ID: 1102478545

View in Genome Browser
Species Human (GRCh38)
Location 12:113204623-113204645
Sequence TTGTAGAAAAAGTTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102478537_1102478545 10 Left 1102478537 12:113204590-113204612 CCACAAAGCCTAATGTTTTTACT 0: 1
1: 2
2: 29
3: 426
4: 1236
Right 1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG 0: 1
1: 0
2: 1
3: 37
4: 323
1102478539_1102478545 2 Left 1102478539 12:113204598-113204620 CCTAATGTTTTTACTATCTGGCC 0: 1
1: 1
2: 34
3: 411
4: 1298
Right 1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG 0: 1
1: 0
2: 1
3: 37
4: 323
1102478535_1102478545 19 Left 1102478535 12:113204581-113204603 CCATCTGGCCCACAAAGCCTAAT 0: 1
1: 8
2: 85
3: 286
4: 756
Right 1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG 0: 1
1: 0
2: 1
3: 37
4: 323
1102478536_1102478545 11 Left 1102478536 12:113204589-113204611 CCCACAAAGCCTAATGTTTTTAC 0: 1
1: 1
2: 18
3: 341
4: 1187
Right 1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG 0: 1
1: 0
2: 1
3: 37
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102478545 Original CRISPR TTGTAGAAAAAGTTGGGGCC AGG Intronic
901115918 1:6843773-6843795 TTATAAAAAAGTTTGGGGCCGGG - Intronic
901266996 1:7918660-7918682 TTGCAAAAAAACTTGGGGCCGGG - Exonic
903265348 1:22154690-22154712 TTCAGGACAAAGTTGGGGCCCGG + Intergenic
903624098 1:24718969-24718991 TTTTAAAAAAAGTTCCGGCCAGG - Intergenic
904172902 1:28604227-28604249 TTGGAGAAAAGATTGGGGTCAGG - Intronic
905623547 1:39470354-39470376 TTTTTAAAAAAATTGGGGCCAGG + Intronic
906945516 1:50291161-50291183 TGGTAGAGAAAGATGGGGGCAGG - Intergenic
908515350 1:64886733-64886755 GTGTAGACAAGGTTGGGGCGGGG - Intronic
908617629 1:65940174-65940196 TTGTATAAAAAGTAGGGGGCAGG + Intronic
909615430 1:77603372-77603394 TTGTATTAATAGTTGGGGCCAGG - Intronic
910216437 1:84849079-84849101 TTGTATAAAAAGTTCTGGCTGGG + Intronic
912500992 1:110121739-110121761 TTGGTGACAGAGTTGGGGCCAGG + Intergenic
912790471 1:112644486-112644508 TTGAATACAAAGCTGGGGCCAGG - Intronic
916066665 1:161141486-161141508 TGATAGAAAAAGTCAGGGCCAGG + Intergenic
916680333 1:167098302-167098324 TCTTAAAAAAAGTTTGGGCCGGG - Intronic
916952047 1:169790479-169790501 TTAAAGATAAATTTGGGGCCAGG - Intronic
917262898 1:173189018-173189040 TCATAGAAAAAGTCAGGGCCGGG - Intronic
917885025 1:179375397-179375419 TTAAAGAATATGTTGGGGCCGGG - Intronic
917990849 1:180377458-180377480 TTGGAGAAATGGTTGGTGCCAGG + Intronic
918352935 1:183676522-183676544 TTGTATGAAAAATTGGGACCTGG + Intronic
918952344 1:191154793-191154815 TTGTAGAACAATTTGAAGCCAGG - Intergenic
919279807 1:195475100-195475122 TTGTAGTATAATTTGGGGTCAGG - Intergenic
919816402 1:201443514-201443536 ATGCAGGAAAAGTGGGGGCCAGG + Intergenic
920156836 1:203958814-203958836 TTTTTAAAAAAGGTGGGGCCAGG + Intergenic
921224838 1:213008157-213008179 CATAAGAAAAAGTTGGGGCCGGG - Intronic
922434319 1:225588512-225588534 TTGAAAGAAAAGTTGGGGCCGGG + Intronic
923349955 1:233094565-233094587 TTTTAAAAAAAGTTAGGGCCTGG + Intronic
923780176 1:237015473-237015495 TTGTAAAAAAAGTTGTTGGCCGG + Intergenic
923987431 1:239397375-239397397 ATATAGAAAATGTTGTGGCCGGG + Intronic
924734469 1:246743287-246743309 TTTTAAAAAAATTGGGGGCCGGG + Intronic
1064263376 10:13804342-13804364 TTGTAGATAAGCTTGTGGCCAGG + Intronic
