ID: 1102483376

View in Genome Browser
Species Human (GRCh38)
Location 12:113239423-113239445
Sequence TACACAGCTGTGCCTCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102483371_1102483376 28 Left 1102483371 12:113239372-113239394 CCCAGTGTAATGCCTGGGTGTTA 0: 1
1: 0
2: 1
3: 11
4: 115
Right 1102483376 12:113239423-113239445 TACACAGCTGTGCCTCTTTCTGG 0: 1
1: 0
2: 0
3: 17
4: 194
1102483374_1102483376 16 Left 1102483374 12:113239384-113239406 CCTGGGTGTTAATGGCTGTTGTT 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1102483376 12:113239423-113239445 TACACAGCTGTGCCTCTTTCTGG 0: 1
1: 0
2: 0
3: 17
4: 194
1102483372_1102483376 27 Left 1102483372 12:113239373-113239395 CCAGTGTAATGCCTGGGTGTTAA 0: 1
1: 0
2: 1
3: 4
4: 76
Right 1102483376 12:113239423-113239445 TACACAGCTGTGCCTCTTTCTGG 0: 1
1: 0
2: 0
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102483376 Original CRISPR TACACAGCTGTGCCTCTTTC TGG Intronic
900974814 1:6010542-6010564 GACACAGCTGTGGCTCATCCAGG - Intronic
902274321 1:15328342-15328364 TGCTCAGCTGGGTCTCTTTCTGG - Exonic
904074304 1:27828730-27828752 TGCTGAGCAGTGCCTCTTTCTGG + Intergenic
904542663 1:31243729-31243751 TGAGCAGCTGTGCCTTTTTCTGG + Intergenic
905380579 1:37558922-37558944 TACACACATCTGCCTCTTTCTGG + Intronic
905976672 1:42180334-42180356 TACTCAGCTGTGGTTCCTTCTGG - Intronic
907998424 1:59656341-59656363 TTCAAAGCTGTGCCTCTCCCAGG + Intronic
908349697 1:63272493-63272515 TACACATCTGTTCATCTTTCTGG - Intergenic
912081425 1:105942111-105942133 AATTCAGCTGTGACTCTTTCTGG + Intergenic
916653035 1:166848632-166848654 TTCCCAGCTCTGCCACTTTCTGG + Intronic
916949319 1:169762838-169762860 TACAGAGCTGTGTTCCTTTCTGG - Intronic
917436494 1:175026604-175026626 TACCCAGTTGTGCCACTTTGAGG + Intergenic
919178052 1:194045001-194045023 TATATAGCTGTGGCTCTTTTTGG + Intergenic
919674948 1:200372393-200372415 TACAGGGCTGTGCTTCTTTGAGG + Intergenic
920085050 1:203409222-203409244 AACCCAGCTGTGCCTCTGCCTGG - Intergenic
920264110 1:204709143-204709165 CGAACACCTGTGCCTCTTTCAGG - Intergenic
920721052 1:208387186-208387208 CACACAGCTCTGGCTCTTTCTGG + Intergenic
922038255 1:221870944-221870966 CACAGGGCTGTGCCCCTTTCTGG - Intergenic
922274034 1:224060130-224060152 TACAGGGCTGTGTCCCTTTCTGG - Intergenic
923234620 1:232020514-232020536 TACAAAGATCTGCCTCCTTCAGG - Intronic
923854514 1:237831345-237831367 TCCACAGCCTTTCCTCTTTCTGG + Intronic
1063653601 10:7964852-7964874 TCCACTCCTCTGCCTCTTTCCGG + Exonic
1064250921 10:13705885-13705907 TACACAGGAGTGGCTGTTTCAGG + Intronic
1069375425 10:67788172-67788194 TACACAGCTATTTCTCTTTAAGG + Intergenic
