ID: 1102487307

View in Genome Browser
Species Human (GRCh38)
Location 12:113266940-113266962
Sequence ATGAAGAAGGAGAAACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1831
Summary {0: 1, 1: 1, 2: 16, 3: 200, 4: 1613}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102487307 Original CRISPR ATGAAGAAGGAGAAACAGGA AGG (reversed) Intronic
900317714 1:2067681-2067703 GTGAAGATGGAGAAACAAGCGGG - Intronic
900917899 1:5651186-5651208 AGGAGGAAGGAGAAGCGGGAGGG + Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
901187315 1:7383218-7383240 AGGAAGAAGGAGGGCCAGGACGG + Intronic
901197914 1:7450518-7450540 ATGCAGAAGTAGAGACAGGTGGG + Intronic
901692306 1:10981451-10981473 AGGAAGAAGGAGAGACAGAGAGG + Intronic
902112504 1:14094152-14094174 ATGAGGAGTGAGAAACGGGAGGG + Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902938520 1:19782552-19782574 AGGAAGAAGGAAAAAAAGGGAGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903680757 1:25095190-25095212 AGGCAGAAGGAACAACAGGAAGG + Intergenic
903807616 1:26016774-26016796 ATGCAGCAAGAGAAACAGGGAGG + Intergenic
903923248 1:26816210-26816232 AGGAAGAAAGAGAAAGAGGGAGG + Intergenic
903989175 1:27253320-27253342 AAGAAGAAGCAGAAACAGAGAGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904819806 1:33234634-33234656 AGGAAGCAGGAGGAACAGGGAGG + Intergenic
904940152 1:34160059-34160081 ATGATGAGGGTGAAACAGGCAGG + Intronic
904944585 1:34189938-34189960 TGGAAGAAGGAGAAAGAGCAAGG - Intronic
905006566 1:34714621-34714643 CTGCGGAAGGAGAGACAGGAAGG + Intronic
905035134 1:34913133-34913155 AGGAAGAAGGGGGAACAGAAAGG + Intronic
905115020 1:35631141-35631163 ATGAACAAGTAGCAACAGGAGGG + Intronic
905320522 1:37113569-37113591 ATGAAGGAGAAGAAAAAGCATGG - Intergenic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
905751483 1:40468406-40468428 AAGAAGAAAAAGAAACTGGATGG + Intergenic
905934820 1:41815062-41815084 ATGAAGAAAGTAAAACAGGATGG + Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906236112 1:44212043-44212065 GTGGAGAAGGAGAAACACTAAGG - Intergenic
906529105 1:46512978-46513000 AGAGAGAAGGAGAAACAGAAGGG - Exonic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906960430 1:50416529-50416551 ATAAAAAAGGAGAAAAAAGAGGG - Intergenic
907071085 1:51535508-51535530 ATGAAGAAATAGAAACAGTATGG - Intergenic
907456629 1:54580547-54580569 AGCAAAAAGGAGAAACAGAACGG - Intronic
907705530 1:56829158-56829180 GAGGAGAAGGAGACACAGGAAGG - Intergenic
907952309 1:59195634-59195656 AAAAAGAAAGAGAAAAAGGAAGG - Intergenic
908600598 1:65735061-65735083 GTGAAGAAAGTGATACAGGAAGG - Intergenic
908897809 1:68920331-68920353 ATGAAGAATGAGAAAGGGAATGG - Intergenic
909425558 1:75520558-75520580 AGAAAGAATGAGAAAGAGGAGGG + Intronic
909704549 1:78565695-78565717 ATGAAGAAGAAGGAAAAGAAAGG - Intergenic
910019287 1:82567198-82567220 ATAAAGGAGAAAAAACAGGACGG + Intergenic
910085107 1:83392086-83392108 ATGAGGAAAGAAAGACAGGAAGG - Intergenic
910378657 1:86601186-86601208 TGGAAGAAGTAGAAACAGGCCGG - Intergenic
910474834 1:87595651-87595673 AAAAAGAAAGAGAAAGAGGAGGG - Intergenic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
910564504 1:88628119-88628141 AAAAAGAAGAAGAAAAAGGAAGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910713073 1:90202004-90202026 AGGAAGAGAGAGAAAGAGGAGGG + Intergenic
910919668 1:92330103-92330125 ATGAAGAATAAGAAACTGGACGG - Intronic
910990763 1:93053554-93053576 ATTGAGAAGGTGAAAAAGGAAGG - Intergenic
911319046 1:96389906-96389928 ATGAATCAGGAGAATCATGATGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911660899 1:100500133-100500155 AGGAACAAGGACAAATAGGAAGG + Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911705431 1:101006351-101006373 ATGAAGTAGGAAAAAAATGATGG + Intronic
911815120 1:102339769-102339791 ATATAAATGGAGAAACAGGAGGG - Intergenic
911856495 1:102884164-102884186 ATGAGGGATGAGAGACAGGAGGG - Intronic
911962400 1:104322165-104322187 ATGAAAAAGGAGACAGAGAAAGG + Intergenic
911986080 1:104624572-104624594 ATGAGAAAGTAGAAACTGGAAGG + Intergenic
912210330 1:107550278-107550300 GAGAAGGAGGAGGAACAGGAGGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912275706 1:108256477-108256499 AGAAAGAAAGAGAAAAAGGAAGG - Intergenic
912292517 1:108437872-108437894 AGAAAGAAAGAGAAAAAGGAAGG + Intronic
912449668 1:109761214-109761236 AGGAAGAAGTAGCAGCAGGATGG - Intronic
912791587 1:112657258-112657280 ACAAAGAAGGAGAAATAGGCCGG - Intronic
912853594 1:113148000-113148022 ATGAAGGGCGAGAGACAGGAGGG - Intergenic
913074900 1:115333756-115333778 ATGAAGAAAGAGAGAGAGGGGGG - Intronic
913153599 1:116071090-116071112 ATAAAGAAGAACAAACAGAAGGG + Intergenic
913351610 1:117867390-117867412 TTGAAAAAGGAAATACAGGATGG + Exonic
913691185 1:121281407-121281429 AAGAAGAAGGAGGAAAAGGAAGG - Intronic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914486945 1:148118913-148118935 ATGAAGAAAGAGAAACTCAAGGG + Intronic
914940634 1:152020024-152020046 ATGAAGAAAGAGAAACTCAAGGG - Intergenic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915208239 1:154287016-154287038 CTGAGGCAGGAGAATCAGGAAGG - Intergenic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
915965901 1:160307861-160307883 TTGTAGAAGGATAAACAGAAGGG + Intronic
916178715 1:162065270-162065292 ATGCAGAAGGAGAGACAGCACGG - Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916584468 1:166138331-166138353 ATGAAGAAAGAGAAACACAGGGG - Intronic
916838141 1:168570439-168570461 ATGAAGAATGAGAGAGAGCATGG - Intergenic
916987312 1:170205697-170205719 ATGAACACTGAGAAACAGAAAGG - Intergenic
917030316 1:170683210-170683232 AGGAAGAAGGAGAAGCAGTTAGG + Intronic
917067840 1:171116182-171116204 ATAAAGAAGGAAAGACACGATGG - Intronic
917175084 1:172225114-172225136 AAGAGGAAGAAGAAACAGGAGGG - Intronic
917225373 1:172775943-172775965 GTGAAGATAGAGAAACAAGATGG + Intergenic
917289553 1:173458463-173458485 ATGTAGAAAGAGAAAGAGTAGGG + Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917448491 1:175126839-175126861 AAGAAGGAGGAGAAATGGGAGGG + Intronic
917624983 1:176836610-176836632 AAGAAGAAGAAGAAATAGAAGGG - Intronic
917644311 1:177014894-177014916 AGGAAGAAAGAGAAACATGAAGG + Intronic
917715220 1:177728574-177728596 AGGAAGAAGGAAGGACAGGAGGG + Intergenic
917819775 1:178750711-178750733 ATGCAGAAGGAGCAATAAGAAGG - Intronic
917989793 1:180362422-180362444 CAAAAGAAGGTGAAACAGGATGG + Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918202358 1:182279351-182279373 ATGAACTAGAAGGAACAGGAGGG + Intergenic
918212714 1:182365812-182365834 ATGAAGCTGGAGAAGCAGGGAGG + Intergenic