1064269673 10:13853534-13853556 CTGAAAAAAAAGTGGGGGCCAGG + Intronic
1064366367 10:14712294-14712316 TTTAAAAAGAAGTTGGGGCCGGG + Intronic
1064986162 10:21212371-21212393 TTGCAAGGAAAGTTGGGGCCAGG - Intergenic
1065053461 10:21819105-21819127 TTTTAAAAAAGGTTTGGGCCAGG + Intronic
1065084483 10:22161103-22161125 TTTAAGAAGAAGTCGGGGCCGGG + Intergenic
1065422758 10:25565309-25565331 TTGGAGAAAATTTTGTGGCCTGG + Intronic
1066115882 10:32239271-32239293 TCATAGAAACAGTAGGGGCCAGG - Intergenic
1066128615 10:32367335-32367357 TTTTAAAAAAGTTTGGGGCCGGG - Intronic
1066710100 10:38224171-38224193 TTGGAGAAATAGGTGGGCCCAGG - Intergenic
1068114346 10:52720470-52720492 TGGAAGAAAAATATGGGGCCAGG - Intergenic
1068801825 10:61149687-61149709 ACGTAAAAAAAATTGGGGCCAGG + Intergenic
1069892151 10:71658683-71658705 GTGTAGAAGAAGCTGGGGCCCGG + Intronic
1070591370 10:77804185-77804207 TTATAGAAAAAGTTTAGGCCAGG - Intronic
1071719309 10:88127339-88127361 TAGCAGGAAAAGTTGGGACCAGG + Intergenic
1071821937 10:89288197-89288219 TTGTAGAAGGAGTTGGGGTTTGG - Intronic
1072649601 10:97284417-97284439 ATGTAGAAAAAAATGGGGGCTGG - Intronic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073527585 10:104199132-104199154 TTGTAGAAATAGTTGAGGTATGG + Intronic
1073772883 10:106754609-106754631 TTGTTGAAAAAGATGGGGAATGG + Intronic
1074467456 10:113696136-113696158 TTCTAGTAACAGTTGGGACCAGG + Intronic
1075066895 10:119294876-119294898 TTATAGAAAAAGTCTGGGCAGGG + Intronic
1076249714 10:128976207-128976229 TCAAAGAAATAGTTGGGGCCAGG + Intergenic
1076832741 10:133004882-133004904 TTGTAGAAAATGCTGGGGACGGG + Intergenic
1077617134 11:3684277-3684299 ATGTTCAAAAAGTTGGGGCTTGG + Intronic
1078712598 11:13809227-13809249 TTCTAGAGAAAGGAGGGGCCAGG - Intergenic
1078920317 11:15824426-15824448 TGGTAGAAAAAGAAGTGGCCAGG + Intergenic
1079317755 11:19423796-19423818 TGGTAGAGATATTTGGGGCCAGG + Intronic
1080063447 11:27981841-27981863 TGGTAGGAAAAGTGGGGGCGGGG + Intergenic
1080237222 11:30084920-30084942 TTAAAGAAAAAGAAGGGGCCAGG + Intergenic
1080290842 11:30669903-30669925 CTGTAGCAAAAGGTGGGGCTAGG - Intergenic
1081848156 11:46255716-46255738 TTGAAGAAAAATTAGAGGCCGGG + Intergenic
1083696545 11:64447047-64447069 TTTAAGAAAAAGATGAGGCCGGG - Intergenic
1083705216 11:64509469-64509491 TTGTCTAAAAACTTGGGGTCAGG + Intergenic
1084099517 11:66936794-66936816 TTGTAGAAAAACTTGGGGAAGGG + Intronic
1084132163 11:67144545-67144567 TTAAAAAAAATGTTGGGGCCGGG - Intronic
1084976851 11:72805434-72805456 TTTTAGAAATAGTAGTGGCCAGG - Intergenic
1085323385 11:75588528-75588550 TAGAAGAAAAAGTAGGGACCTGG - Intronic
1085635826 11:78158899-78158921 TTGGAGAAGCAGGTGGGGCCAGG - Intergenic
1085701318 11:78748464-78748486 TTGGAGAGAAAGTCAGGGCCAGG + Intronic
1086416653 11:86595696-86595718 TAGTAGAAATAGTGAGGGCCTGG - Intronic
1086726343 11:90189471-90189493 TTCTAGAAACATTTGTGGCCGGG + Intronic
1089485636 11:118843832-118843854 TTGTAGAAGAAGCTGGGGAAAGG - Intergenic
1090543849 11:127739730-127739752 CAGCAGAAAAAGATGGGGCCAGG + Intergenic
1091511426 12:1131147-1131169 TTTTAGAACTAGTTGGGGCCAGG + Intronic
1091962990 12:4714500-4714522 TTTTAAAAATAGTAGGGGCCAGG - Intronic
1092583158 12:9869967-9869989 TTGAAGACAAAATTGTGGCCTGG - Exonic
1093800756 12:23369436-23369458 TTGGAGAAAGAGTTGAGTCCGGG + Intergenic
