ID: 1102476606

View in Genome Browser
Species Human (GRCh38)
Location 12:113192698-113192720
Sequence ATGGCTAGGACTTTGCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102476606 Original CRISPR ATGGCTAGGACTTTGCCAAG TGG Intergenic
903574034 1:24326760-24326782 ATGGCTAGCACTTTCTCAAGAGG - Intronic
907391350 1:54160417-54160439 AGGGATGGGACTGTGCCAAGAGG + Intronic
907639106 1:56167663-56167685 ATGGCTGGGAATTTGTAAAGTGG + Intergenic
910825360 1:91401367-91401389 ATGGTTAGGAATTTGCCAGTTGG - Intronic
915297150 1:154929502-154929524 AAGGCTAAGCCTTTGCCCAGGGG - Intronic
918381828 1:183963703-183963725 ATGACAAGGTCTTTGCCATGTGG - Intronic
918764572 1:188462671-188462693 GTGCCAAGGACTTTGCTAAGAGG + Intergenic
919071801 1:192765254-192765276 ATAGCTAGTACTTGGCCAGGCGG + Intergenic
922583557 1:226717241-226717263 ATGGCAAGGACATGGGCAAGTGG + Intronic
924916261 1:248572780-248572802 ATGGTCAGGGCTGTGCCAAGGGG + Intergenic
1067689308 10:48491153-48491175 ACTGCGAGGCCTTTGCCAAGAGG - Intronic
1067691063 10:48502643-48502665 ATGAGTAGGAGTTTGCCAGGTGG - Intronic
1067908613 10:50320774-50320796 AGGAATAGGAGTTTGCCAAGTGG - Intronic
1070052845 10:72905769-72905791 ATGGGGAGAACTTTGCCCAGTGG - Intronic
1070599636 10:77856729-77856751 ATGGCACGGCCTTTGACAAGAGG - Exonic
1072798696 10:98376539-98376561 ATTGCTAGAACTTTTCCCAGAGG + Intergenic
1072835452 10:98706650-98706672 AAGGGTAGGATTTTGCCAGGAGG + Intronic
1073302309 10:102478476-102478498 ATTGCCAGGTCTTTGCCAAATGG - Intergenic
1077091577 11:780737-780759 ATGGTTAGGAGTTTGATAAGCGG - Intronic
1077882849 11:6364459-6364481 ATGAATAGGAGTTTGCCAAAGGG + Intergenic
1078248843 11:9600755-9600777 ATGGATAAGAGTTTGCTAAGTGG + Intergenic
1081181689 11:39992216-39992238 CTGACTAGGGCATTGCCAAGGGG + Intergenic
1083126269 11:60569168-60569190 ATTGCTAGGACTCTGACAATAGG - Intergenic
1085710787 11:78827438-78827460 ATGGATAGGACTTGGACAAGCGG - Intronic
1088249705 11:107852032-107852054 ATGTCTAGGACTTTACCCTGTGG + Intronic
1088896938 11:114085659-114085681 ATGGCTAGGCTTTGGACAAGTGG + Intronic
1090758888 11:129817903-129817925 ATAGCAAGGACTTTGGCTAGGGG - Intronic
1092395045 12:8118639-8118661 ATGGCGAGGACACTACCAAGGGG + Intergenic
1097353698 12:58577648-58577670 AAGGCTAGGACATGGCCAAAAGG + Intronic
1098719292 12:73875235-73875257 ATTGCAAGGACATTACCAAGAGG - Intergenic
1098925261 12:76342269-76342291 AGGGCCAGGACTATGCCATGGGG + Intergenic
1099468116 12:83011694-83011716 TTCGGTAGGACTTTGCTAAGTGG - Intronic
1100935624 12:99661827-99661849 ATGGTTATGACTTAGCCATGTGG - Intronic
1101183468 12:102247081-102247103 ATGGCTAATACTTAGCCAATAGG - Intergenic
1102476606 12:113192698-113192720 ATGGCTAGGACTTTGCCAAGTGG + Intergenic
1102752521 12:115308010-115308032 CTGGCTAGGAACTTGCCATGAGG + Intergenic
1102942787 12:116958747-116958769 ATGACTAGGACTTGGCCAGGTGG + Intronic
1104405554 12:128513499-128513521 ATGGCTAAGACTCTGCCAGAAGG - Intronic
1105446937 13:20465692-20465714 AGGGCCAGGTCTTTGCCAAGAGG - Intronic
1106762366 13:32879816-32879838 ATGCCAATGACTTTGCCAAAGGG + Intergenic
1108000087 13:45897761-45897783 ATGAATAGGAGTTTGCTAAGAGG + Intergenic