918287883 1:183076416-183076438 ATGAAAAATGAGAAACTTGAGGG + Intronic
918761864 1:188420589-188420611 AGGAAGAAGGAGGAAGGGGAAGG - Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919588229 1:199465551-199465573 ATGAAGGAAGAGAGACAGGAGGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919665211 1:200284963-200284985 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920133889 1:203754064-203754086 AAGAAGAAAGAGAGAAAGGAAGG + Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920458259 1:206117134-206117156 AGGAAGATGGGGAATCAGGACGG + Exonic
920478509 1:206299883-206299905 AAGAAGAAGGAGGAAAAGGAAGG - Intronic
921253943 1:213322723-213322745 AAGAAGAAGGAGAAAGAAAATGG - Intergenic
921303302 1:213771046-213771068 AAGAAGGGAGAGAAACAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921557086 1:216611900-216611922 ATGAAGAAGCAGAAATATGGAGG + Intronic
921887507 1:220321549-220321571 AGGAAGGAGGAGGAAGAGGAGGG + Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922175752 1:223195754-223195776 ATAAAGCACCAGAAACAGGATGG + Intergenic
922248761 1:223827016-223827038 GTGAGGAAGGAGGAACAGGTTGG + Intronic
922402712 1:225276928-225276950 AATAAGAAGAAGAAAAAGGAAGG + Intronic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922661906 1:227437518-227437540 AGAAAGAAAGAGAAAGAGGAGGG + Intergenic
922943389 1:229489135-229489157 AAGAAGAAAAAGAAAAAGGAAGG - Intronic
923082906 1:230676272-230676294 ACGAAGAAGGTGAAAAAAGAAGG - Intronic
923127764 1:231047329-231047351 AGGAGGAAGGGGAAAGAGGAGGG - Intergenic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923323432 1:232859000-232859022 AGAAAGAAAGAGAAAAAGGAAGG - Intergenic
923357632 1:233176339-233176361 AGGAAGAAGGAGAGAAAGGAAGG - Intronic
923566502 1:235080387-235080409 ATGAAGAAAGAGAGAAAGGAAGG + Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923717047 1:236433999-236434021 ATGACCATGGAGCAACAGGATGG - Intronic
924111882 1:240708208-240708230 ATGAAGAACGAGAAGAAAGACGG + Intergenic
924196014 1:241607591-241607613 AGGAAGAAAGAGAGAAAGGAGGG + Intronic
924196021 1:241607671-241607693 AGGAAGAAAGAGAGAAAGGAGGG + Intronic
924202845 1:241678037-241678059 TTTCAGAAGGAGAAACAGGGAGG + Intronic
924247653 1:242100518-242100540 ATGGAGATGAGGAAACAGGACGG - Intronic
924405222 1:243737407-243737429 AAGAAGAAGGAATAACAGAAGGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924650137 1:245918513-245918535 ATGAAGCAAGAGAAACATGGAGG - Intronic
1062864216 10:836463-836485 ATGAAAAGGGAGAAAAAGTAAGG - Exonic
1062914101 10:1234287-1234309 GTGAAGAAGGAGAAACTTGGGGG - Intronic
1063197797 10:3759460-3759482 AGGAAGACAGAGAAAAAGGAAGG + Intergenic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063494499 10:6494406-6494428 ATGAAGAAGGTGAACCATGAAGG - Intronic
1063587075 10:7362330-7362352 ACAAGGAAGGAGAAACAGCATGG - Intronic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063865734 10:10363463-10363485 GTAAGGAAGGAGAGACAGGAAGG + Intergenic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1064272669 10:13879659-13879681 AAGAAGGAGGAGGAAGAGGAAGG - Intronic
1064635240 10:17358589-17358611 AGGAAGAAGGAGGAGAAGGAGGG + Intronic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1064769035 10:18704835-18704857 AGAAAGAAAGAGAAAGAGGAAGG - Intergenic
1064857999 10:19793240-19793262 AGGAAGAATGAGAAAGAGAAGGG + Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065066148 10:21966991-21967013 AAGAAGAAGAAGAAAAAGGTGGG - Intronic
1065162530 10:22937851-22937873 ATGGAGACAGAGAAACAGCATGG + Intronic
1065199893 10:23302421-23302443 ATGAAGAGGCAGAGACAGGGTGG - Intronic
1065734596 10:28740234-28740256 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1065988515 10:30982082-30982104 AAAAAGAAAGAGAAAAAGGATGG - Intronic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1066221861 10:33343054-33343076 AGGAAGGAGGAGGAAGAGGAGGG + Intergenic
1066290511 10:34010368-34010390 AGGAAGAAAGAGAGAAAGGAAGG + Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1067128146 10:43537772-43537794 AGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1067161463 10:43828396-43828418 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1067353643 10:45502839-45502861 ATAAAGAAAGAGCAACAGAAAGG + Intronic
1067719769 10:48719610-48719632 GTAAATGAGGAGAAACAGGAGGG + Intronic
1067894683 10:50166077-50166099 CTGAAGGAGGAGCAACTGGAGGG - Intergenic
1067954158 10:50774185-50774207 CTGAAGGAGGAGCAACTGGAGGG + Intronic
1068022328 10:51600962-51600984 AGGAAGAAGGAGAGAAAGGGAGG + Intronic
1068186708 10:53594349-53594371 ATGAAGAATGAAGAAAAGGAGGG - Intergenic
1068376068 10:56182735-56182757 AAGAAGAAAAAGAAAAAGGAAGG + Intergenic
1068690371 10:59907361-59907383 ATGAAGAAAAAAAAAAAGGAAGG + Intergenic
1068692351 10:59930223-59930245 AAGAAGAAAGAGAAAAATGAAGG - Intergenic
1068911212 10:62380290-62380312 AAGGAGGAGGAGAAACAGAAGGG - Intronic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069277892 10:66615454-66615476 AAGAAGAAGGAGACACAGGAAGG + Intronic
1069298473 10:66877101-66877123 ATGAAGTAGGAGTGAGAGGAGGG - Intronic
1069362701 10:67661269-67661291 AGGAAGAAAGAGAAAAAGGAGGG + Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069940372 10:71951378-71951400 AGGAAGAGGGTGAAACAGCAAGG + Intergenic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1070252801 10:74787735-74787757 GTGAGGAAGGAGAACAAGGAAGG + Intergenic
1070320215 10:75348977-75348999 GAGAAAAAAGAGAAACAGGAAGG - Intergenic
1070326106 10:75390333-75390355 GTGAAGGAGGAGGAAGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070578431 10:77698489-77698511 ATGATGAAGGAGGAGAAGGAGGG + Intergenic
1070714279 10:78707914-78707936 AGGAGGAAGGAGAACCAGGAAGG - Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1070852766 10:79581237-79581259 AGAAAGAAAGAGAAACAGAAAGG + Intergenic
1071083485 10:81840569-81840591 ATGAAGAAGAGTAAACAGGGGGG - Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071191424 10:83105882-83105904 AAGAAGAAGAAGGAAAAGGAAGG - Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071948694 10:90678052-90678074 ATGCAGAAAGAGAAAGAGTATGG - Intergenic
1071952273 10:90717372-90717394 ATGAAGAAGGAAAAGGAGCATGG + Intergenic
1071966693 10:90858585-90858607 AGGAAGAAAGAAAAAAAGGAGGG + Intergenic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072222317 10:93336855-93336877 AGGAAGAAGGAAAGAAAGGAAGG + Intronic
1072895949 10:99366837-99366859 AGAAAGAACTAGAAACAGGAAGG - Intronic
1073024920 10:100480867-100480889 ATAAAGATGGGGAAATAGGATGG + Intronic