1094356160 12:29580043-29580065 TGATAGAAAAAGTTTTGGCCAGG + Intronic
1094709380 12:32946223-32946245 TTGGAGAAAAGGGTGGGGCGTGG + Intergenic
1094761593 12:33539554-33539576 ATTTTTAAAAAGTTGGGGCCAGG - Intergenic
1096083449 12:48849043-48849065 TTTAAGAATTAGTTGGGGCCGGG - Intronic
1096206795 12:49729279-49729301 TTAAAAAAAAAATTGGGGCCGGG + Intronic
1096277771 12:50225195-50225217 TTAAAGAGACAGTTGGGGCCAGG - Intronic
1096760670 12:53839466-53839488 TAGAAGGAAAAGTTGGGACCAGG - Intergenic
1096862944 12:54542898-54542920 TTATGGAAAAAGTTAGGGCGTGG + Exonic
1097902473 12:64887025-64887047 TTCTAGAAATAGTTGGGGGAGGG + Intergenic
1099756892 12:86863053-86863075 TTGTAGAAATGGATGGAGCCTGG - Intergenic
1100342153 12:93689519-93689541 TTCTAGAAGAAGTTTGGGGCAGG + Intronic
1102344778 12:112152571-112152593 TTGTAGAAGTTGTTGGGACCAGG + Intronic
1102371737 12:112387614-112387636 ATTAAGAAAAAGTTGTGGCCGGG + Intergenic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1102886547 12:116526263-116526285 TTATAAAAGAAGTTGGGGCCAGG + Intergenic
1103338096 12:120205059-120205081 CTGTAGATAAAGTTGTGGCCGGG + Intergenic
1103353829 12:120304856-120304878 TTTTAAAGAAAGTTGAGGCCGGG + Intronic
1103538372 12:121649240-121649262 TTAAAGAAAAAGTGGGGGCAGGG - Intergenic
1103768428 12:123300360-123300382 TTTTAGAAAATGTTTAGGCCAGG + Intronic
1105450034 13:20491200-20491222 TTTTAAAAAAATTTAGGGCCAGG - Intronic
1106630018 13:31461579-31461601 TAATAAAAAAAGATGGGGCCGGG - Intergenic
1108281852 13:48869336-48869358 TTGTAGAAGAGGTTGGGGTTTGG + Intergenic
1108679762 13:52769523-52769545 TTTAAAGAAAAGTTGGGGCCAGG - Intergenic
1109170617 13:59092781-59092803 TGGCAGAAAAAGTTTGGTCCAGG - Intergenic
1109877997 13:68430565-68430587 TTACAGAAAAAGTAGGGGCTTGG + Intergenic
1111271017 13:85885572-85885594 TTTTAAAAAAATTTGGGGCCGGG + Intergenic
1111876499 13:93903783-93903805 TTTTAAAAACAGTTGGGGCGGGG - Intronic
1112759221 13:102674322-102674344 TTGTAGGAAAGGTTGTGCCCTGG + Exonic
1113054013 13:106248303-106248325 TTCTTTAAAAAGTTTGGGCCAGG + Intergenic
1113128871 13:107012414-107012436 TTGGAGAAATAGCTAGGGCCTGG + Intergenic
1113718927 13:112537177-112537199 TTGTTGAGAAAGTTATGGCCAGG - Intronic
1113945731 13:114043110-114043132 TTGCAGACAAAGGAGGGGCCTGG - Intronic
1114326595 14:21595216-21595238 TTGTAAAATGAGTTGGGGACCGG - Intergenic
1116682347 14:47988839-47988861 TTTGAGAAAAAGTAGGGGCTTGG + Intergenic
1117967138 14:61217678-61217700 TACCAGAAGAAGTTGGGGCCAGG + Intronic
1118735148 14:68695787-68695809 TTAGAGGAAGAGTTGGGGCCAGG + Intronic
1119018770 14:71087228-71087250 TTGAAAAAAAATTTGGGTCCAGG - Intronic
1119332880 14:73808430-73808452 TTTTAGAAAAATTTTAGGCCGGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119514454 14:75237024-75237046 TTCCAGACAAAGTGGGGGCCCGG + Intergenic
1121349218 14:93160356-93160378 TTGTAGAAACAGGTGGTGCTGGG - Intergenic
1126399185 15:48251907-48251929 TAGTAACAATAGTTGGGGCCGGG + Intronic
1126888785 15:53181635-53181657 TGTTATAAAAAGCTGGGGCCAGG - Intergenic
1127443913 15:59040354-59040376 TGGTAGGATAAGTTGAGGCCAGG - Intronic
1127594656 15:60467256-60467278 TTTTAAAAAAAATTGAGGCCAGG - Intronic
1127986575 15:64076999-64077021 TTTTAAAAAAAATTGGGGCCAGG - Intronic
1128427136 15:67553616-67553638 TTTAAGAAATAGTTGAGGCCGGG + Intronic