1108065025 13:46568549-46568571 ATGTCTAAGACTTTACTAAGAGG - Intronic
1110614144 13:77522295-77522317 ATGGTTAGGAATTTGCCCAGAGG + Intergenic
1111102503 13:83606273-83606295 ATGGCTTGCACTTTTCTAAGTGG - Intergenic
1113061171 13:106323883-106323905 ATTGCTAGGACAGTACCAAGGGG - Intergenic
1115151500 14:30291364-30291386 ATGGTTAGGAATTTGACAGGAGG + Intergenic
1115500175 14:34042653-34042675 AAGGGTAGGACTTTGCCAAGGGG + Intronic
1115548301 14:34482664-34482686 ATGGCTGGGAAATTGCCTAGGGG + Intergenic
1117127040 14:52640328-52640350 ATGCATAGGAATTTTCCAAGTGG + Exonic
1118050494 14:62021248-62021270 ATTGCTTGGAATTTGCCTAGTGG + Intronic
1119845110 14:77823316-77823338 ATGACGAGGACTTTTCTAAGGGG - Intronic
1120445559 14:84590868-84590890 ATGGCTAGAACTGGGCCAAGTGG - Intergenic
1123879955 15:24668855-24668877 ATGACTATGACTTTCTCAAGGGG + Intergenic
1128602928 15:69012948-69012970 ATGAGTAGGAGTTTGCCAGGTGG - Intronic
1130395014 15:83494065-83494087 ATGGCCAGGACTTTTCCAGAGGG + Intronic
1130530437 15:84743794-84743816 ATGGTTAGGCCTCTGCAAAGGGG + Intergenic
1131118738 15:89809957-89809979 ATGAGTAGGAGTTTGACAAGAGG - Intronic
1133920573 16:10149397-10149419 AAATCTAGGACTTTGCCCAGTGG + Intronic
1135160871 16:20095053-20095075 ATGCCTTGGCCTTTGCCAGGAGG + Intergenic
1135173541 16:20208168-20208190 ATGTGTAGGAGTTTGTCAAGGGG - Intergenic
1136315485 16:29452556-29452578 ATTGCTAGGACTTTGAACAGAGG - Intronic
1136430062 16:30191898-30191920 ATTGCTAGGACTTTGAACAGAGG - Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1144110359 17:12024835-12024857 ATGGCTAGGGCTTTCCCTTGTGG + Intronic
1145113103 17:20182839-20182861 ATGGCTAGGTTCTGGCCAAGCGG - Intronic
1145245862 17:21268930-21268952 ATGAATAGGAGTTTGCCAATTGG - Intergenic
1145916071 17:28574792-28574814 ATGGTGCTGACTTTGCCAAGTGG - Exonic
1147441635 17:40451077-40451099 AAGACGAGGACTGTGCCAAGGGG - Intronic
1149278220 17:55069610-55069632 TGGGCTAGAACTTTGCTAAGGGG + Intronic
1150302802 17:64060210-64060232 ATGGGTAGGATTTGGCCAGGTGG - Intronic
1155095923 18:22556655-22556677 ATGGCTAGGTATTTTCCCAGAGG - Intergenic
1155224097 18:23713335-23713357 ACGGATAGGACTTTGGTAAGTGG - Intronic
1157209038 18:45725574-45725596 AGGGCTAGGACTTAGCGATGCGG - Intronic
1158880917 18:61779018-61779040 ATGCCTAGGTGTTTGCAAAGAGG - Intergenic
1159451746 18:68611494-68611516 ATGCCTATGACTCAGCCAAGTGG + Intergenic
1160739349 19:678862-678884 ATGTCTAGGAGTTTGCCAGATGG + Intronic
1160952380 19:1673973-1673995 ATGAATAGGAGTTTGCCAGGTGG - Intergenic
1161785450 19:6322468-6322490 ATGAATAGGAGTTTGCCAAGTGG - Intronic
1161786150 19:6326984-6327006 ATGAATAGGAGTTTGCCAAGTGG - Intronic
1163730474 19:18946501-18946523 ATGAATAGGAGTTTGCAAAGAGG - Intergenic
1163785193 19:19271345-19271367 ATGAGTAGGAGTTTGCCAAGTGG - Intronic
1164778042 19:30869618-30869640 AAGGGCAGGACTTTGCCCAGAGG - Intergenic
1165645479 19:37431967-37431989 GTGGGAAGGACTTTGCCATGTGG + Intronic
1166414930 19:42588506-42588528 ATGGAAAGGACTTCACCAAGGGG - Intronic
1166804322 19:45476227-45476249 ACGGCTAGGATTTTGCAATGGGG - Intronic
