTGGG - Intergenic
1132174007 15:99693628-99693650 GGGTAGAGAATTTTGGGGTGAGG - Intronic
1133567978 16:7013104-7013126 GTCTAAAGACATTTGGAGATGGG - Intronic
1135462289 16:22655236-22655258 ATTCAGAGGCATTTGGGGTTAGG - Intergenic
1136740145 16:32512608-32512630 GTGAAGAGATATTTGGGGGAGGG - Intergenic
1139076200 16:63451927-63451949 ATTTTGAAACATTTGGGGTTTGG - Intergenic
1139808402 16:69589988-69590010 TTGTAGAGACAGTTGGGGAGGGG - Intronic
1140476354 16:75241173-75241195 GTGTTTACACATATGGGGTTTGG + Intronic
1141016542 16:80456235-80456257 GTATAGACACATGTGGGGTCAGG - Intergenic
1203012763 16_KI270728v1_random:314729-314751 GTGAAGAGATATTTGGGGGAGGG + Intergenic
1203031098 16_KI270728v1_random:587888-587910 GTGAAGAGATATTTGGGGGAGGG + Intergenic
1203040623 16_KI270728v1_random:746543-746565 GTGAAGAGATATTTGGGGGAGGG - Intergenic
1142955821 17:3521127-3521149 GTGAAGAGACAGTTAGGGTGGGG - Intronic
1143157523 17:4847795-4847817 GTGTAGAGAGATCTCAGGTTGGG + Intronic
1143774877 17:9192504-9192526 GTCTGGAGATATTTTGGGTTGGG + Intronic
1144114853 17:12078046-12078068 GTACAGTCACATTTGGGGTTAGG + Intronic
1145793979 17:27645112-27645134 GTGTACAGGGCTTTGGGGTTGGG - Intronic
1146126908 17:30237448-30237470 CAGTAGGGACATTAGGGGTTAGG + Intergenic
1147322250 17:39653381-39653403 GTGTAGAGACAAATGCGTTTGGG + Intronic
1147357073 17:39906498-39906520 GTGGAGAAGAATTTGGGGTTGGG - Intronic
1148386029 17:47235802-47235824 GGGTAGAGAAAATTGGGGTGGGG - Intergenic
1150676186 17:67246750-67246772 GTGTAGACACATTAAGGGATTGG + Intergenic
1151549775 17:74815471-74815493 GTGCAGAGAAATTTGGGGATGGG + Intronic
1152182045 17:78828548-78828570 GTTTAGAGACATGTGGGCTGGGG - Intronic
1153178737 18:2408721-2408743 GAGGAGAGCCATTAGGGGTTGGG - Intergenic
1156355910 18:36339665-36339687 GTGCAGAGAGAGTTGGGGTTGGG + Intronic
1158827186 18:61236053-61236075 CTGTAGAGATATCTAGGGTTGGG - Intergenic
1164752276 19:30665791-30665813 GCGTGGAGAGATTTGGGGTTTGG + Intronic
1164814619 19:31185709-31185731 GTGTAGAGACAGATGAGTTTTGG + Intergenic
1167901954 19:52628801-52628823 GTGCAGAGATATAAGGGGTTGGG - Intronic
1168072616 19:53961338-53961360 GTGGAGAGACATTTGGGGTCTGG + Intergenic
1168289422 19:55350311-55350333 GTCTGGAGACATTTTTGGTTGGG - Exonic
928357306 2:30630287-30630309 GTATAGTCACATTGGGGGTTAGG + Intronic
928923290 2:36548962-36548984 CTGTAGAGATATTTGGGGTGGGG + Exonic
928981514 2:37140322-37140344 ATGTAAGGACATTTGTGGTTAGG + Intronic
929411363 2:41700345-41700367 GTCAGGTGACATTTGGGGTTTGG - Intergenic
932398798 2:71465913-71465935 GTGTAGAGATTGTTGGGGATGGG + Intronic
934081633 2:88473374-88473396 GTGCAGAGACATTGGTGCTTAGG + Intergenic
934949079 2:98564133-98564155 GTGAACAGTGATTTGGGGTTGGG + Intronic
936072841 2:109382829-109382851 GTGCAGAGACATTTGGCTGTTGG + Intronic
938119577 2:128624101-128624123 TTACAGTGACATTTGGGGTTTGG + Intergenic
938144864 2:128824763-128824785 GAGAAGAGACATTTTGGTTTTGG - Intergenic
940352280 2:152703404-152703426 CTTTAGAGAGATTTGGGGTTTGG - Intronic
941502317 2:166295119-166295141 GTGAAGAGATATTTGGGCTGGGG + Intronic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
942428983 2:175889379-175889401 GTCAAGAGACATTTGGTCTTAGG - Intergenic
943337058 2:186628591-186628613 GTGTAGACACATGTGGTGTCAGG - Intronic
944103878 2:196058449-196058471 GTGGAGAGACACATGGGGATAGG - Intronic