1070976468 10:80609588-80609610 TCCACATCTTTGCCTCTCTCTGG + Intronic
1072689410 10:97561889-97561911 TACACACCTGGATCTCTTTCTGG + Intronic
1072695243 10:97598753-97598775 TAGTCAGCTGTGTCTCTTGCAGG + Exonic
1078330718 11:10417091-10417113 TCCTCAGCTGTGCCTCATGCTGG + Intronic
1078364132 11:10692797-10692819 AAGACAGCTGGGCCTCTCTCTGG + Intronic
1078611590 11:12824427-12824449 CACCCAGCTATGCCTCTTGCTGG + Intronic
1078710381 11:13785432-13785454 AACATTGCTGTGGCTCTTTCAGG + Intergenic
1079974703 11:27076795-27076817 GAGACAGCTGTGCTTCTCTCTGG - Intronic
1081096929 11:38947950-38947972 TAGACATCAGTGCCTATTTCAGG + Intergenic
1081259941 11:40947413-40947435 AACAGAGATGTGCCTATTTCAGG + Intronic
1082201939 11:49382498-49382520 TAAACAGGTGTGCTTCTTTCTGG - Intergenic
1083269657 11:61565388-61565410 TCCCCAACTCTGCCTCTTTCTGG - Intronic
1084040426 11:66539504-66539526 TGCACAGCTCTGGCTCTTCCTGG + Exonic
1084824276 11:71717622-71717644 TGCAATCCTGTGCCTCTTTCAGG + Intergenic
1084854970 11:71977713-71977735 TCCAGAGCTCTGCCTCTTCCAGG + Intronic
1085081132 11:73635101-73635123 TCCACAGCTGTGTCTCCTTGGGG - Intergenic
1086653724 11:89323672-89323694 TAAACAGATGTGCTTCTTTCTGG + Intergenic
1087235690 11:95716024-95716046 GAAACATCTGTGTCTCTTTCAGG - Intergenic
1088368450 11:109063274-109063296 GACTCAGCTGTTCCTCATTCAGG + Intergenic
1091618618 12:2068512-2068534 TCAACAACTGTGCCTCTTTTGGG - Intronic
1092923804 12:13256350-13256372 AACACAGCTCTGCATCTTGCAGG + Intergenic
1096761827 12:53848329-53848351 TTCTCAGCTCTGCCACTTTCCGG - Intergenic
1097310760 12:58116566-58116588 TACATAGATGTGTCTGTTTCTGG - Intergenic
1098633519 12:72753749-72753771 CAAACAGCTGTGCATCTCTCTGG - Intergenic
1099567742 12:84274500-84274522 TAGGCAGCTCTGCCTGTTTCGGG - Intergenic
1099807524 12:87538759-87538781 TAAACAGCTATGCCTTTTTGTGG + Intergenic
1099895129 12:88635380-88635402 TCCATAGCTTTGCCTCTTCCAGG + Intergenic
1100517659 12:95343706-95343728 TAAACAGCTGTGTCCCATTCAGG - Intergenic
1100922502 12:99504174-99504196 TACACAGCTTTGGTTCCTTCAGG - Intronic
1102094127 12:110221716-110221738 GACACAGCTTTTCCTCTTTTGGG - Intergenic
1102483376 12:113239423-113239445 TACACAGCTGTGCCTCTTTCTGG + Intronic
1104908358 12:132227695-132227717 TACACCCCTGGGGCTCTTTCAGG - Intronic
1105792087 13:23811767-23811789 TGCACAGCTGAGTCTGTTTCTGG - Intronic
1106216737 13:27708479-27708501 GCCACAGCTGTGCCTCTACCTGG - Intergenic
1106596925 13:31150940-31150962 GACACACCTGTTCATCTTTCCGG + Exonic
1108190740 13:47936084-47936106 TACACAGCTATTCCACTTACAGG + Intergenic
1110367576 13:74704440-74704462 TCCACACATTTGCCTCTTTCTGG - Intergenic
