ID: 1102486335

View in Genome Browser
Species Human (GRCh38)
Location 12:113260269-113260291
Sequence GAGCATATGAAGGGACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102486335 Original CRISPR GAGCATATGAAGGGACTGCC AGG Intronic
901154658 1:7127405-7127427 GTGCAGATGAAGAGACAGCCTGG - Intronic
901401674 1:9019120-9019142 GAGCAGATGAGGTGTCTGCCTGG - Intronic
904341385 1:29837138-29837160 GAGCATCAGATGGGACTGCAGGG - Intergenic
904566834 1:31433353-31433375 GAGCAGATGAAGGCACTGTTGGG - Intronic
906316731 1:44791320-44791342 GAGCATGAGAATGAACTGCCTGG - Intergenic
907423375 1:54362572-54362594 GCGCCTATGTAGGGGCTGCCCGG - Intronic
909601338 1:77464591-77464613 GGGCATATTGAGGGACAGCCGGG + Intronic
915531412 1:156504385-156504407 TGGCAGATGAAGGGACTGCCGGG - Intergenic
915901054 1:159847006-159847028 GGGCATCTGAAGGGACTGACAGG + Intronic
921833586 1:219755568-219755590 GAGGATATGAAGGAACTGGTAGG + Intronic
1066613544 10:37275301-37275323 GCGCATGGCAAGGGACTGCCAGG - Intronic
1070896038 10:79983457-79983479 GGGGACATGCAGGGACTGCCCGG - Intergenic
1073244684 10:102081369-102081391 GATCAGATGAAGTGACTGACAGG - Intergenic
1076323723 10:129604197-129604219 CATCATCTGAAGGGGCTGCCGGG + Intronic
1076353953 10:129839021-129839043 TAGCGTATGAAGGGACGCCCAGG - Intronic
1076425056 10:130361731-130361753 GAGCAGATGCTGGGGCTGCCTGG + Intergenic
1076682973 10:132184603-132184625 GTGACTATGAAGGGAGTGCCTGG - Exonic
1079129694 11:17740333-17740355 GAGGCTATGAAGGGATTTCCTGG + Intronic
1084188925 11:67490203-67490225 CTGCAGATGAAGGTACTGCCTGG + Exonic
1084205009 11:67586119-67586141 GACTATGTGAAGGCACTGCCCGG + Exonic
1084686092 11:70696339-70696361 GAGCAGAGGAAGGACCTGCCTGG - Intronic
1085732629 11:79012435-79012457 GATCAAATGAGGGAACTGCCTGG - Intronic
1089387888 11:118079850-118079872 GAGCCTAGGATGGCACTGCCAGG - Intronic
1093475540 12:19550331-19550353 GAGCTGATGAATGGACTCCCGGG + Intronic
1094359840 12:29618607-29618629 GAGCCTATAAAGGGAGTGCAAGG - Intronic
1097580276 12:61447362-61447384 GTGCATGAGAAGGGACTTCCTGG - Intergenic
1102486335 12:113260269-113260291 GAGCATATGAAGGGACTGCCAGG + Intronic
1106609573 13:31265617-31265639 GATCAAATGGATGGACTGCCAGG - Intronic
1106875115 13:34063604-34063626 CAGCATATCATGGGACTTCCTGG - Intergenic
1110603468 13:77403373-77403395 GAGCATATGAAGATTCTGGCAGG + Intergenic
1110805202 13:79746421-79746443 GAACAGATTAAGGGAATGCCAGG + Intergenic
1111643326 13:90998388-90998410 GAGAATATGAAATGACTCCCTGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1115572568 14:34680822-34680844 GAGCACATGAAGGGACAAACTGG - Intergenic
1117784218 14:59265827-59265849 GAGCCTATGAATGGTTTGCCAGG - Intronic
1120399972 14:84018532-84018554 AAGCATATAAAAAGACTGCCTGG + Intergenic
1123830835 15:24135818-24135840 GAGAATATGAAGTTCCTGCCAGG + Intergenic
1123835914 15:24193191-24193213 GAGAATATGAAGTTCCTGCCAGG + Intergenic
1126273530 15:46849047-46849069 GCTCAGATGAAGGGGCTGCCTGG - Intergenic
1126546355 15:49878634-49878656 GAGCCTTGGAAGGGACTTCCTGG - Intronic
1130109771 15:80954540-80954562 GAGGACATGAGGGCACTGCCAGG - Intronic
1130413123 15:83664002-83664024 GAGCATGTGGAGGGACAGACGGG - Intronic
1132205737 15:99984926-99984948 GAGCAAATGGAGGGACGGCAGGG + Intronic