946334373 2:219027681-219027703 GTGTAAAGGCAGTTGGGGTGAGG + Exonic
1171876717 20:30584694-30584716 GTTAAGAGACGTTAGGGGTTAGG - Intergenic
1173668611 20:44781594-44781616 GAGTAAATGCATTTGGGGTTGGG + Intronic
1173756141 20:45518147-45518169 GTCTAGAGACATTTTTGATTGGG + Intergenic
1173781445 20:45760361-45760383 GTGCAGAGATATAAGGGGTTGGG - Intronic
1174704069 20:52637954-52637976 GTATAGTGACATTTGAGGCTAGG + Intergenic
1174972606 20:55293306-55293328 GTGGAGAGACAGTTTGGGCTGGG + Intergenic
1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG + Intronic
1181985970 22:26800049-26800071 GAGTAGAGAGACTGGGGGTTGGG + Intergenic
1182276139 22:29189979-29190001 GTGAAGAGAGGTTTGGGGTTGGG + Intergenic
1182551728 22:31104377-31104399 GTGAAGACACACTTGGGGTCAGG - Exonic
1183483633 22:38077949-38077971 GTGTAGAGACACAAGGGGCTGGG - Intergenic
1183550888 22:38484135-38484157 GCTTAGACAAATTTGGGGTTGGG + Exonic
1183619965 22:38966531-38966553 GTGACGAAACATTTGGGGCTGGG + Intronic
1185276820 22:49953512-49953534 GGGAAGTGACATTTGGGGGTGGG - Intergenic
951916075 3:27802217-27802239 AGGTAGAGACAGTTGGTGTTAGG + Intergenic
956837110 3:73104409-73104431 CAGGAGAGACATTTGGGGCTGGG - Intergenic
956875035 3:73454288-73454310 GTGTAGAGAAACTTGGAGTAGGG + Intronic
958989846 3:100830066-100830088 GTATATAGCCATTTGGGGTAAGG - Intronic
959053249 3:101544450-101544472 GTGGAGAGGATTTTGGGGTTGGG + Intergenic
959219603 3:103499954-103499976 GTTTAGTCATATTTGGGGTTTGG + Intergenic
960206015 3:114899401-114899423 TGGTAGAGACATTTTGTGTTTGG - Intronic
961865260 3:129949176-129949198 GTGGGAAGACATTTGGGGTAAGG + Intergenic
965327881 3:167330487-167330509 ATGTAGTCACATTGGGGGTTAGG - Intronic
966223130 3:177570172-177570194 ATGTACAGGCATTTGGGATTAGG + Intergenic
969210221 4:5681572-5681594 GTGGAGAAACGCTTGGGGTTGGG + Intronic
969955249 4:10883020-10883042 GTGTGGAGATATTTGGAGATGGG + Intergenic
970630395 4:17936844-17936866 GTGAAGAGACATTTGGAGTTGGG - Intronic
972533702 4:39982156-39982178 CTGTAGTGAAATTGGGGGTTAGG - Intergenic
973798125 4:54449538-54449560 GAGCAAAGACATTTGGTGTTTGG + Intergenic
974214643 4:58829087-58829109 GTGCAGAGTGATTTGGGGGTCGG + Intergenic
975728462 4:77315397-77315419 GTGTAAACACAGTTGGGCTTGGG + Intronic
977474847 4:97492665-97492687 GTGAGGAGAAATTTGGGGGTTGG + Intronic
978968163 4:114768455-114768477 ATATAGATACATTGGGGGTTAGG - Intergenic
979097504 4:116569589-116569611 GTATAGAGACATTTGGTGGCAGG - Intergenic
979147532 4:117263945-117263967 ATCTAGAGGTATTTGGGGTTTGG - Intergenic
979418378 4:120472225-120472247 GTTTATATACATTTTGGGTTTGG - Intergenic
979564968 4:122145042-122145064 GTGTTGAGATACTTGGGATTAGG + Intergenic
980700133 4:136415373-136415395 GTTTACAGGCATTTGGGATTAGG + Intergenic
983502640 4:168516955-168516977 GTGTAGAAACATTCAGTGTTGGG + Intronic
987805063 5:22753730-22753752 ATGTATATACATTTGCGGTTGGG + Intronic
988001041 5:25348574-25348596 GGGTAGAGACATTTGCAATTTGG + Intergenic
988970287 5:36460038-36460060 GTGTAGAGATATTTGCTGATTGG + Intergenic
991258676 5:64643262-64643284 GTGTACAGAGATGTGGGTTTAGG - Intergenic
998877771 5:146618039-146618061 GTGTAGACATATTTGGGGATGGG - Intronic
999099412 5:149010508-149010530 GTGTGAAGACATTTAGGATTTGG - Intronic
1000734722 5:164884909-164884931 GTGCAGAGACATTTGGGGATTGG - Intergenic
1002996844 6:2294489-2294511 GTGTATAAGCATTTGTGGTTGGG - Intergenic