1073209170 10:101784385-101784407 ATGAAAGAGGAGAAAAGGGAGGG + Intergenic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073535508 10:104273162-104273184 ATCAAGAAGGACAAATTGGATGG - Intronic
1073731371 10:106292114-106292136 AGGAAGAAAGACAGACAGGAAGG + Intergenic
1074125371 10:110524934-110524956 ATGAAGAAGGAGAGACAAAATGG + Intergenic
1074256304 10:111806012-111806034 AGGAAGAAAGACAAACAGCAGGG + Intergenic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1074851407 10:117442360-117442382 AGGAAGAAGAGGAAACAGTAGGG - Intergenic
1075022535 10:118962175-118962197 ATGAGGCCGGAGGAACAGGAGGG + Intergenic
1075291979 10:121238495-121238517 ATGAGGAAGGAGAAGCATAAAGG - Intergenic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075667719 10:124242960-124242982 CTGAGGAGGGAGAAACAGGCGGG + Intergenic
1075908903 10:126106466-126106488 AAGAAGAAGAAGAAAAAGAAGGG - Intronic
1076210745 10:128642722-128642744 AGGCAGAAGGAGATACAAGAGGG + Intergenic
1076597248 10:131631718-131631740 AAGCAGAAGGAAAACCAGGAAGG - Intergenic
1076831842 10:132999338-132999360 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831855 10:132999382-132999404 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831881 10:132999470-132999492 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831907 10:132999558-132999580 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1077872450 11:6273305-6273327 AGGAAGAAGGAAGAAAAGGAGGG + Intergenic
1077890609 11:6415530-6415552 ATCATGAAGGAGGAAGAGGAGGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078444038 11:11390773-11390795 ATAAAGAAAGAAAAACGGGAAGG - Intronic
1078520483 11:12058924-12058946 TAGAAGAAGGAAATACAGGAGGG + Intergenic
1078586011 11:12589749-12589771 AAGAGGCAGGAGAAAAAGGATGG - Intergenic
1078610517 11:12815262-12815284 AAGAAGAAAGGGAAAAAGGAAGG - Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078777007 11:14403044-14403066 GAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1078935076 11:15942667-15942689 AGGAAGAAGGAAAAACAAGATGG + Intergenic
1079237684 11:18701510-18701532 ATGAAGAATGAGTAACAGGGTGG - Intronic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1080039719 11:27746871-27746893 ATGAAGAAAGAGAAGCAGACAGG + Intergenic
1080279536 11:30540730-30540752 ATTAAGAAGGAGGGACAGGCAGG - Intronic
1080487018 11:32719033-32719055 AAGAACAAGGAGATACAGCAAGG + Intronic
1080556604 11:33422587-33422609 AGGAAGAAGGAAAGAAAGGAGGG - Intergenic
1080556623 11:33422784-33422806 ATGAAAAAGAAAAAAAAGGAAGG + Intergenic
1080585003 11:33674103-33674125 AGGTAGAATGAGAAACAGGCAGG - Intergenic
1080665323 11:34330913-34330935 AAGAAGTTGGAGAATCAGGAAGG - Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081205832 11:40274539-40274561 ATGAAAAGGGAGACAGAGGAGGG + Intronic
1081206119 11:40277453-40277475 AAGAAGAGGGGGAAAGAGGAAGG + Intronic
1081514962 11:43819626-43819648 ATGAAGAATGAAGAAGAGGAAGG - Intronic
1081581933 11:44358534-44358556 ATGAAGGAGAAGGAAAAGGATGG - Intergenic
1081734888 11:45395725-45395747 ATGAACAAGGACAAAAAAGATGG + Intergenic
1081797529 11:45831722-45831744 CTGAAGAAAATGAAACAGGATGG + Intergenic
1081797685 11:45832787-45832809 ATGGAAATGGAGGAACAGGATGG - Intergenic
1081804649 11:45883883-45883905 GTGAAGAAGGAGAAAAGGGGAGG + Intergenic
1081887750 11:46513716-46513738 ATGGAGACTGACAAACAGGAAGG + Intronic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083583656 11:63840622-63840644 GTGAGGGTGGAGAAACAGGAAGG - Intronic
1084041234 11:66543828-66543850 ATGAAGCAGCAGGCACAGGAAGG + Exonic
1084230779 11:67751117-67751139 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
1084532137 11:69733622-69733644 AGGAAGGAGGAAAAAAAGGAAGG + Intergenic
1084595456 11:70114178-70114200 TTAAAGATGGAGAAACAGGCTGG + Intronic
1085187009 11:74584097-74584119 ATGACGAAGAAGACAGAGGAGGG + Intronic
1085442017 11:76573899-76573921 AAGAAGGAGGAGAAAGAGAATGG - Intergenic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1085949063 11:81307545-81307567 AAGAGGAAGGGGAAACAGAAGGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1087105368 11:94402158-94402180 ATGGGGAAGGAAAAACAGCATGG - Intergenic
1087332987 11:96806417-96806439 ATTATGAAAGGGAAACAGGAGGG - Intergenic
1087813034 11:102629179-102629201 AAAAAGAAAGAGAAAAAGGAAGG + Intergenic
1087864742 11:103210812-103210834 ATGAAGAGGGAGGAAAAGGTTGG + Intronic
1088028118 11:105211303-105211325 ATGAAGAAGAAGAAGCACAATGG - Intergenic
1088381269 11:109195069-109195091 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
1088420910 11:109645667-109645689 ACGAAGAAAGATAACCAGGATGG + Intergenic
1088489119 11:110369912-110369934 ATGAAGAGAGGGAAATAGGAAGG - Intergenic
1088774992 11:113074027-113074049 ATTTAGAAGGAGAAACACGTCGG + Intronic
1089360211 11:117880593-117880615 ATGAAGCAGGAGAGGCAGGTGGG - Intergenic
1089413037 11:118263103-118263125 ATGAAAAAGAAGAAAAAGAAGGG + Intronic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1089905903 11:122038251-122038273 AAAAAGAAGGAAAAAAAGGAAGG + Intergenic
1089919767 11:122197601-122197623 ATGAGGGAGGTAAAACAGGATGG - Intergenic
1089921970 11:122217490-122217512 ATTAAGAAGTAGAAAAAGGCCGG - Intergenic
1089959638 11:122604516-122604538 AGGAAGAAAGAGAAACAAGGAGG - Intergenic
1090125703 11:124081055-124081077 ATGAAGAAAAATAAACATGAGGG - Intergenic
1090259595 11:125309167-125309189 AGGAAGAAAGAGAGAGAGGAAGG - Intronic
1090345684 11:126068339-126068361 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1090428529 11:126627287-126627309 ATGAGGAAGGAGACAGAGGCTGG + Intronic
1090767551 11:129889736-129889758 ATGAGGAAAGAGAAAAAAGACGG + Intronic
1090902332 11:131044050-131044072 AAGAAGAATGAGAAAAAGAAAGG - Intergenic
1091095339 11:132815816-132815838 AAGAAGAAAGAGATACTGGATGG + Intronic
1091111213 11:132970169-132970191 ATGAAGCATGTGAAAGAGGAGGG - Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091363972 11:135001655-135001677 AAGAAGACGGAGAAGCAGGAAGG + Intergenic
1091439643 12:502539-502561 AAGAGAAAGGAGAAACAGGCGGG + Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091468194 12:703987-704009 AGGAAGAATGAGAAACAGCGTGG + Intergenic
1091880943 12:3977722-3977744 AGGAAGCAGGAGAAACATGGGGG + Intergenic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092059754 12:5538761-5538783 ATGAAGAAAGTGTATCAGGAAGG + Intronic
1092092246 12:5812589-5812611 AAGAGGAAGAAGAAAAAGGAAGG + Intronic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1092504849 12:9087500-9087522 ATGAAGCTGGAGTAAAAGGAAGG + Intronic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093051094 12:14505934-14505956 ATGAGGAAACAGAAACATGACGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093262525 12:16956962-16956984 ATGAAGGAAGTGAAAAAGGAAGG - Intergenic