1110402634 13:75111713-75111735 AATTCAGCTGTGACTCTTTCTGG - Intergenic
1112096665 13:96140369-96140391 TAGACAGCTGTTCATCTCTCTGG + Intronic
1112143333 13:96670883-96670905 GACACAGCTGTGCTTCTTGGGGG + Intronic
1114806525 14:25843740-25843762 TAAACAGCTGTGCTTATTTGGGG - Intergenic
1115020096 14:28668890-28668912 TACACAACTCAGCCTTTTTCTGG + Intergenic
1115462935 14:33682304-33682326 TACCCAGCTGTGCCTGTATGCGG + Intronic
1116311462 14:43331996-43332018 TACAAAGCTATGTTTCTTTCTGG - Intergenic
1117809589 14:59532656-59532678 CACACAGCTGTTCCTGTTGCAGG - Intronic
1118598792 14:67456809-67456831 TACATATGTGTGCCTCTTTAGGG - Intronic
1119611124 14:76063331-76063353 TACTAAGCTGTGCCTCTGTAGGG - Intronic
1123951926 15:25287663-25287685 TACTGAGCTGTGCCACTTTTGGG - Intergenic
1124179949 15:27463696-27463718 TTCACAGCTGTGCCTTCTCCTGG + Intronic
1125097023 15:35866589-35866611 TACACAGCTGTACCTCCCTAAGG - Intergenic
1125682718 15:41542566-41542588 TATACAGATGTGCCTTTTCCTGG + Intronic
1125986437 15:44057468-44057490 TAACCAGCTGTGTCTCTTTGAGG + Intronic
1126941441 15:53770468-53770490 TACACATTTGAGCCTGTTTCAGG - Intergenic
1127454301 15:59143443-59143465 AAAGCAGCTGTGCCTCTTTGTGG - Intronic
1129151191 15:73688823-73688845 TGCTAAGCTGAGCCTCTTTCAGG + Intronic
1129418320 15:75402048-75402070 TACACAACTGCGCCTCCTCCTGG - Intronic
1130043743 15:80428180-80428202 TCCACAGTTCTGCCTCTTTCAGG - Intronic
1131978912 15:97976426-97976448 TCCAGAGCTGTGTCTCTTTCAGG + Intergenic
1132228993 15:100167991-100168013 TACACGGCTTCGCCACTTTCTGG - Intronic
1132872695 16:2122828-2122850 TTCACAGCTGTGTCCCTTCCAGG - Intronic
1133221877 16:4322404-4322426 AACCCAGCTGTGCCCCTTGCTGG + Intronic
1134551787 16:15142027-15142049 TTCACAGCTGTGTCCCTTCCAGG - Intergenic
1135894309 16:26384814-26384836 TGGAGAGCTGTGCCTATTTCAGG - Intergenic
1138321162 16:56113319-56113341 TAAAAAGCTATGCCTCTCTCTGG + Intergenic
1139321975 16:66122161-66122183 TTCACAGCTTTGCATTTTTCTGG + Intergenic
1140073385 16:71673221-71673243 TACCCAGCAGTGCCTCTTCTAGG - Intronic
1141250323 16:82350564-82350586 TACACAGCTTTACCTCTTGATGG - Intergenic
1142806274 17:2372711-2372733 GACAAAGCTTTGCCTCTCTCCGG + Intronic
1144439948 17:15272494-15272516 TTCACAGCTGGGGATCTTTCAGG - Intergenic
1144966398 17:19079270-19079292 ATCCCAGCTGTGCCACTTTCTGG + Intergenic
1144981520 17:19172787-19172809 ATCCCAGCTGTGCCACTTTCTGG - Intergenic
1144986704 17:19205452-19205474 ATCCCAGCTGTGCCACTTTCTGG + Intergenic
1145740833 17:27273048-27273070 CACATAACTGTGTCTCTTTCTGG - Intergenic
1145957364 17:28863813-28863835 GACAAAGCTGTGGCTCTCTCAGG + Intergenic
1147892730 17:43728811-43728833 TTGACAGTTGGGCCTCTTTCTGG + Intergenic