1129064905 15:72893839-72893861 ATGTAGAAAGAGATGGGGGCTGG - Intergenic
1129409500 15:75341307-75341329 TTGTAGAAAAGGCTGATGCCAGG + Intronic
1129484107 15:75852367-75852389 TTGTAAAAATAGTTTGGACCTGG + Intronic
1130053866 15:80506229-80506251 TTTTAACAAATGTTGGGGCCGGG - Intronic
1130388512 15:83434352-83434374 TTGGAAAATGAGTTGGGGCCAGG + Intergenic
1131768975 15:95714254-95714276 CTGGAGAAAAAGATGGGTCCTGG + Intergenic
1131951274 15:97683965-97683987 ATGCAGAAAAAGTTGGGGTGGGG + Intergenic
1132114874 15:99128447-99128469 TTGTAGAAAATGTCCTGGCCTGG + Intronic
1132193073 15:99886086-99886108 TTAAAAAAAAAATTGGGGCCAGG + Intergenic
1133146322 16:3789405-3789427 TTGTAGAGAAAGGTGGGACTTGG - Intronic
1134601441 16:15536695-15536717 TTAAAGAAAATGCTGGGGCCTGG + Intronic
1137024669 16:35460687-35460709 TTGTAGAAAAGGTTGGGGGGCGG - Intergenic
1137637906 16:50003021-50003043 TTGAAGAAGAAGCTGGGGCTAGG + Intergenic
1137767975 16:50992510-50992532 TTATGGAAACTGTTGGGGCCAGG + Intergenic
1137797453 16:51233957-51233979 TGGTATAAAAAGTTGGGGATTGG - Intergenic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1138547270 16:57727429-57727451 GTCTAGGAAAAGCTGGGGCCTGG - Intronic
1138612726 16:58139979-58140001 TGGTAGAAGAAATTGGGGCCAGG - Intergenic
1139544045 16:67640732-67640754 ATTAAAAAAAAGTTGGGGCCGGG - Intergenic
1139808402 16:69589988-69590010 TTGTAGAGACAGTTGGGGAGGGG - Intronic
1140486904 16:75300580-75300602 TAAAAGAAAAACTTGGGGCCAGG - Intronic
1140886509 16:79249122-79249144 TTATAAAAGAAGTTGAGGCCGGG + Intergenic
1141681659 16:85547930-85547952 TTCTAGAAATATTTGAGGCCGGG + Intergenic
1143139055 17:4730467-4730489 TTATAAAAAAATTTGGGGGCTGG - Intergenic
1144194253 17:12875294-12875316 TTGTATAAAAAATTGGGGTCTGG + Intronic
1145304929 17:21668745-21668767 TTATAGAAAAAACTTGGGCCAGG - Intergenic
1146090839 17:29875796-29875818 TTGAAGAATAAGTAGGAGCCAGG - Intronic
1146125007 17:30224516-30224538 TTGCAGAAAATTGTGGGGCCAGG - Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1147396306 17:40145465-40145487 TTTTAAAAAAATTTTGGGCCAGG - Intronic
1147568330 17:41551435-41551457 AGGTACAAAAAGTTGGGGCAGGG - Intergenic
1147691300 17:42316511-42316533 TTTCAGAAAAAGTTGAGGCTGGG - Intronic
1148006922 17:44440075-44440097 TTTTAAAAGAAGTTGAGGCCGGG - Intronic
1148247896 17:46047489-46047511 TTGAAGAAAAAGTTCAGGCCGGG + Intronic
1151250605 17:72831010-72831032 TTGTAGAAAAATGAGGAGCCTGG + Intronic
1153620300 18:6970910-6970932 TTGTTTAAAAAGTTAGGACCAGG - Intronic
1153847668 18:9064358-9064380 TTGTAAAAAAAGTTATAGCCTGG + Intergenic
1155051960 18:22156346-22156368 CTGTATAAAAAGGAGGGGCCGGG + Intergenic
1156710322 18:39936398-39936420 TAGTACAAAAAGTTGGGGAAAGG + Intergenic
1157173881 18:45433146-45433168 TGGTAGTAAATGTTGGGGTCAGG - Intronic
1157593938 18:48852460-48852482 TTCTAGAAAAAGTTGGAGGTGGG - Intronic
1158056787 18:53290871-53290893 TTTAAAAAAATGTTGGGGCCAGG + Intronic
1158134949 18:54197926-54197948 CTGTAGATAAAGTTGGGGACAGG - Intronic
1158138067 18:54227550-54227572 TTAAAGAAAAAGTTGTGGCCGGG + Intergenic
1158195535 18:54881299-54881321 TATTAGAAAAAGTTGTGGCAGGG + Intronic
1158576593 18:58643861-58643883 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
1158657369 18:59350788-59350810 TTTAAAAAAAAATTGGGGCCGGG - Intronic