1093393279 12:18649874-18649896 ACTAAGAAGGAGAAACAAAAAGG - Intergenic
1093425149 12:19020289-19020311 GTGAAGAAGGAGCGAGAGGAAGG - Intergenic
1093636521 12:21477499-21477521 ATAAAGATGGAGAGAAAGGATGG - Intronic
1093722550 12:22461740-22461762 ATGAAGAGGGAAAAAAGGGAGGG + Intronic
1093743609 12:22715139-22715161 AGTAAGAAGGAGAAAGAGGGAGG - Intergenic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094208408 12:27864761-27864783 AGGAGGTAGGAAAAACAGGAAGG - Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094381217 12:29845297-29845319 ATGAAGAAACTGAAACAGAAAGG + Intergenic
1095218465 12:39578583-39578605 ATGAATCAGGAGAATCAGAAGGG + Intronic
1095337715 12:41048710-41048732 AAGAAGAAGGAAAAAAATGAAGG + Intronic
1095517954 12:43027915-43027937 ATTAAGAAGGAAGAAAAGGATGG + Intergenic
1095779866 12:46047860-46047882 ATGTAGTAAAAGAAACAGGAGGG + Intergenic
1095823663 12:46508638-46508660 ATAAAGAATGAGGAAGAGGATGG + Intergenic
1095837490 12:46654484-46654506 ATAAAGCAGGAGAAAAGGGAAGG - Intergenic
1095897966 12:47299781-47299803 AGAAAGAAGGAGGAAAAGGAGGG + Intergenic
1095927210 12:47591140-47591162 ATGAGCAAGGAGGAAAAGGAAGG + Intergenic
1095929111 12:47608012-47608034 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1096447460 12:51706471-51706493 AGGAAGAAGGTGAAGAAGGAGGG + Exonic
1096616944 12:52838646-52838668 AGGAAGAAGGAGGAACAAGAAGG + Intronic
1096783001 12:54001560-54001582 GGAAAGAAGGAGAAACAGCAGGG + Intronic
1096902197 12:54896331-54896353 ATGAGGAATGACAGACAGGAGGG - Intergenic
1097216126 12:57414532-57414554 ATTAAGAATGAGAAGCAGGCCGG + Intronic
1097254629 12:57664457-57664479 AGGAAGAAGGAAAGAAAGGAAGG - Intergenic
1097394303 12:59054905-59054927 AGGAAGAAGGAGACAAAGGCTGG + Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097957000 12:65496478-65496500 AAGAAGAAGGAGTAACAGACAGG + Intergenic
1097965253 12:65572458-65572480 ATGGGGAGGGAGAAACAGAATGG - Intergenic
1098049377 12:66437407-66437429 ATGAGGAAGGAACAACAAGATGG + Intronic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098113093 12:67145019-67145041 TTGCAGAAGAAGAAACAGAAAGG - Intergenic
1098196615 12:68008720-68008742 AAGTAGAAGGGGAAACAGCATGG + Intergenic
1098200406 12:68048607-68048629 ATGAAGAGGGAAACACAAGAAGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098341939 12:69460680-69460702 ATGAAGGAGAAGAGAAAGGATGG + Intergenic
1098460806 12:70731089-70731111 AGGAGGAAGGAGAGAGAGGAAGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098895304 12:76053279-76053301 AAGAAGAAGCAGAAACACAAGGG - Exonic
1099536307 12:83849291-83849313 ATGAAGAAGGAGTAAGAGTTTGG - Intergenic
1099746537 12:86711233-86711255 ATGTAGGAAGAGAAACAGTATGG + Intronic
1099850841 12:88094851-88094873 ATGAAGCTGGAAAAACAGGAGGG - Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100176207 12:92033881-92033903 ATGAAGAAAGAGAAGAAGAAAGG + Intronic
1100262857 12:92949423-92949445 AGAAAGAAAGAGAAAAAGGAAGG + Intergenic
1100447690 12:94676451-94676473 AAGAAGAGTGAGAAACAAGAGGG + Intergenic
1100598219 12:96089703-96089725 AGAAAGAAGGAGAGAAAGGAAGG - Intergenic
1100760230 12:97798963-97798985 AATTAGGAGGAGAAACAGGAAGG + Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101469806 12:104986057-104986079 ATAAAAAAGGATAAAGAGGAGGG + Intergenic
1101481308 12:105100331-105100353 GGAAAGAAGGAGAAAGAGGAAGG - Intergenic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102364739 12:112322518-112322540 ATTACGAAGGAGAAACAGGAAGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102887578 12:116533558-116533580 ATGAAGAAGGGGGACAAGGAGGG - Intergenic
1103000430 12:117381669-117381691 ATGAAGAAAGAAAAACAGGGAGG - Intronic
1103038621 12:117676462-117676484 ACTAAGAAGGAGAAAAAGAAGGG + Intronic
1103130552 12:118464786-118464808 TAGAACAAGGAGACACAGGAAGG + Intergenic
1103158152 12:118705389-118705411 CTGAAAAAGGAGAAACATCAAGG - Intergenic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103480856 12:121248902-121248924 ATGAAGACGGAGAGACAGGACGG + Intronic
1103633199 12:122279973-122279995 AAGACGAAGGAGGAACAGGGAGG + Intronic
1103662072 12:122528227-122528249 ATGAAGAAGGAGGGACAGGTTGG - Intronic
1103676995 12:122663662-122663684 ATGAAGAAAGAAAAACAGGCCGG - Intergenic
1103855116 12:123962623-123962645 ATTCAGAAGGCGGAACAGGATGG + Intronic
1103969330 12:124660190-124660212 ATTAGGAAAGAGAGACAGGAGGG + Intergenic
1104152826 12:126100922-126100944 AAGAAGAAAGAAAAAAAGGAAGG + Intergenic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104301697 12:127570410-127570432 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
1104316190 12:127704214-127704236 AAGAAGCAGAAGAAACAAGAAGG + Intergenic
1104316195 12:127704249-127704271 AGGAAGCAGAAGAAACAAGAAGG + Intergenic
1104392761 12:128404938-128404960 AAGAAAATGGATAAACAGGAAGG + Intronic
1104710511 12:130982534-130982556 AAGAAGAAGGAAGAAGAGGAGGG - Intronic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1104830462 12:131747451-131747473 ATGAGGTAGGAGAAGCAGGCAGG + Intronic
1105508681 13:21033239-21033261 AGAAAGAAAGAGAAACAGGGAGG + Intronic
1105662949 13:22519531-22519553 ATGAAAAAGGACAAACATGAAGG + Intergenic
1105775469 13:23655457-23655479 CTGAAGAAGTGGAAATAGGAAGG - Intronic
1105887391 13:24653505-24653527 ATCAAGGAGGAAAACCAGGAGGG + Intergenic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106007625 13:25785834-25785856 ATGAGGAAGAAGATAAAGGAAGG + Intronic
1106195622 13:27491718-27491740 AGGAAGAGGAAGAAACAGGAGGG + Intergenic
1106505014 13:30363677-30363699 ATGGTGTAGGAGAAAAAGGATGG - Intergenic
1106521241 13:30499476-30499498 AAGAAAAAAGAGAAACGGGAAGG - Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106812005 13:33368030-33368052 AATAAGAAAGAGAAAGAGGAAGG - Intergenic
1106872782 13:34039637-34039659 AAGAAGAAGGAAAAAGAGAAGGG - Intergenic
1107104932 13:36632924-36632946 ACGAAGAAAGAGAACCAGCAAGG + Intergenic
1107436498 13:40385050-40385072 ATAAAAAAGGAAAAAAAGGAAGG - Intergenic
1107666924 13:42700159-42700181 CTGAAGAAGTAAAGACAGGAAGG + Intergenic
1107668587 13:42718680-42718702 AAGAAGGAGGAGAAAGAAGAGGG + Intergenic
1108000029 13:45897286-45897308 AGAAAGAAAGAGAAAAAGGAAGG - Intergenic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1108173121 13:47764269-47764291 AAGAAGAAGCAGAAACACAAGGG + Intergenic