1147911555 17:43859068-43859090 TCCCCAGTTCTGCCTCTTTCAGG - Intronic
1150209644 17:63435093-63435115 TGAACAGCAGTGCCTCCTTCAGG + Exonic
1152745539 17:82037052-82037074 TCCCCAGCTGTGCCGCTTGCTGG - Intronic
1155181891 18:23355119-23355141 TACAGAGCTCAGCCTCTTTGAGG - Intronic
1157112311 18:44832770-44832792 TAGACAGCTGTTTCTCATTCAGG - Intronic
1157445178 18:47738982-47739004 TACAATGCTGTGCCACTTCCTGG - Intergenic
1163342743 19:16720129-16720151 TCCACAACTGTTTCTCTTTCTGG - Exonic
1163495247 19:17642769-17642791 TGCCCAGCTCTTCCTCTTTCTGG - Intronic
1164284159 19:23796553-23796575 TACACAGCTGTGAATCTGTCTGG + Intronic
1164446445 19:28321644-28321666 TATTCAGCTCTGCCTCTTCCAGG + Intergenic
1165439891 19:35819264-35819286 TCCAGTGCTGTGCCTGTTTCTGG + Intergenic
1166691640 19:44825024-44825046 TACACAGGTGTCCCTCTCACAGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925532481 2:4880092-4880114 GACACAGCTCTGCCTCTCTCAGG + Intergenic
929056188 2:37878648-37878670 AACAAAGCTGTCTCTCTTTCTGG + Intergenic
929369402 2:41203971-41203993 TAGACAGCTGTAACACTTTCAGG + Intergenic
931090077 2:58876316-58876338 TCCCCAGCTGTGCCTCTTCCAGG + Intergenic
933772134 2:85751292-85751314 GACACAGCTTGGCCTCTTTAAGG + Intergenic
935193109 2:100794056-100794078 GACACAGCTGTGACTCCTGCCGG - Intergenic
935269764 2:101423815-101423837 AACACAGTGGTGCCTGTTTCCGG - Intronic
935720728 2:105976673-105976695 CACACAGTTGTGCCACTGTCAGG + Intergenic
935999991 2:108817729-108817751 TACAGAGCTGTGTTCCTTTCTGG - Intronic
938733628 2:134165957-134165979 AACATAGCTGTACCTCTTTGAGG - Intronic
939358557 2:141137411-141137433 TTCAAAGCTGTGCTTCTTGCAGG + Intronic
941986556 2:171516840-171516862 TCCACAGCTGTGGCTCTCACAGG - Intergenic
943585841 2:189739027-189739049 TACACAGATGTACCTCTGTCTGG + Intronic
943624585 2:190184367-190184389 TACATAGTTCTGCCTCTTGCAGG - Intronic
946478143 2:220028807-220028829 TTCACAGCTGTACCTATTACTGG + Intergenic
946947315 2:224834412-224834434 TACACACCTGTTCCTATTTAGGG + Intronic
948225791 2:236308405-236308427 CATGCAGCTGTGCCACTTTCGGG + Intergenic
948470356 2:238173502-238173524 CACACACCTGTGCCTCTTATAGG + Intronic
1172990314 20:39031281-39031303 TGCATAGCTGTGCCTCATGCAGG - Intronic
1174141612 20:48418142-48418164 TCCACAGCTGAGCGTCATTCTGG + Intergenic
1174806253 20:53606777-53606799 TCCCCAGCTGTGCCGCTTTGGGG + Intronic
1175253663 20:57625136-57625158 TGCTCAGCTGTCCCTCTCTCTGG + Intergenic
1176225378 20:63995215-63995237 TGCACAGCTGTGCATATGTCAGG + Intronic
1176227739 20:64011616-64011638 TTCACACCTGTGCCTGCTTCTGG - Intronic
1177140198 21:17350354-17350376 TCCAGTGCTGTGTCTCTTTCCGG + Intergenic