1004247803 6:13996781-13996803 GTGAGGAGACAGTTGGGGTAGGG - Intergenic
1006263736 6:32897910-32897932 CTGAAGAGAGCTTTGGGGTTTGG + Intergenic
1011228179 6:85130699-85130721 GTTGATAGAAATTTGGGGTTGGG - Intergenic
1012343347 6:98156209-98156231 GAGAAGAGGCATTTTGGGTTTGG + Intergenic
1012451333 6:99355227-99355249 GTTTCGAGAAATTTAGGGTTAGG + Intergenic
1013594655 6:111649688-111649710 ATTTAGAGAGATTTGGGCTTAGG - Intergenic
1014148904 6:118030601-118030623 GTGTAAAGATCTTTGGGGGTGGG + Intronic
1015914991 6:138206944-138206966 GTGTAGTGGCATTTGGGGGTGGG + Intronic
1017680803 6:156862163-156862185 GAAGAGAGACATTTGAGGTTTGG + Intronic
1020504414 7:8965656-8965678 TTGTAGACTCATTTGGGGTAGGG - Intergenic
1021097850 7:16553605-16553627 GTCTAGAGACATTTCTGATTGGG + Intronic
1023797672 7:43807360-43807382 ATGTTGGGATATTTGGGGTTAGG + Intergenic
1024134540 7:46392901-46392923 GGGTAGAGTCTTTTGGGCTTTGG - Intergenic
1024800232 7:53068767-53068789 GAGTAGACACATTTGGAGTCTGG + Intergenic
1025120901 7:56301281-56301303 GTTTAGAGTTTTTTGGGGTTTGG - Intergenic
1026110179 7:67453354-67453376 TTGAAGAGACAGTGGGGGTTGGG + Intergenic
1027643603 7:80768594-80768616 GTGAAAAAACATTTGGGGATGGG + Intronic
1027857935 7:83536902-83536924 ATATAGTGATATTTGGGGTTAGG - Intronic
1029269800 7:99370350-99370372 GTGGAGAAACACTTTGGGTTAGG - Intronic
1030778338 7:113564776-113564798 GTGGAGAGGATTTTGGGGTTGGG + Intergenic
1031928886 7:127664430-127664452 GTTTGGAGAGCTTTGGGGTTGGG + Intronic
1032982127 7:137296460-137296482 GAGTAGAGACAATTTGGTTTTGG + Intronic
1033298613 7:140164443-140164465 GTCTAGAGACATTTTTGATTTGG - Intronic
1036411574 8:8506623-8506645 GTGCAGAGGCTTTTGGGGGTGGG - Intergenic
1040387276 8:46922044-46922066 GTGCAGAGACCTTTGGGGATGGG + Intergenic
1044765017 8:95562233-95562255 GTTTAGAGATATTTAGAGTTGGG - Intergenic
1045454819 8:102367507-102367529 GTGAAAAGGGATTTGGGGTTGGG - Intronic
1045723536 8:105142298-105142320 GTTTAGAGATATTTGTGATTAGG - Intronic
1046107454 8:109683107-109683129 TTGAAGAGAAATGTGGGGTTGGG + Intronic
1047455126 8:125001244-125001266 GTGTAGAGAAATTTTGGAGTAGG + Intronic
1050391565 9:5148752-5148774 TTTTCCAGACATTTGGGGTTGGG + Intronic
1051600038 9:18863396-18863418 GTGAAGAGACATTTGGGGAATGG + Intronic
1056600307 9:88041959-88041981 CTTTAGAGAGCTTTGGGGTTCGG + Intergenic
1057694924 9:97316463-97316485 GTGTGGAGGCATTTGGGGCCAGG + Intronic
1057859806 9:98632049-98632071 GTGTCTAGACAATTGGGGCTGGG - Intronic
1058504155 9:105652074-105652096 ATGTAGAGAATTTTGGGGCTAGG - Intergenic
1059021652 9:110582378-110582400 GTCTGGAGACATTTGGGGGATGG + Intergenic
1186113084 X:6276897-6276919 GTGCAGAGATATAAGGGGTTGGG + Intergenic
1188396870 X:29695722-29695744 GTGTGGTGGCATTTGGAGTTGGG - Intronic
1190432452 X:50391295-50391317 GTGCAGAGCCATTTGTGGGTTGG - Intronic
1190566814 X:51738815-51738837 GTGTAGAGAAATGTGAGGTAAGG - Intergenic
1194366911 X:93023979-93024001 GTGCAGAGATATAAGGGGTTGGG - Intergenic
1197711821 X:129677129-129677151 GTATAGTGATATTGGGGGTTAGG - Intergenic
1197731916 X:129818025-129818047 GTGCAGCTACATTGGGGGTTAGG - Intronic
1198078857 X:133219694-133219716 GAGTAGTGAAATTGGGGGTTAGG + Intergenic
1198599591 X:138269000-138269022 GTGCAGAGATATAAGGGGTTGGG + Intergenic
1199683760 X:150245749-150245771 ATGTATGTACATTTGGGGTTGGG + Intergenic
1200675133 Y:6140235-6140257 GTGCAGAGATATAAGGGGTTGGG - Intergenic