1108256205 13:48613375-48613397 AGGAAGAGTCAGAAACAGGAGGG + Intergenic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1108393901 13:49974438-49974460 TTAAAGATGGAGAAACAGGCCGG - Intergenic
1108626589 13:52234738-52234760 ATGAGGAAGGAAGAACAGCAGGG + Intergenic
1108647334 13:52443430-52443452 AAGAAGAGGAAGAGACAGGAGGG + Intronic
1108659481 13:52571752-52571774 ATGAGGAAGGAAGAACAGCAGGG - Intergenic
1108762902 13:53591640-53591662 AGGAAGAGGGAGAGACAGAAGGG + Intergenic
1109185770 13:59265797-59265819 ATGAAAAAGAAAAAAAAGGAAGG - Intergenic
1109214318 13:59570554-59570576 AGGAAGAAGGAGAGAAGGGATGG + Intergenic
1109374800 13:61478244-61478266 ATTAAGAAAGAGAAACAGCAAGG - Intergenic
1109689963 13:65873566-65873588 ATGAAGAAGGAAAGGAAGGAAGG + Intergenic
1109897202 13:68708757-68708779 ATGACCTAGAAGAAACAGGAAGG - Intergenic
1109918508 13:69023817-69023839 AAGAAGTAGTAGAAACAGGAAGG - Intergenic
1109977231 13:69854337-69854359 ATGAAGAAAGAGAGAGAGCATGG + Intronic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110420735 13:75304800-75304822 AGGAAGAAGGAGAATAGGGAGGG + Intronic
1110470380 13:75853396-75853418 GAGAAGAAAGAGAAACAGCAAGG - Intronic
1110502643 13:76246725-76246747 AAGAAGAAGAAGAAAAAGAAGGG - Intergenic
1110609517 13:77473601-77473623 GTGAAGATGGAGAGACAGAAAGG + Intergenic
1110701728 13:78556214-78556236 GTGAAGAAGGGGGAACAGCAGGG + Intergenic
1111307072 13:86428487-86428509 ATGAATAAGAAGAATCAGTATGG - Intergenic
1111393873 13:87636996-87637018 AATAAGAAGAAAAAACAGGATGG + Intergenic
1111425363 13:88073130-88073152 ATGAAGTAGGAGAACCAGAGTGG - Intergenic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1112786251 13:102954912-102954934 AAGAAGAAAGAGGAAGAGGAGGG - Intergenic
1112995406 13:105568583-105568605 ATGAGGAAGCAGAAACAGTAGGG + Intergenic
1113053056 13:106236262-106236284 AAGAAGAAGAAGAAAAAGAAAGG - Intergenic
1113303876 13:109054968-109054990 AGGAAGAAGGAGGAAAAGGAGGG - Intronic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1114050944 14:18919485-18919507 ATGGAGGGGGAGAAACAGGGTGG - Intergenic
1114111615 14:19482437-19482459 ATGGAGGGGGAGAAACAGGGTGG + Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114737886 14:25061751-25061773 ATAAAGAAAAAGAAAGAGGAAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115440014 14:33423907-33423929 TTGAAGAAGGAAAAAATGGAGGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115703899 14:35978532-35978554 CTGAGGCAGGAGAAACAGGCAGG + Intergenic
1115841260 14:37473220-37473242 AGGAAGCAGGAGAAAGAGGCGGG - Intronic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116095785 14:40365039-40365061 ATGAGGAGTGAGAGACAGGATGG + Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116255846 14:42554274-42554296 AGGAAGGAGGAGAAGAAGGAAGG + Intergenic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1116427342 14:44807100-44807122 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117296281 14:54382616-54382638 ATGAAGAAGGAGAGAGATGGGGG - Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117459338 14:55929242-55929264 AGGAGGAAGGAGAAAAGGGAAGG + Intergenic
1117570487 14:57044334-57044356 TTGAAGAAAGAAAGACAGGAAGG + Intergenic
1117601556 14:57381148-57381170 AGGAAGAAGGAAAGAAAGGAAGG + Intergenic
1117896967 14:60497042-60497064 ATGAAGATGGAGAGATAGGTAGG - Intronic
1118375320 14:65171777-65171799 AAGAAGAAGAAGAAGCTGGAAGG + Intergenic
1118411152 14:65479651-65479673 GCAAAGAAGGAAAAACAGGAGGG - Intronic
1118559045 14:67057686-67057708 AACAAGAAAGAGAAAGAGGAAGG - Intronic
1118767698 14:68921134-68921156 ATCAAGAGGGAGGAAGAGGAAGG + Intronic
1118848015 14:69562738-69562760 ATGAACAAGGAGGTAGAGGAGGG + Intergenic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119642250 14:76324132-76324154 CTGAAGAAGGAAAAATAGGGCGG + Intronic
1119676892 14:76562540-76562562 AGGAAGAAGGAGAGCCAGGAGGG + Intergenic
1119891757 14:78188080-78188102 TTAGAGATGGAGAAACAGGATGG + Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120056075 14:79925640-79925662 AGGAAGAAAGAGAGAAAGGAAGG + Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120385195 14:83836637-83836659 ATGAACAGGGTAAAACAGGAAGG + Intergenic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1120802578 14:88708483-88708505 TTGAAGAAAGAGAAAAAGAAAGG + Intronic
1120880740 14:89413764-89413786 AAGAAGAAGGAAAAAAAGAAGGG + Intronic
1120892724 14:89505371-89505393 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1120998541 14:90435076-90435098 ATGAAGAAGGAGACAAAGACAGG - Intergenic
1121615646 14:95311809-95311831 ATGAAGAAGGTGGCAGAGGATGG - Intronic
1121735714 14:96216701-96216723 AGGAAGGAGGAGGAAGAGGAAGG + Intronic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122201850 14:100127629-100127651 GTGAGGAAGGAGGAAAAGGATGG - Intronic
1122436007 14:101699715-101699737 ATGAAGTAACAAAAACAGGATGG + Intergenic
1123695039 15:22872978-22873000 AACAAGAAGCAGAAACAGAATGG + Intronic
1123974673 15:25541947-25541969 ATGAAGACCAAGAAACAAGATGG - Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125036765 15:35134317-35134339 AGGAAGGAAGAGAAAGAGGAAGG - Intergenic
1125222016 15:37349479-37349501 ATGCAGAAGGGGAATCAGAACGG + Intergenic
1125254819 15:37751411-37751433 AAGAGGAAGGAAAAAGAGGAAGG + Intergenic
1125255476 15:37758399-37758421 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1125972556 15:43923617-43923639 ATGAAGCTGGAGAAATAGGCAGG + Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126192734 15:45895443-45895465 ATTAGGAAGGATAAAAAGGAAGG + Intergenic
1126240955 15:46442793-46442815 AATAGGAAGGAGATACAGGAGGG - Intergenic
1126274102 15:46855965-46855987 ATGAAGAAGTAGAAAATGTAGGG - Intergenic
1126475835 15:49064070-49064092 AGAAAGAAGGAGAAACTTGATGG - Intergenic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126634354 15:50766568-50766590 GTGAAGATGGGGAGACAGGAAGG - Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126870577 15:52982716-52982738 AGGAAGAAGGGGAAAAAGGAAGG - Intergenic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127852562 15:62926570-62926592 ATGAAGAAGGAGAGCCAGATAGG - Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128219061 15:65954858-65954880 ATAAAGAAGGGGGAACAGGGAGG + Intronic
1128595824 15:68948342-68948364 ATTAAGAGGGAGAATCAGGCCGG + Intronic
1128830594 15:70764404-70764426 AAGAGGATGAAGAAACAGGAAGG + Intergenic
1128835605 15:70806920-70806942 ATGAAGCATGGGAAAGAGGAGGG + Intergenic
1128839685 15:70840168-70840190 ATGAAAAAGGAGATGCAAGATGG + Intronic
1128907555 15:71481603-71481625 ATGAAGAGGGGCAAAAAGGAAGG - Intronic