925844309 2:8021357-8021379 ATGGCTTGGACCTTGCCATGGGG + Intergenic
926308793 2:11659634-11659656 ATGTCTTGGTCTCTGCCAAGGGG + Intronic
926313170 2:11689311-11689333 ATGGCTAAGGCTTTGCCATCTGG + Intronic
928337951 2:30414231-30414253 ATGACTAGGAGTTTGACAGGTGG - Intergenic
932395944 2:71448120-71448142 ATGGCCAGGACTTTGGAAAAGGG - Intergenic
932691949 2:73921004-73921026 AAGGCTGGGACTTTGCTAGGTGG - Intergenic
936286057 2:111182274-111182296 AGGGTTGGGACTTTGCCAAGGGG - Intergenic
936661230 2:114546373-114546395 ATTGCTAGGACAGTACCAAGAGG + Intronic
939166615 2:138647426-138647448 TTGGCCTGGACTTTGCCAAGGGG + Intergenic
943922846 2:193731564-193731586 ATGGCAAGGAGTTGGCCAACAGG + Intergenic
946016679 2:216609650-216609672 ATGGTGGGGACTGTGCCAAGGGG - Intergenic
948749918 2:240125826-240125848 TTGGACAGGACCTTGCCAAGGGG - Intergenic
1169122510 20:3105871-3105893 ATGGCTCTGTCTGTGCCAAGAGG - Intergenic
1169856790 20:10111696-10111718 ATGGCAGAGATTTTGCCAAGAGG - Intergenic
1170922067 20:20688543-20688565 ATGACTAGGGCTTAGCTAAGGGG - Intronic
1171139384 20:22728056-22728078 ATGGCTAGGATTTACCCCAGTGG - Intergenic
1172148240 20:32772489-32772511 TTGGCTCTGATTTTGCCAAGGGG + Intronic
1173566041 20:44039367-44039389 ATGGCTAGGCCATTGCTAAGTGG + Intronic
1176175450 20:63721096-63721118 AATGCTAGGACTTTGGGAAGTGG + Intronic
1176199111 20:63852288-63852310 ATGGGTAGGGCTTTGCAAACTGG - Intergenic
1177358512 21:20038978-20039000 ATGGCTAAAACATTGCCAAGAGG - Intergenic
1178713643 21:34943439-34943461 ATGTGAAGTACTTTGCCAAGAGG - Intronic
1179341001 21:40509401-40509423 ACGGCTAGATCCTTGCCAAGTGG + Intronic
1182979036 22:34650801-34650823 ATTGCAAGGAAATTGCCAAGGGG + Intergenic
1184041340 22:41945983-41946005 AAGGGAGGGACTTTGCCAAGTGG + Exonic
949752401 3:7369463-7369485 TTGGCTATAACTTTGCCAAATGG + Intronic
949852896 3:8436734-8436756 ATGGTTAGGACTGCACCAAGGGG - Intergenic
949934734 3:9107940-9107962 ATGGGTAGGAGTTTTCCAAATGG + Intronic
950631530 3:14285186-14285208 GTGGCCAGGGCTTTGCCAGGGGG + Intergenic
953664071 3:44913457-44913479 ATGGCCAGGACTTTTCAAAGAGG + Intronic
954631650 3:52050986-52051008 ACGCCTACGACTTTGTCAAGAGG - Exonic
955209055 3:56924122-56924144 ATGGCTAGGGCATTTCCAACAGG + Intronic
958005099 3:87800395-87800417 ATGACTAAGAATTTGCCAGGTGG - Intergenic
960400773 3:117195023-117195045 ATTGCTAGGGTTTTGCCAAAAGG - Intergenic
961748088 3:129078726-129078748 TTGGCTAGGACTTGGTCACGTGG - Intergenic
969039053 4:4279812-4279834 ATGGCAAGGACTTTTTCAATTGG - Intronic
971813035 4:31452509-31452531 ATTGCTAGGACAGTGTCAAGAGG - Intergenic
974330983 4:60478835-60478857 ATTGCAAGGACACTGCCAAGGGG + Intergenic
977532466 4:98216448-98216470 AAGGATAAGACTTCGCCAAGAGG + Intergenic
978487802 4:109275948-109275970 ATGGGTAGGTGTTTGCCCAGTGG - Intronic
978534941 4:109750946-109750968 ATGGGTAGGAATTTGCCATAAGG - Intronic
983869154 4:172804616-172804638 CTGGCCAGGACATTGCTAAGTGG - Intronic
987985494 5:25140938-25140960 TTGGCTAGGACTGTGACAAGTGG + Intergenic
990251215 5:53917081-53917103 ATGGCTGGTCCTTTTCCAAGGGG - Intronic
995853063 5:116566899-116566921 GTGGCTAGGACTTCTGCAAGAGG - Intronic