1132590752 16:725382-725404 GAGCATATGGAGAGCCTGGCTGG - Intronic
1135471846 16:22738074-22738096 GAGCAAGAGAAAGGACTGCCAGG + Intergenic
1140919498 16:79524089-79524111 GAGCTTTTGAAGGGACTCACTGG + Intergenic
1142899704 17:3004387-3004409 GAGCAGATGCAGAGTCTGCCAGG - Intronic
1142905075 17:3035808-3035830 GAGCAGATGTAGGGACAGCGTGG - Exonic
1147737045 17:42646042-42646064 GAGCATATCATGGGTCTTCCTGG - Intergenic
1148355397 17:46972277-46972299 AAGCATATGAAAGGACAGCAGGG - Intronic
1149332638 17:55602352-55602374 CAGCTTTTGAAGGGAATGCCTGG - Intergenic
1150548904 17:66191605-66191627 GGGCCGAGGAAGGGACTGCCAGG - Intronic
1151276355 17:73037525-73037547 GGGGCTATGAAGGGACTGGCTGG - Intronic
1152610676 17:81313774-81313796 GAAGACATGAAGGGCCTGCCTGG - Exonic
1152816545 17:82411527-82411549 CAGCCTGTGAAGGGACAGCCAGG + Exonic
1157498748 18:48174728-48174750 GCTGATATGAAGTGACTGCCAGG + Intronic
1159108805 18:64032490-64032512 GAGGATAAGAAGGGCCTGTCAGG - Intergenic
1159501762 18:69280483-69280505 GAGCAAAGGAAGATACTGCCTGG - Intergenic
1160652449 19:238290-238312 GAGCATCTGATGGGCCTGCAAGG - Intergenic
1165904450 19:39185216-39185238 GAGGATATGCAGGAACTCCCAGG - Intergenic
1166713550 19:44952164-44952186 GAGCATAGGAAGGCTCTGCAGGG + Intronic
1166736344 19:45087582-45087604 GAGCCCAAGAAGGGATTGCCAGG + Intronic
1168367526 19:55801522-55801544 GTGCATGTGAGGGGAATGCCTGG - Intronic
925471369 2:4164868-4164890 CAGCAGATGAAGAAACTGCCCGG - Intergenic
925893739 2:8456291-8456313 GAGCCTTTGAAGGGCTTGCCGGG - Intergenic
927996659 2:27491935-27491957 TAGCAGCTGAAGGGGCTGCCAGG + Exonic
929460793 2:42101166-42101188 GAGCACGTGAAGGGGCTCCCCGG - Intergenic
930065200 2:47322585-47322607 GAGCAGGTGAAGGCACTGACGGG + Intergenic
932397201 2:71456244-71456266 GAGCCTAGGAAGAGACTGGCTGG + Intronic
934937284 2:98474530-98474552 GAGCAGGTGAATGGCCTGCCCGG + Intronic
938249633 2:129804760-129804782 GAGCATCTGAAGGAACAGCAAGG + Intergenic
942506602 2:176647964-176647986 GAGCAACTGGAGGGACTGTCAGG + Intergenic
943667740 2:190628025-190628047 GAGCAGCTGGAGGGACTGCGGGG - Intergenic
944202642 2:197124116-197124138 AAGCATATGAAATGACTGCGTGG - Intronic
946410373 2:219512583-219512605 GAGCATAGGAGGCGGCTGCCTGG + Intergenic
947745622 2:232506018-232506040 GATCAGATTAAGGGACTGACAGG - Intergenic
947934048 2:233988158-233988180 GAGCATATGGGAGGCCTGCCGGG - Intronic
1173963489 20:47093143-47093165 TAGCACATGAAGGCACGGCCAGG - Intronic
1174067457 20:47875570-47875592 GGGCCTATGCAGGAACTGCCAGG + Intergenic
1178219070 21:30635171-30635193 GTGTATATAAAAGGACTGCCTGG + Intergenic
1179357343 21:40673047-40673069 CTGCATATGAAGGGCCTTCCTGG - Intronic
1179805645 21:43835424-43835446 GAGGAGAGGAAGGGAGTGCCCGG + Intergenic
1182656913 22:31897967-31897989 GAGCATATGAAAGGAGAGCGTGG - Intronic
1183698905 22:39438592-39438614 GAGCGGAGGACGGGACTGCCTGG - Intergenic
950109234 3:10407916-10407938 GAGCACATGGAGGGCCGGCCTGG + Intronic
955228729 3:57080816-57080838 GCGGATCTGAAGGGACTGCTGGG - Intergenic
957102320 3:75843587-75843609 GAGCATATTAAAGGTATGCCAGG - Intergenic
957262501 3:77920071-77920093 AAGCATATGCAGGGACTCCCTGG + Intergenic
963517718 3:146329240-146329262 GAGCATGTGAACAGATTGCCAGG - Intergenic
964587081 3:158318177-158318199 GAGCATATCCAGGGGCTCCCAGG + Intronic
969106241 4:4809009-4809031 GAACAAATGAAGGGCTTGCCAGG + Intergenic
969841445 4:9885813-9885835 GAGTAAATGAATGGACTGCATGG - Intronic
975350665 4:73342378-73342400 GAGAATATGAAGTGACAGTCTGG - Intergenic
983330593 4:166322672-166322694 GAGCATATGATGGGACAACTGGG - Intergenic
986040872 5:3992877-3992899 CAGCAAATGAAAGCACTGCCTGG + Intergenic
986210692 5:5668407-5668429 GAGCACACAAAGGGACAGCCTGG - Intergenic
988952451 5:36277142-36277164 AAGAAAATGCAGGGACTGCCAGG - Intronic
989647806 5:43654992-43655014 GAGCCTCTGAAGGAACTGCATGG - Intronic
993385295 5:87255015-87255037 GTGCATAGAAAGAGACTGCCAGG - Intergenic
1000693444 5:164350553-164350575 CAGCAAAATAAGGGACTGCCAGG + Intergenic
1001224515 5:169932289-169932311 ACTCATATGAAGGGACTGCATGG + Intronic
1006056769 6:31391005-31391027 TACCAAATGAAGGGATTGCCTGG + Intergenic
1006069488 6:31487920-31487942 TACCAAATGAAGGGATTGCCTGG + Intergenic
1006167793 6:32075416-32075438 GAGCAAATGCAGAGACTGGCAGG - Intronic
1006834243 6:36986896-36986918 GAGCACATGCAGGCACTGCTAGG + Intergenic
1006904335 6:37522968-37522990 GACCATAGGTGGGGACTGCCTGG - Intergenic
1007202943 6:40125981-40126003 GAGGATATGTAGAGACTTCCAGG + Intergenic
1007259643 6:40554611-40554633 GAGAATATGAAGGGGTGGCCTGG - Intronic
1009628397 6:66165207-66165229 GAGCATAAGAAGGCAGCGCCAGG - Intergenic
1011901214 6:92301132-92301154 GAGCATGTGAAGGGGGTGGCAGG - Intergenic
1016738799 6:147507905-147507927 GAGCTTAGGAAGGGAGAGCCAGG + Intergenic
1018174975 6:161170704-161170726 CAGCACAAGAAGGGGCTGCCAGG - Intronic
1018634878 6:165852187-165852209 GAGCACATGAAGGGCCTCACAGG - Intronic
1022128734 7:27382443-27382465 GAGCATATGTAGGGAGTCACTGG - Intergenic
1022515840 7:30974582-30974604 GAGGAGGAGAAGGGACTGCCCGG + Intronic
1031389572 7:121197306-121197328 GATCACATGAAAGTACTGCCAGG + Intronic
1035888411 8:3318384-3318406 TAGCATATGAAGTGCCTGCTCGG + Intronic
1038253509 8:25928356-25928378 GAGCATATGAAAGATCTGCATGG - Intronic
1038493881 8:27988252-27988274 GAGCCTCTGAAGGGACACCCAGG + Intronic
1041943616 8:63417134-63417156 CAACATATTAAGGAACTGCCAGG - Intergenic
1045380955 8:101625241-101625263 GTGAATATGAATGGATTGCCAGG - Intronic
1046969409 8:120204868-120204890 GACCACATGAAGAGCCTGCCTGG - Intronic
1048020951 8:130538513-130538535 AAGCATATCCAGGGACTGCAGGG + Intergenic
1048920669 8:139227172-139227194 GAGCACCTGATGGAACTGCCTGG + Intergenic
1049030841 8:140036300-140036322 TAGCAGATGAAGTCACTGCCAGG + Intronic
1056491177 9:87108743-87108765 GAGCATGTGATGTGACAGCCTGG - Intergenic
1059336670 9:113573412-113573434 GGGCATATGGAGGCAGTGCCTGG - Intronic
1060182877 9:121546107-121546129 GGGCATAGGGAGGGACGGCCTGG - Intergenic
1061939325 9:133875617-133875639 GAGCTTTTGAAGGGACTGGCAGG - Intronic
1062653222 9:137589291-137589313 GAGCATAGGCAGGGCCTGCTGGG - Intronic
1186681803 X:11882798-11882820 GAGCATATTTAGGGGCTCCCAGG + Intergenic
1187995940 X:24926749-24926771 GAGCATTTTAAAGGGCTGCCAGG - Intronic
1190233691 X:48600696-48600718 GAGTATAAGGAGGGACAGCCAGG + Intronic
1192848018 X:74925570-74925592 GAGCCTCTGCAGGCACTGCCTGG + Intergenic
1196754872 X:119149169-119149191 GAGCACATGGAGGAACTGTCGGG - Intronic
1197206785 X:123797897-123797919 AAGCATATGATGGAAATGCCAGG + Intergenic