1129389760 15:75214668-75214690 GTGCAGCAGGAGAGACAGGAGGG - Intergenic
1129651809 15:77496439-77496461 ATGGAAAAGGAGAAACTGGATGG - Intergenic
1129658829 15:77541920-77541942 AAGAAGGAGGAGAAAAAGAAGGG - Intergenic
1129751044 15:78064369-78064391 ATCACGAAGGAGCCACAGGAAGG + Intronic
1129831927 15:78676284-78676306 GTGGAGGAAGAGAAACAGGAGGG + Intronic
1130127399 15:81105252-81105274 AGAAAGAAAGAGAAAGAGGAAGG - Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130822219 15:87507758-87507780 ATGAGGTGGGAGAAACAGCAAGG - Intergenic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131262957 15:90898249-90898271 AGGAACAAGGACAACCAGGAGGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131340005 15:91590204-91590226 AAGAAGAAAGAGGAAAAGGAAGG + Intergenic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132510730 16:340022-340044 AAGAAGAAGAAGAAAAAGAAAGG - Intronic
1133166337 16:3950196-3950218 AGAAGGAACGAGAAACAGGAAGG - Intergenic
1133313838 16:4869765-4869787 ATCTAGATGGAGAAACTGGAGGG + Intronic
1133580716 16:7141991-7142013 AAGAAGAAGGAGGAAGAAGAAGG - Intronic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1133834940 16:9359506-9359528 GTGAGAAAGGTGAAACAGGAGGG - Intergenic
1133959461 16:10480384-10480406 GGGAAGGAGGAGAAACAGAAAGG - Intronic
1134074931 16:11284004-11284026 AGCAGGAAGGAGAAAGAGGAGGG + Intronic
1134537062 16:15034643-15034665 ATGAAGAACGGGAACCAGGGCGG - Intronic
1134751411 16:16628261-16628283 AAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135781488 16:25305949-25305971 ATGATGAAGGAGATAGAGTATGG + Intergenic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1135946809 16:26872450-26872472 ATAAATTAGGAGAGACAGGAAGG + Intergenic
1136006593 16:27334578-27334600 ATGAATAAAGAGAAACAGAGAGG - Intronic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136077921 16:27829528-27829550 ATGAGGAATGTGAAACAGAAAGG - Intronic
1136240078 16:28938157-28938179 AAGAAAAAGAAGAAACTGGAGGG - Intronic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1136539107 16:30918743-30918765 AGGAGGAAGGAGAAGAAGGAAGG - Intergenic
1136577904 16:31135174-31135196 AGAAAGAAAGAGAAAGAGGAGGG + Intronic
1136939666 16:34510991-34511013 GGGAAGAAGGAGGAAAAGGAGGG - Intergenic
1136960154 16:34837569-34837591 GGGAAGAAGGAGGAAAAGGAGGG + Intergenic
1137036456 16:35573765-35573787 ATGAGGAAGAAGAAACTGAAGGG + Intergenic
1137530599 16:49276562-49276584 AAGAAGAGGGAGAAAGAAGAGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137804307 16:51288899-51288921 ATGACGAAGGAGCAAAAAGAAGG - Intergenic
1137951406 16:52787126-52787148 ATGAAGAGGGAGAAATGGGGAGG - Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138293860 16:55870323-55870345 AAGAAGAAAGAGGAAGAGGAAGG + Intronic
1138293872 16:55870396-55870418 AAGAAGGAAGAGAAAGAGGAAGG + Intronic
1138335326 16:56248578-56248600 ATGAAGAAAAATAAACAGGGAGG + Intronic
1138436208 16:57001411-57001433 CTCAAGAGGCAGAAACAGGATGG + Intronic
1138877642 16:60972177-60972199 AAGAAGGAGGAGAAAAAAGAAGG - Intergenic
1138912509 16:61418795-61418817 AGAAAGAAAGAGAAAAAGGAAGG - Intergenic
1138991598 16:62397064-62397086 AAGAAGAAGGAAGAAAAGGAAGG + Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139769303 16:69260407-69260429 AGGTAGAAGGAGAAAAAGGGAGG - Intronic
1139946308 16:70644822-70644844 AGGAGGAAGGAGGAAGAGGAAGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1140149620 16:72348978-72349000 ATGAAGACAGAGAGACTGGAAGG - Intergenic
1140513107 16:75522408-75522430 AATAAAAAGGAGAAAAAGGAAGG - Intergenic
1140773151 16:78224297-78224319 ACAAAGAAGGAAAAACAGGCCGG - Intronic
1140781928 16:78304925-78304947 AGGAAGAAGGGAAAAGAGGAAGG - Intronic
1141263073 16:82471333-82471355 AAGGAGAAGGAGAAACAGAAGGG - Intergenic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141585609 16:85031583-85031605 ATGAAGCTGGAGAAACAGGCAGG - Intronic
1141711412 16:85701386-85701408 AAGAAGAAGGAAAAAGATGAAGG - Intronic
1141727830 16:85801154-85801176 ATGAATAAGGACAAACAGCAAGG - Intronic
1141803878 16:86329820-86329842 ATGAAGAAGGGAAAGAAGGAAGG - Intergenic
1141867037 16:86757475-86757497 AAGAAAAATGAGAACCAGGAAGG + Intergenic
1142243881 16:88959638-88959660 AGGAAGGAGGAGGAAAAGGAGGG - Intronic
1142431349 16:90029631-90029653 AACAAGAAGGAGCAGCAGGAGGG - Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142795039 17:2301138-2301160 GTAAAAAAGGAGAAAAAGGAGGG + Intronic
1142832879 17:2562352-2562374 AGGAAGAAAGAGAAAGAGAAAGG + Intergenic
1143148470 17:4791371-4791393 ATGATGAAAGAGAAACAGAAGGG - Intergenic
1143365334 17:6404643-6404665 ATGAAAAAAGAAAAACAAGATGG + Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143434894 17:6916069-6916091 ATTCAGAAGGAGATTCAGGAGGG + Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1143890031 17:10095943-10095965 AGGAATGAGGAGGAACAGGAAGG - Intronic
1143918858 17:10315026-10315048 ATAATGAAGAAGAAAGAGGAGGG + Intronic
1143924786 17:10359970-10359992 AAGAAGAAGGAGACACAGCCAGG - Exonic
1144001127 17:11056176-11056198 AAAGAGAAGGAGAAACAGAAAGG - Intergenic
1144035034 17:11357217-11357239 AAGAAGAAGAAGAAGCAGGGAGG + Intronic
1144101213 17:11943779-11943801 ATAAGGAAGGAGAGACAGGAGGG + Intronic
1144152539 17:12463993-12464015 AAGATGGAGGAGAAACAGAAGGG - Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144225059 17:13137229-13137251 ATGATGTAGGAGAAAGAGCATGG - Intergenic
1144746787 17:17621370-17621392 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
1144746792 17:17621409-17621431 AAGAAGAAGGAAGAAGAGGAAGG + Intergenic
1145026936 17:19475455-19475477 CTGAGGAAGGAGAATCAGGCAGG - Intergenic
1145049191 17:19646555-19646577 ATGAAAAAGAAAAAACAGGCCGG - Intergenic
1145064935 17:19755815-19755837 AGGAAGATGGGGAACCAGGATGG - Intergenic
1146269065 17:31472634-31472656 ATCAAGAAGGCGAAGCAGAAGGG + Intronic
1146495111 17:33314858-33314880 AAGAAGAAGAAGAAAAAGAAAGG - Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146796817 17:35787443-35787465 AGAAAGAAGGAGAAAAAGAAAGG - Intronic
1147112692 17:38275243-38275265 ATGAAGAAACTGAAACAGCAAGG - Intergenic
1147134042 17:38425177-38425199 ATGAGGAAGGAAACACAGGCGGG - Intergenic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147332164 17:39705557-39705579 ACAAAGAGGGAGGAACAGGAGGG - Intronic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147511898 17:41076990-41077012 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1147663485 17:42130087-42130109 AAGAAGGGGCAGAAACAGGATGG + Intronic