1161536182 19:4820123-4820145 TTTAAAAAAAAGTTTGGGCCAGG + Intronic
1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG + Intronic
1161652821 19:5495898-5495920 TTGTGGAAGAAGATGGAGCCAGG + Intergenic
1162557113 19:11394154-11394176 ATGTAGAAAGAGGTGGGGCATGG - Intronic
1163516517 19:17767250-17767272 TTTTAAAAAATGTTTGGGCCTGG + Intronic
1164044969 19:21529900-21529922 TTTAAGAAAAGTTTGGGGCCGGG + Intronic
1164050616 19:21583284-21583306 TTATAGAAAATGTTTGGGCCGGG - Intergenic
1164211881 19:23105411-23105433 TTGTAGAAAATATTGGGTTCTGG - Intronic
1164839218 19:31380148-31380170 ATTTAGAAAAATTCGGGGCCGGG - Intergenic
1165790392 19:38488110-38488132 GTGTATGAAAAGTTGGGGCCAGG - Intronic
1166857752 19:45791800-45791822 TTCTAGAGAAAATTGGGGTCTGG - Intronic
1166925036 19:46261296-46261318 ATTTAGAAAAAGATGGGGCTGGG + Intergenic
1167004950 19:46769672-46769694 TTTTAGAAAAAGTTTGAGCCAGG + Intronic
926543496 2:14209813-14209835 TTTAAGAATAAGTTGTGGCCGGG + Intergenic
927526348 2:23744988-23745010 TCCTAGAAAAACTTGAGGCCAGG + Intergenic
927800170 2:26091504-26091526 ATGTAGAAAATGTTGAGGGCAGG + Intronic
929490921 2:42395404-42395426 TTTAAGAAGGAGTTGGGGCCAGG + Intronic
929692140 2:44083828-44083850 TTTAAAAAAAAGTTAGGGCCGGG + Intergenic
930607125 2:53504256-53504278 TAATAGAAAAAGCAGGGGCCTGG + Intergenic
931386796 2:61805075-61805097 TTGTCTAAAAATTTGGGGTCAGG - Intergenic
931777174 2:65550731-65550753 TCATAGAAGAATTTGGGGCCAGG + Intergenic
931834570 2:66085465-66085487 TTGGAGATAAACTTGGGGTCTGG + Intergenic
931940600 2:67247676-67247698 TTCTTGGAAAAGTTGGGGCCAGG + Intergenic
932003865 2:67908606-67908628 TTTAAAAAAATGTTGGGGCCAGG + Intergenic
935293953 2:101632186-101632208 TTTAAGAAAATGTAGGGGCCGGG + Intergenic
936431172 2:112465054-112465076 TTTTAAAAAATGTTGGGGCCGGG + Intergenic
936514123 2:113171078-113171100 GTGTGGGAAAAGATGGGGCCAGG - Intronic
939337945 2:140855365-140855387 TTCTTTAAAAATTTGGGGCCAGG + Intronic
940621047 2:156114251-156114273 TTGTAGAGATATTTAGGGCCTGG + Intergenic
941898687 2:170656704-170656726 TTGAAAAGAAAGTTTGGGCCGGG - Intergenic
941988930 2:171535933-171535955 TTTTAGAAAGTGTGGGGGCCAGG - Intronic
942502868 2:176610146-176610168 TTAAAAAAAAGGTTGGGGCCCGG - Intergenic
942706358 2:178777048-178777070 TTCTATAAAAAGTTGGGGGAGGG + Exonic
943061766 2:183047380-183047402 TTGTAGAAGGAGTTGGGGTTTGG - Intergenic
943321556 2:186450410-186450432 TTGAAGAAGAAGATGGGGCCAGG + Intergenic
944884010 2:204044181-204044203 GGATAGAAAAATTTGGGGCCGGG - Intergenic
945250410 2:207761277-207761299 TTGCAGAAATAGGTGGGCCCAGG - Intronic
947077555 2:226362419-226362441 TTTTAGAAATAGTTAGGACCAGG - Intergenic
947309620 2:228786926-228786948 TTGAAGCAAAAGTTGAGGCTCGG + Intergenic
1168970554 20:1927876-1927898 TTGTAGAAGAAGTGGAGCCCTGG - Exonic
1169895405 20:10500453-10500475 GTGTGGAAAAAGATGGGGCCAGG + Intronic
1170069967 20:12356142-12356164 TTGTTGAAAAAGTTGAGGGTGGG + Intergenic
1170672571 20:18448571-18448593 TAATTTAAAAAGTTGGGGCCGGG + Intronic
1172224275 20:33294917-33294939 ATTTAGAAAATGTTGAGGCCAGG + Intronic
1173342630 20:42166621-42166643 TTTGAGAAGAAGTCGGGGCCAGG + Intronic
1173424010 20:42927264-42927286 TTGTAGAAAAAAGGGGGGCTGGG + Intronic
1175135570 20:56821136-56821158 TACTAGCAGAAGTTGGGGCCAGG + Intergenic