995914960 5:117233896-117233918 ATGGCTAAGTTTTGGCCAAGAGG - Intergenic
997000077 5:129748888-129748910 ATAGCTAGCACTTTTTCAAGTGG - Intronic
1001746287 5:174095077-174095099 ATGACTAGGAGTTCACCAAGGGG + Intronic
1001866225 5:175108040-175108062 CTGGTTGGGACTTTGCCAACAGG + Intergenic
1002506017 5:179679581-179679603 AGGAGTAGGACTTTGCCAGGTGG + Intronic
1006678049 6:35777699-35777721 ATGAGTAGGAGTTTGCCAAGTGG - Intronic
1006770518 6:36548744-36548766 ATGGGTAGGACTTTGACAACAGG - Intergenic
1010205998 6:73323026-73323048 ATGGGCATGACTGTGCCAAGTGG + Intergenic
1016030881 6:139336639-139336661 ATGGCTAGTAATTTGCAAAGAGG + Intergenic
1016359731 6:143254442-143254464 ATGTCTAGGACTTTGCCTCGCGG - Intronic
1016893590 6:149031893-149031915 GTGCGTAGGAGTTTGCCAAGTGG + Intronic
1017005673 6:150026754-150026776 ATGGCTGGCTCTTTGCCCAGGGG - Intergenic
1018692127 6:166354957-166354979 TTGGCTTGGACTTGGCCAATAGG - Intergenic
1020937535 7:14486212-14486234 ATAGCTACTACTTTCCCAAGGGG - Intronic
1022547608 7:31203352-31203374 ATGGGGAGGACTTTCCTAAGGGG + Intergenic
1023137133 7:37064014-37064036 ATAGTTAGGACTATGACAAGTGG - Intronic
1027967050 7:85025540-85025562 CTGTCTGGGGCTTTGCCAAGGGG - Intronic
1032704093 7:134407070-134407092 ATGGCAAGGACTTGGCCAAATGG + Intergenic
1033137450 7:138797156-138797178 ATGGCTAGAATTTTGACAGGGGG - Intronic
1034749188 7:153552845-153552867 ATGGCAGGGAATTTGCCATGTGG - Intergenic
1035110255 7:156475842-156475864 ATGAGTAGGAGTCTGCCAAGTGG - Intergenic
1042221490 8:66478683-66478705 ATGGGCAGGAGTTTGCCATGAGG - Intronic
1042710057 8:71707335-71707357 GTGGATAGAACTTTGCTAAGAGG - Intergenic
1043589990 8:81819918-81819940 ATGGTAAGGGCTTAGCCAAGAGG + Intronic
1043908700 8:85835910-85835932 ATTGCTAGTACTTTCCCATGAGG + Intergenic
1045997278 8:108377702-108377724 ATGGCTATAACTTTGCCTACTGG + Intronic
1049558125 8:143293780-143293802 AGGGCTGGGCCTCTGCCAAGGGG + Intronic
1049627750 8:143633645-143633667 ATGTCCAGGACTTTGCAATGTGG + Intergenic
1051087522 9:13367630-13367652 ATGGCTAGTAAGTAGCCAAGAGG - Intergenic
1052896561 9:33752425-33752447 ATAGCAAGGACTTTGGCTAGGGG - Intronic
1058293754 9:103278877-103278899 ATTGCAAGGACAATGCCAAGGGG + Intergenic
1059992087 9:119875069-119875091 TTGAGTAGGACCTTGCCAAGTGG + Intergenic
1061553248 9:131350039-131350061 ATGGCTATGACCTGGCGAAGTGG - Intergenic
1186179723 X:6961073-6961095 ATGAATAGGAGTTTGCCAGGTGG - Intergenic
1189320256 X:40083363-40083385 GTGGCTTGGAGTGTGCCAAGAGG - Intronic
1189520656 X:41763738-41763760 ATGACCAGGAGTTTGCCAAGTGG - Intronic
1193545678 X:82825269-82825291 ATGGCCAGAACTTAGCCATGTGG - Intergenic
1194578287 X:95640459-95640481 GTGGGTAGGCCTTTGCCAATGGG + Intergenic
1194697421 X:97071450-97071472 ATGGCAAGCAGTTTGCCATGTGG - Intronic
1196334086 X:114510053-114510075 ATGGCTAGAATTTTGCTAATTGG - Intergenic
1196538229 X:116873070-116873092 AAGGCTATGACTTGGCCCAGTGG - Intergenic
1196893387 X:120310865-120310887 GTGACCAGGACTTTGCAAAGAGG + Intronic
1198049974 X:132942249-132942271 ATGGCTGAGACTTTGCTAAGTGG - Intronic
1201492758 Y:14560421-14560443 ATGGCAATGTGTTTGCCAAGGGG + Intronic