1147780238 17:42935694-42935716 ATTAAGAAACAGAAACAGGCTGG - Intergenic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148376609 17:47153384-47153406 ATGAAGAAGGCAAAACAAAATGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148882985 17:50745853-50745875 AGGAAGAAAGAGAAAAAGAAAGG + Exonic
1149042364 17:52205205-52205227 ATGAAGTAAGAGAAACCAGAAGG - Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149127335 17:53251480-53251502 TTCAAGAAGGATAAACATGAAGG + Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1149958733 17:61082888-61082910 GTGAGGAAGAAAAAACAGGAGGG - Intronic
1150054982 17:62006308-62006330 AAGGAGAAGGGGAGACAGGAAGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150963814 17:69944749-69944771 TTCTAGAAGAAGAAACAGGAAGG + Intergenic
1150998240 17:70343774-70343796 ATGAGGAAAGATAAAAAGGAAGG + Intergenic
1151023818 17:70653454-70653476 ATTAGGAAGGAGAAAAAGAAGGG + Intergenic
1151029297 17:70717582-70717604 ATGAAGAAGAAAAAAAATGATGG - Intergenic
1151190605 17:72395076-72395098 CAGTAGAGGGAGAAACAGGAAGG + Intergenic
1151360582 17:73586276-73586298 ATAAATAAAGAGCAACAGGAGGG - Intronic
1151484511 17:74389934-74389956 AGGAAGAAAGAGAGAAAGGAAGG - Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151815876 17:76471167-76471189 AGGTAGGAGGAGAAAGAGGAAGG + Exonic
1152072645 17:78141598-78141620 GTGAAGGAAGAGTAACAGGAAGG - Exonic
1152221762 17:79072636-79072658 ATGAAGGAGGAGGCAGAGGAAGG + Intergenic
1152261582 17:79270103-79270125 AGGACGGAGGAGAACCAGGAGGG - Intronic
1152696541 17:81800511-81800533 ATGCAGGAAGGGAAACAGGAGGG - Intergenic
1152891125 17:82882259-82882281 AGGAGGCAGGAGAAACAGGTGGG - Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153572873 18:6491102-6491124 AAGAAGGAGGAGGAACAGGAAGG - Intergenic
1153636069 18:7115007-7115029 AAGAAGAAGGAAAAAAAGAATGG + Intronic
1153645609 18:7193401-7193423 AAGAAAAAAAAGAAACAGGATGG - Intergenic
1153739265 18:8106024-8106046 ATGAAGAAGGAGGTACCTGAGGG - Intronic
1153949015 18:10042105-10042127 ATGAAGAGAGAGAGACAGAAAGG + Intergenic
1154155037 18:11937347-11937369 AAGAAGAAGAAGAAACAAAAGGG + Intergenic
1154395825 18:13987679-13987701 AACAGGAAGGAGCAACAGGAAGG - Intergenic
1155116502 18:22773556-22773578 AGGAAGCAGGAGAGAGAGGAGGG - Intergenic
1155586666 18:27374467-27374489 ATGAGGAAGGAGAAACACTTTGG + Intergenic
1155712406 18:28899458-28899480 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1155872668 18:31046675-31046697 ATTAACAAGGAGATACTGGAAGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156315458 18:35965129-35965151 AAGGAGAAGGAGAAAAAAGAAGG - Intergenic
1156336563 18:36178115-36178137 CCGAGGAGGGAGAAACAGGAAGG - Intronic
1156685585 18:39641634-39641656 AAGTACAAGGAGTAACAGGACGG + Intergenic
1157122532 18:44924975-44924997 ATCAAGAAGGAAAAAGAGCATGG - Intronic
1157334135 18:46724974-46724996 AGGAAGAAAGAGAGAGAGGAAGG + Intronic
1157531286 18:48423080-48423102 GGGAAGGAGGAGAAACTGGAGGG - Intergenic
1157771908 18:50356397-50356419 GTGAAGAAAGAGAAACATGAGGG - Intergenic
1157894806 18:51455682-51455704 AAGAGGAAGGATAAAGAGGAAGG + Intergenic
1158087510 18:53670066-53670088 AAGAAAAAGGACAAAAAGGAGGG - Intergenic
1158872769 18:61704646-61704668 ATGAGGGATGAGAGACAGGAGGG - Intergenic
1159109676 18:64042391-64042413 AAGAAGATGGAGAGGCAGGATGG + Intergenic
1159588076 18:70301291-70301313 ATAATGCAGGAGAAAGAGGATGG + Intronic
1159600824 18:70427196-70427218 AGGAAGAAGCAGATAAAGGAAGG - Intergenic
1159780604 18:72656406-72656428 ATGAAGTTGTAGAAACTGGAAGG - Intergenic
1159924692 18:74257521-74257543 ATGAACAAGGAGAAAGAATATGG + Intronic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160047291 18:75398780-75398802 ATGAAGAGAGAGAGAGAGGAAGG - Intergenic
1160912347 19:1480591-1480613 AGGAAGGAGAAGAAAAAGGAAGG + Intergenic
1160947440 19:1650311-1650333 ATGGACAGGGAGAAACAGGGAGG + Intronic
1161019073 19:1999368-1999390 TGGAAGGAGGAGAAACAGGCCGG + Intronic
1161274908 19:3410522-3410544 GTGAGGAAGGGGAGACAGGAAGG + Intronic
1161417438 19:4155341-4155363 AAGAAGAAAGAGAGAAAGGAAGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161756594 19:6138511-6138533 AAGAGGAAGGAGGAAAAGGAAGG + Intronic
1161788856 19:6346464-6346486 AAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1162011026 19:7815253-7815275 AAGAAGAATAAGGAACAGGATGG - Intergenic
1162104702 19:8363403-8363425 AGGAAGAAGGAAAGAAAGGAAGG - Intronic
1162404094 19:10463068-10463090 AAGAAGAAAGAGAAAGAAGAAGG - Intronic
1162815817 19:13193778-13193800 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1163374994 19:16924560-16924582 ATAAAGAAGAAGAAACAGTCAGG - Intronic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1163965335 19:20741455-20741477 CTGAAGAAGGAGAAATAACATGG - Intronic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164445611 19:28315084-28315106 GTGAAGAAAGACAAACAAGAAGG + Intergenic
1164856322 19:31527454-31527476 ATGAAGGAAGGGAAACAGAAGGG + Intergenic
1165100544 19:33436145-33436167 AGGAAGATGGAGGAAGAGGAAGG + Intronic
1165207253 19:34200555-34200577 ATAAAGATGGAGAAACAGAGTGG + Intronic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1165468777 19:35990869-35990891 AGGAAGAAGGAGGAAGAAGAAGG + Intergenic
1166056383 19:40291939-40291961 ATGAAGTTAGAGAAACAGGCAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166328745 19:42066799-42066821 AGGAAGAGGGAGACAGAGGATGG + Intronic
1166524290 19:43501567-43501589 AGGGAGAAGGAAAACCAGGAGGG + Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166805721 19:45485787-45485809 ATCCTGAAGGAGAAACAGGTGGG + Exonic
1166885769 19:45960177-45960199 AGGAAAAAAGAGACACAGGAAGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166979549 19:46624429-46624451 AGAGAGAAAGAGAAACAGGAAGG - Intronic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167749426 19:51370931-51370953 ATGAAGAGGGAGAGGCAGGTGGG - Intergenic
1167806393 19:51789262-51789284 ATCAAAAAGGAGAAATAGGAAGG + Intronic
1167831963 19:52030971-52030993 ATGAAGAAAAAGGAACAGAAAGG + Intergenic
1168236668 19:55068026-55068048 AGAGAGAAGGAGACACAGGAGGG - Intronic
925485274 2:4321860-4321882 GAGAACAAGGAGAAAAAGGAAGG - Intergenic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
925965692 2:9063112-9063134 AGGAAGAGAGAGAAAGAGGAAGG + Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926574461 2:14564705-14564727 CTCAAGAAGAAGAAACAGGAGGG + Intergenic
926726844 2:16005174-16005196 AAGGAGAAGGAGAAACAAGTCGG - Intergenic
926853458 2:17226635-17226657 AGGAAGAAAGAAAAAGAGGAGGG + Intergenic
926923162 2:17959449-17959471 AAGAAGAAGAAGAAAAAGAATGG - Intronic