1178812087 21:35893644-35893666 TACACAGCTGTGGCTCCTAAGGG + Intronic
1179328342 21:40373257-40373279 AACTCTGATGTGCCTCTTTCTGG - Intronic
1179804719 21:43829926-43829948 TAGACAGCACTGCCTGTTTCAGG - Intergenic
1181733510 22:24864613-24864635 TCCACAGATGTGCCTTTTTCTGG - Intronic
1182146560 22:28000418-28000440 TACCCAGATGGGCCTCTTTATGG - Intronic
949146445 3:706297-706319 TTCATAGCTGTGTCTCTTTAGGG - Intergenic
949226607 3:1702587-1702609 AACACAGCTGTGTTTCTTCCAGG + Intergenic
950103583 3:10374369-10374391 TACACAGAACTGCCACTTTCTGG + Intronic
952137705 3:30441915-30441937 AACACAGCAGTGCATCTCTCTGG - Intergenic
954656528 3:52197585-52197607 CACTCAGCTGTGGCACTTTCTGG - Intergenic
954811944 3:53254139-53254161 TGCACATCTGAGCATCTTTCAGG - Intronic
954948272 3:54445894-54445916 AACAAAGCAGTTCCTCTTTCAGG - Intronic
955860905 3:63329357-63329379 TAAACAGCTGTGCCACTTTGGGG - Intronic
957977812 3:87469948-87469970 TACACTATGGTGCCTCTTTCTGG + Intergenic
958814340 3:98900426-98900448 TAAACAGTTTTGCCTGTTTCTGG + Intronic
961627360 3:128273295-128273317 TCCTCAGCTGTGCCTCCTTAGGG - Intronic
962445490 3:135459905-135459927 CACATATCTGTGCCTCTTTCTGG - Intergenic
965741576 3:171880730-171880752 TATACAGCTGTGCCTCAGTAAGG + Intronic
966035020 3:175401196-175401218 TACACAGATGTGGCTGTTTATGG - Intronic
966352949 3:179050505-179050527 AATTCAGCTGTGCATCTTTCTGG - Intronic
968213505 3:196868437-196868459 TAGACCGCTCTGCCTCCTTCCGG + Intronic
969357766 4:6640614-6640636 GACACAGCCGGGCCTCTTTACGG - Exonic
973181270 4:47271464-47271486 GACAAATCAGTGCCTCTTTCTGG - Intronic
974351467 4:60752909-60752931 TAGACATCTGTTCCTGTTTCTGG + Intergenic
976665040 4:87581152-87581174 TACAGAGCTTTGCCTATTTTTGG - Intergenic
979365821 4:119822179-119822201 TACTGAGCTGTGCCACCTTCGGG - Intergenic
984749126 4:183254765-183254787 TAAACAGCAGTGCCTGTTTCAGG + Intronic
986164187 5:5259211-5259233 TACACACCTGTGCATGTCTCTGG + Intronic
988265852 5:28950359-28950381 TGCAGAGCTGTGGCTCCTTCAGG - Intergenic
989137080 5:38166604-38166626 TATACTTCTCTGCCTCTTTCTGG + Intergenic
990732176 5:58821180-58821202 TACACAACTGTGACACTCTCTGG + Intronic
991147531 5:63324214-63324236 TCCAAAGCTGTGCCTCTCTAAGG - Intergenic
991952130 5:71956607-71956629 TGCAGAGCTGTGCCTCTTGGTGG - Intergenic
993172035 5:84431327-84431349 GATACAGCTGTGCCCCTTCCTGG - Intergenic
999531759 5:152470768-152470790 CACTAAGCTGTGTCTCTTTCTGG - Intergenic
999801393 5:155041128-155041150 GACACAGCTCTGCCACTTCCTGG + Intergenic
1001270489 5:170307706-170307728 CACACAGCTGTGACTCATACTGG + Intergenic
1001909177 5:175500804-175500826 TACACATTTGTGCCTATTTCAGG - Intronic
1004462189 6:15848013-15848035 GTCCCAGCTGTGCCTCTTCCTGG - Intergenic
1008161639 6:48083870-48083892 AACATAGCTGTGTTTCTTTCTGG - Intergenic
1013075147 6:106764555-106764577 CACCCAGCTGTGTCTCTCTCTGG - Intergenic
1018865573 6:167744805-167744827 TAAGCATATGTGCCTCTTTCCGG + Intergenic
1019458089 7:1142191-1142213 TACACAGCTGGGTCTCTTGGCGG - Intergenic
1019770277 7:2879341-2879363 TACACACCTGTGCTTCACTCTGG - Intergenic
1020993483 7:15231822-15231844 TACAAAGCTGTGCAGCTTTGTGG + Intronic
1022131753 7:27411254-27411276 TGCACTGCTGGGCGTCTTTCTGG - Intergenic
1022849675 7:34247404-34247426 TAGAGAGCTGTGCTTTTTTCTGG + Intergenic
1024803224 7:53105473-53105495 TACACAACTGTGTCTAATTCTGG - Intergenic
1025757808 7:64361951-64361973 TACACATGTGGGTCTCTTTCTGG - Intergenic
1027985993 7:85290550-85290572 CACACAGCTGTGCAGTTTTCAGG - Intergenic
1030274858 7:107709590-107709612 TTCACAGCTGTGCCCTTCTCTGG - Intronic
1030418620 7:109278437-109278459 TACACAATTGAGTCTCTTTCTGG + Intergenic
1033017312 7:137684956-137684978 CACACAGCCCTGCCTCCTTCTGG + Intronic
1033026601 7:137780458-137780480 TAAACAGCTGTGCATCTTACAGG - Intronic
1033591724 7:142814004-142814026 TTCACAGCTCTGCTTCTTGCTGG + Intergenic
1038196157 8:25370116-25370138 AACACATCTGTACCTCTGTCTGG + Intronic
1043047774 8:75349457-75349479 AACTCAGCTGTGCATCTATCTGG - Intergenic
1044182091 8:89208814-89208836 TTCACAGCTGTGTCACTCTCAGG - Intergenic
1050205457 9:3191641-3191663 TACAGAAGTGTGCCTGTTTCTGG - Intergenic
1052916095 9:33925273-33925295 TTCCCAGCTCTGCCTCTTCCGGG - Intronic
1055205970 9:73730872-73730894 TACACAACTCTTCCTCTTGCAGG + Intergenic
1056879604 9:90378757-90378779 TGCCCAGCTGTCCCTGTTTCAGG + Intergenic
1057077160 9:92143947-92143969 TAACCAGCAGTGCCTCTCTCTGG + Intergenic
1059128184 9:111715099-111715121 AAAACAGCAGTGCCTCATTCAGG + Intronic
1059874490 9:118619201-118619223 TACACTGCAGTGCCTCTTCAGGG + Intergenic
1060269185 9:122128905-122128927 AACCCAGCTCTGCCACTTTCTGG + Intergenic
1060404712 9:123367551-123367573 CCCACAGCTGGGCCTCTTACAGG + Exonic
1186766043 X:12771570-12771592 TGCACCGCTGTGCCGCTTTAAGG - Intergenic
1194627809 X:96246372-96246394 TACTTAGCTGTGCTTCCTTCAGG - Intergenic
1195349635 X:103984393-103984415 ACCTCAGCTGTGCCTCTTACTGG + Intergenic
1195357808 X:104054446-104054468 ACCTCAGCTGTGCCTCTTACTGG - Intergenic
1196566380 X:117210149-117210171 TACAGAGGTGGGCCTGTTTCTGG - Intergenic
1197560272 X:128011975-128011997 TACACGAATGTGCCACTTTCAGG + Intergenic
1198310002 X:135421723-135421745 CACACAGCCCCGCCTCTTTCCGG - Intergenic
1199467856 X:148159939-148159961 TACACAGCACTGCCTCTTAAAGG - Intergenic