1175428565 20:58887680-58887702 TTGGCTGAAAAGTTGGGGCCAGG - Intronic
1177598183 21:23274605-23274627 TTAAAAAAAAAATTGGGGCCAGG + Intergenic
1178993955 21:37379880-37379902 ATATAGAAAAACCTGGGGCCTGG + Intronic
1179071854 21:38078961-38078983 TTTTAATAAAAGTTGAGGCCAGG - Intronic
1180065087 21:45408462-45408484 TTGTTGAAAAGGCTGGGGGCTGG + Intronic
1180230340 21:46423483-46423505 TTGTATAAAAATTTGAGGCCAGG - Intronic
1182470197 22:30543771-30543793 TTGTAGAAGAAGTGGAGCCCTGG - Intronic
1182884410 22:33761079-33761101 TGGGAGAAAAGGTTGGGCCCTGG - Intronic
950239561 3:11356341-11356363 TTTTAGAAAATATTGGTGCCTGG + Intronic
950376908 3:12579803-12579825 TTTAAGAACAGGTTGGGGCCAGG + Intronic
951163422 3:19454731-19454753 TTATGGAGAAACTTGGGGCCAGG - Intronic
951615213 3:24534855-24534877 TTTTAAAAAAAGTCTGGGCCGGG + Intergenic
954032276 3:47828161-47828183 TTAAAGATAAAGATGGGGCCTGG + Intronic
955686977 3:61558953-61558975 TTGTAGGAACTGGTGGGGCCTGG + Intergenic
955707927 3:61747736-61747758 TTGAAGACAAAGATGGGACCAGG - Intronic
957595110 3:82253465-82253487 TTATAGAAAAACTAGTGGCCAGG - Intergenic
958922656 3:100123788-100123810 TTGTACAAAGCGTTAGGGCCGGG - Intronic
959710814 3:109384137-109384159 CTGGAGCAGAAGTTGGGGCCAGG + Intergenic
961842809 3:129731670-129731692 GTGTAAAAAAATTTTGGGCCAGG - Intronic
963111639 3:141693513-141693535 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
967617840 3:191594279-191594301 CTGTAGAAAAAATTGTGTCCTGG - Intergenic
968254654 3:197256820-197256842 TTTTAGAAAAACTTGAGTCCTGG - Intronic
969046659 4:4341339-4341361 TTTAAGAAAAAGCTGAGGCCAGG - Intergenic
969649571 4:8457021-8457043 TTGTAGAGATAGTTGGGGGGGGG - Intronic
971176664 4:24288924-24288946 TCAAAGAAAAAGTTAGGGCCAGG + Intergenic
975355705 4:73400958-73400980 TTGGAGAGAAAATTGGGGACAGG - Intronic
975797430 4:78022986-78023008 TGGTGGAAAAATTTGGGTCCTGG + Intergenic
976739736 4:88345816-88345838 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
979118177 4:116854734-116854756 TTGTAGAATAATTTGAGGTCAGG + Intergenic
979232159 4:118358273-118358295 TTAAAGAAATAGATGGGGCCGGG - Intergenic
981698712 4:147584601-147584623 TTGTAGAAAAATGTGTGGGCTGG - Intergenic
982529595 4:156522415-156522437 GTGTAGAAAAAGATGGGTACAGG + Intergenic
982886629 4:160789798-160789820 TTGAAAAAAAAAATGGGGCCAGG - Intergenic
984109256 4:175591128-175591150 TTGTAGACTAAATTGAGGCCTGG + Intergenic
984432717 4:179668670-179668692 ATGTAGCAATAGTTAGGGCCAGG - Intergenic
985197077 4:187443068-187443090 TTGAAAAGATAGTTGGGGCCGGG + Intergenic
986580347 5:9259115-9259137 TTGTAAAAAATAATGGGGCCGGG - Intronic
986927202 5:12769658-12769680 TTATAAAAGAAGATGGGGCCGGG + Intergenic
987018531 5:13846132-13846154 TAAAATAAAAAGTTGGGGCCAGG - Intronic
987900531 5:24005215-24005237 CTGTGGAAAAAGTTGGGGGCAGG - Intronic
987961243 5:24812065-24812087 TTATAGAAAATCTTGGAGCCTGG - Intergenic
988351405 5:30112843-30112865 TTGGAGGAAAATTTGAGGCCAGG + Intergenic
988867106 5:35347540-35347562 TTGTAGAAAAAGTTGGTGACTGG - Intergenic
989135823 5:38153733-38153755 TTGTAGAAGAAGCTGGCTCCTGG - Intergenic
989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG + Intergenic
990645110 5:57835081-57835103 TGGTAGTAAGAGGTGGGGCCTGG + Intergenic
992065007 5:73099023-73099045 TTATAGAAAAAGTTGCTGGCTGG + Intergenic