927208838 2:20626531-20626553 ATGAGGAAGGTGATATAGGATGG + Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927733395 2:25496281-25496303 ATGAACAAGGAGAACAAGGAAGG - Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
928157849 2:28893275-28893297 ATAAATCTGGAGAAACAGGAGGG + Intergenic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
928401124 2:30979459-30979481 ATCAAGGAGGAGAGACAGGGAGG + Intronic
928710906 2:34004585-34004607 ATTAAAAAGGAGATACAGAATGG - Intergenic
928785543 2:34881207-34881229 TTAAAGAAGGAGCAAAAGGAAGG - Intergenic
929015015 2:37485260-37485282 AAGAAGAAGGAGGAAGAAGAAGG - Intergenic
929168146 2:38904407-38904429 ATGAAGATGAAAAAACAGGCCGG + Intronic
929231955 2:39569207-39569229 TTGAGGAGGGAGAAAAAGGAAGG - Intergenic
929984250 2:46710840-46710862 ACGGAAAAGGAGAAACAGCAAGG - Intronic
929985564 2:46728300-46728322 ATTCAGTAGGAGAGACAGGATGG + Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930371466 2:50506740-50506762 AGGAAGAAAGAGAGAGAGGAGGG + Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
930659321 2:54038080-54038102 ATGAAGTAGGAAAAACAAGCTGG + Intronic
930833453 2:55770150-55770172 AGAAAGAAAGAGAAAAAGGAAGG - Intergenic
930919608 2:56736415-56736437 ATGAAGCTGGAGAGAGAGGATGG - Intergenic
930920406 2:56746674-56746696 ATGAAGAAGGGGTGCCAGGAAGG - Intergenic
931157500 2:59652162-59652184 AAGAAGAGGGAGAAACACCAAGG + Intergenic
931255383 2:60567655-60567677 ATGCAAAAGGAAAAAGAGGAGGG + Intergenic
931338556 2:61375471-61375493 ATCAAAAAGTAGAAACAGGCGGG + Intronic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931794765 2:65698782-65698804 AGGAAAAATGAGAAAAAGGAGGG - Intergenic
931852956 2:66271665-66271687 GAGAGAAAGGAGAAACAGGAGGG + Intergenic
932133811 2:69211126-69211148 TTAAACAAGGAGAAACAGGGAGG + Intronic
932170210 2:69548498-69548520 AGGAAGAAAGAGAGAAAGGAAGG - Intronic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932402714 2:71492730-71492752 AGAAAGAGGGAGAAACAAGAAGG - Intronic
932486061 2:72085101-72085123 ATGTAGAATGAGAAGCAGGGTGG + Intergenic
932489131 2:72107877-72107899 ATTCAGAAAAAGAAACAGGAAGG - Intergenic
932594622 2:73086385-73086407 GGGAAGCAGGAGAAAGAGGATGG + Intronic
932800927 2:74741759-74741781 ATGAAGAAGTGGAAGCAGCAAGG - Intergenic
933143111 2:78817915-78817937 ATGAGGAAGGATAAAGAGCATGG + Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933204725 2:79493201-79493223 AAGTAGAAAGAAAAACAGGAGGG + Intronic
933260030 2:80122197-80122219 AGAAATAGGGAGAAACAGGACGG - Intronic
933542845 2:83670535-83670557 ATGAAGAAAGAAGAACAGAATGG + Intergenic
933569377 2:83991601-83991623 TTGAAGAAAGAGAAAAAAGAGGG - Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933889044 2:86748884-86748906 ATGAATAAGTAGAAACCTGAAGG + Intronic
933896818 2:86818651-86818673 AAGGAGAAGGAGATACAGAATGG - Intronic
934103728 2:88677502-88677524 ATGCAGAAGGAGAAGCATGTTGG + Intergenic
934535339 2:95128700-95128722 AGGAAGAAGGAGAAAGAAGGAGG + Intronic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
934652382 2:96099915-96099937 GGGAAGAAGGACAAAGAGGAGGG + Intergenic
934729005 2:96644549-96644571 ATGTAGGTGGAGATACAGGACGG + Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935058984 2:99592088-99592110 ATGAAGATACAGTAACAGGAGGG + Intronic
935072624 2:99709002-99709024 AAGAAGGAAGAGAAACAGAAGGG + Intronic
935104087 2:100023525-100023547 CAGAAGAGGGAGAAACAGCAAGG + Intronic
935274253 2:101462704-101462726 ATGATGAAGTGGAAACAAGATGG + Intronic
935416066 2:102820745-102820767 ATGAAGTTGGAGAAGCAGGAAGG + Intronic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
936068328 2:109348738-109348760 AGGAGGAAGGGGAAGCAGGAGGG - Intronic
936376908 2:111948615-111948637 ATGAAAAATGAGAAAAAGGAAGG - Intronic
936553137 2:113468053-113468075 AGGAAGGAGGAGCAACAGGTCGG + Intronic
937138359 2:119575357-119575379 GTGAGGAAGGAGATTCAGGAGGG - Intronic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938091061 2:128435097-128435119 AGGAAGCAGCAGAAGCAGGAAGG + Intergenic
938098525 2:128479426-128479448 CTGGAGCAGGAGAAACAGGGAGG - Intergenic
938394105 2:130929348-130929370 ATGGAGGAAGAGAAACTGGATGG - Intronic
939229438 2:139407648-139407670 ATGAAGTAGGAGTAAAAGGAAGG + Intergenic
939242954 2:139585579-139585601 AGGAAGAAAGAGAAAGAGAAAGG - Intergenic
939341130 2:140897310-140897332 ATGAGGCATGAAAAACAGGAAGG - Intronic
939751890 2:146058299-146058321 AATTAGAATGAGAAACAGGAGGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940280771 2:151987378-151987400 ATGGAGAGAGAGAAACAGAATGG - Intronic
940712967 2:157184540-157184562 ATGGATAAGGAGAAACAGCAAGG - Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
940764891 2:157779881-157779903 ATGAGGAAGGAGATAAAAGAAGG - Intronic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941270591 2:163422532-163422554 ATAAAGAAGAAGACATAGGAAGG + Intergenic
941451594 2:165666605-165666627 ATGAAGAAAGAGAGAAAGGAAGG + Intronic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941511063 2:166410604-166410626 AGGACAAAGGAGAAACAGCAGGG + Intronic
941558619 2:167016178-167016200 AGGAGGAAGGAGAAAAAGGAGGG - Intronic
941647557 2:168057628-168057650 ATGCAGAAGGATTAACAGGCTGG - Intronic
941940228 2:171028875-171028897 ATGAAGAAGGCAAAAAAGGATGG + Intronic
941950827 2:171154677-171154699 ATGAAGTAGTAGAAGCAGTATGG - Intronic
941992822 2:171573626-171573648 ATGAAAAAGGACAAAAAGGAAGG + Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942177879 2:173352366-173352388 ATGAGGATAGAGAGACAGGATGG + Intergenic
942181553 2:173385428-173385450 ACGAAGAATGAAAAACAGGCCGG + Intergenic
942282744 2:174383241-174383263 AGGTAGAAGGAGAAAAAGGCAGG + Intronic
942412452 2:175725192-175725214 AACAAAAAGAAGAAACAGGAAGG + Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942663415 2:178290141-178290163 ATGTAGAAGGAATAATAGGATGG - Intronic
942745460 2:179226912-179226934 AGGAAGCAGGAGAAAAAGGAAGG + Intronic
942818393 2:180080487-180080509 AGGAAGAAAGGGAAAAAGGAGGG - Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943553941 2:189377715-189377737 GTGAAGGAGGAGAAAGTGGAGGG - Intergenic
943577909 2:189653047-189653069 TTGAAGCAGGAGAATCAGGCAGG - Intergenic
943587106 2:189754140-189754162 ATGAAAAAGGAAAAAGAGGAAGG - Exonic
943596009 2:189857553-189857575 AAGAAGAAGGAAGAAAAGGATGG - Intronic
943662146 2:190570591-190570613 AGGAGGATGGAGCAACAGGATGG + Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944276393 2:197843298-197843320 ATGAAGAATGTAAAGCAGGAGGG - Intronic
944285749 2:197948105-197948127 ATGAGAAATGAGAAACAGGATGG + