ID: 1102486796

View in Genome Browser
Species Human (GRCh38)
Location 12:113263990-113264012
Sequence AAATCTGAGCCCCATGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 169}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102486794_1102486796 -7 Left 1102486794 12:113263974-113263996 CCAAGTCCTAGAGTTAAAATCTG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1102486796 12:113263990-113264012 AAATCTGAGCCCCATGTCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 169
1102486790_1102486796 16 Left 1102486790 12:113263951-113263973 CCCCCATCTCTTCTGGGACAACT 0: 1
1: 1
2: 0
3: 25
4: 201
Right 1102486796 12:113263990-113264012 AAATCTGAGCCCCATGTCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 169
1102486787_1102486796 24 Left 1102486787 12:113263943-113263965 CCTCATTACCCCCATCTCTTCTG 0: 1
1: 0
2: 3
3: 32
4: 383
Right 1102486796 12:113263990-113264012 AAATCTGAGCCCCATGTCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 169
1102486793_1102486796 13 Left 1102486793 12:113263954-113263976 CCATCTCTTCTGGGACAACTCCA 0: 1
1: 1
2: 1
3: 26
4: 306
Right 1102486796 12:113263990-113264012 AAATCTGAGCCCCATGTCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 169
1102486792_1102486796 14 Left 1102486792 12:113263953-113263975 CCCATCTCTTCTGGGACAACTCC 0: 1
1: 0
2: 2
3: 13
4: 182
Right 1102486796 12:113263990-113264012 AAATCTGAGCCCCATGTCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 169
1102486791_1102486796 15 Left 1102486791 12:113263952-113263974 CCCCATCTCTTCTGGGACAACTC 0: 1
1: 0
2: 2
3: 26
4: 172
Right 1102486796 12:113263990-113264012 AAATCTGAGCCCCATGTCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102486796 Original CRISPR AAATCTGAGCCCCATGTCAG TGG Intronic