992956718 5:81917517-81917539 TATTAAAAAAAATTGGGGCCGGG + Intergenic
993301717 5:86219931-86219953 TATAAGAAAAAGTTGAGGCCAGG + Intergenic
994003520 5:94809866-94809888 TTCCAGAAAAAGTTGGATCCTGG - Intronic
994868538 5:105313261-105313283 TTGTAATAAAAGTTGAAGCCTGG + Intergenic
995807841 5:116074110-116074132 TTATGGAAACATTTGGGGCCTGG + Intergenic
996137786 5:119866282-119866304 TTCTAGAAAAATTTTGAGCCTGG + Intergenic
997885258 5:137624429-137624451 TTTTAGAAGAAGTTTGGTCCTGG - Intronic
1000469535 5:161623271-161623293 TAGTAGAAAAAATTTGGGTCAGG + Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002587314 5:180257568-180257590 TTTTAGAAAAAATTCGGGCCAGG + Intronic
1002903238 6:1427284-1427306 TTGTAGAGAAACTGAGGGCCAGG + Intergenic
1005223483 6:23615006-23615028 TTGAAGAATAAATAGGGGCCAGG - Intergenic
1005575766 6:27187967-27187989 GTGTATAAAGAGTGGGGGCCAGG - Intergenic
1005576662 6:27196175-27196197 GTGTATAAAGAGTGGGGGCCAGG - Intergenic
1006143739 6:31946062-31946084 TTGTATAAAAGGCTGGGGGCTGG + Exonic
1006201776 6:32299621-32299643 TTATTTAAAAACTTGGGGCCTGG + Intronic
1006482372 6:34307281-34307303 CTTTAAAAAAAGTTGAGGCCAGG + Intronic
1006506459 6:34491905-34491927 TTAAAGAAAATGTGGGGGCCGGG - Intronic
1009196331 6:60690633-60690655 TGGTAGAAAAAATTAGAGCCAGG - Intergenic
1010219308 6:73433894-73433916 CTATAGATAAATTTGGGGCCAGG - Intronic
1011694194 6:89897425-89897447 TTTTAGAATAACTTGAGGCCAGG + Intergenic
1011716975 6:90116709-90116731 TTGTAGACAAAGTGTGGACCTGG - Intronic
1013030329 6:106326278-106326300 TTGTAAAAATAATTGGGGCCGGG + Intergenic
1015103910 6:129514086-129514108 TTTCAGAAAAATTTGAGGCCAGG - Intronic
1015163818 6:130181240-130181262 ATTTTGAAAAATTTGGGGCCGGG - Intronic
1017382899 6:153850730-153850752 TTTTAAAAACAGTTGTGGCCGGG + Intergenic
1017469650 6:154726905-154726927 TAGTATAAAAATTTGGGGCTGGG - Intergenic
1017593862 6:156007560-156007582 TTGCAGAAGAAGTTGAAGCCAGG - Intergenic
1019931854 7:4228831-4228853 TTGTAGGAAAAGCAAGGGCCGGG - Intronic
1020032003 7:4940035-4940057 TTATAGAAATAGATTGGGCCAGG - Intronic
1020831016 7:13095677-13095699 TTTTTTAAAAAGGTGGGGCCGGG + Intergenic
1020932026 7:14409410-14409432 TTAAAGAAAAAGTTGAGGCCGGG + Intronic
1021202986 7:17746303-17746325 TTGTAGAAAGAATAGGGGCTTGG - Intergenic
1022173638 7:27852616-27852638 TTCTAGAAAAAGTAGGGCCTGGG - Intronic
1022820883 7:33959625-33959647 ATGTATAAAAAGTTGCGGCAAGG + Intronic
1023410452 7:39884864-39884886 TCCTAAAGAAAGTTGGGGCCTGG + Intergenic
1023616620 7:42026273-42026295 GTGTTGGAAAAGTTGGGGCAGGG + Exonic
1024185849 7:46946946-46946968 TGGCAGAAAAAGTAGGAGCCTGG - Intergenic
1025863180 7:65352953-65352975 GTTTAAAAAAAATTGGGGCCGGG - Intergenic
1028066077 7:86386288-86386310 TTTTAGAAAATGTTGGGGCAGGG + Intergenic
1028404287 7:90459476-90459498 TTTAAGAGACAGTTGGGGCCAGG + Intronic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1029927331 7:104330724-104330746 TGCTAGAAAAAGTTGGGGATGGG - Intronic
1031022507 7:116643391-116643413 GAATAAAAAAAGTTGGGGCCAGG - Intergenic
1031704408 7:124962855-124962877 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
1032162825 7:129523732-129523754 TTAAATACAAAGTTGGGGCCGGG - Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1033163717 7:139019707-139019729 TTGAAGATAAACTTGGGGACTGG - Intergenic
1033677511 7:143557502-143557524 TTGTAGAAGAATCTGCGGCCTGG - Intergenic
1033694323 7:143771938-143771960 TTGTAGAAGAATCTGCGGCCTGG + Intergenic
1034083165 7:148299283-148299305 ATTTTTAAAAAGTTGGGGCCGGG - Intronic
1034562386 7:151889465-151889487 CTGCAGAAGAAGTAGGGGCCAGG + Intergenic
1034692409 7:153024313-153024335 TTATAGCCAAAGTTGAGGCCTGG + Intergenic
1035895423 8:3394617-3394639 GTGTAGAAAAAGTTGGGGGGAGG + Intronic
1036765737 8:11548250-11548272 TTCAAGAAAATGCTGGGGCCAGG - Intronic
1039876934 8:41594838-41594860 TTAAAAAAAAAGTTTGGGCCGGG - Intronic
1039889495 8:41674490-41674512 TTGTAGGAAAGGGTGGGGCGAGG - Intronic
1040871413 8:52103457-52103479 TTCAAAAAAATGTTGGGGCCAGG + Intergenic
1041274790 8:56145794-56145816 TTGTATAAAAAGTAGGGGAGGGG + Intergenic
1041544090 8:59021439-59021461 TTGTAGAAAAACCTGTTGCCTGG - Intronic
1041899898 8:62970429-62970451 TTGTAGAAAAATTTGGTGGCAGG + Intronic
1043502145 8:80868941-80868963 TTGTAGAGAAAGTGGAGGACTGG - Intronic
1043918290 8:85950508-85950530 TAGAAGACAATGTTGGGGCCGGG - Intergenic
1044652585 8:94513040-94513062 TTGTTTAAAAACTTGGGGCTGGG + Intronic
1044701482 8:94969059-94969081 TTGCAGAAGAAGTTGGAGTCTGG + Intronic
1045629156 8:104096572-104096594 TATAAGAAAATGTTGGGGCCGGG + Intronic
1048377610 8:133836238-133836260 TATTTGAAAAAGATGGGGCCTGG - Intergenic
1051663676 9:19448307-19448329 TTAAAAAAAAAGTTTGGGCCAGG - Intronic
1052816854 9:33108315-33108337 TAATAGAAAAATTAGGGGCCAGG + Intronic
1052841116 9:33291606-33291628 TAGTTTAAAAAGTTAGGGCCGGG + Intronic
1053431807 9:38046917-38046939 TTTTTGGAAAAGATGGGGCCTGG + Intronic
1053601986 9:39620130-39620152 ATGTAGAAAGAGTTAGTGCCTGG - Intergenic
1053859643 9:42373895-42373917 ATGTAGAAAGAGTTAGTGCCTGG - Intergenic
1054251550 9:62722305-62722327 ATGTAGAAAGAGTTAGTGCCTGG + Intergenic
1054565661 9:66756817-66756839 ATGTAGAAAGAGTTAGTGCCTGG + Intergenic
1055468506 9:76588943-76588965 TTATAGAAAAAGTTTGGGCTGGG - Intergenic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1056530725 9:87485091-87485113 TTGTAGAACAAGCTGGAGACTGG - Intergenic
1057572296 9:96213917-96213939 TTGTGGAAAAAGGCGGGGCAGGG - Intergenic
1058191548 9:101922976-101922998 TTATAAAAAAAATTGCGGCCGGG + Intergenic
1058442394 9:105021631-105021653 TAGTAGAAGAAAATGGGGCCAGG + Intergenic
1058716018 9:107722549-107722571 TTGAAAAAGAAGTAGGGGCCAGG - Intergenic
1060929782 9:127481758-127481780 TAGTATAAAAAGTTCAGGCCAGG + Intronic
1186006390 X:5076990-5077012 TTGTAGAAAGAATGGGGGCTTGG - Intergenic
1186057669 X:5667206-5667228 TTGTTTAAAAATTTGGGGTCAGG - Intergenic
1187632572 X:21191099-21191121 TTGTAGTATAAGTTGGAGTCAGG - Intergenic
1187812850 X:23199283-23199305 TTGTAATAAAAATTGAGGCCGGG + Intergenic
1188550634 X:31360957-31360979 TTGTATTAAAAGGTGGGGCTGGG + Intronic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1190319878 X:49173766-49173788 ATGTAGTAGAAATTGGGGCCGGG + Intronic
1190819673 X:53961612-53961634 TTTAAAAAAAAATTGGGGCCGGG - Intronic
1190852891 X:54264036-54264058 TTTTAAAAAAAATTTGGGCCAGG + Intronic
1190866431 X:54388773-54388795 TTATATTGAAAGTTGGGGCCGGG + Intergenic
1197894045 X:131292115-131292137 TTGCAGAAAGGGATGGGGCCTGG - Intronic
1199813492 X:151374757-151374779 TTTTTGAATAAGATGGGGCCAGG - Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic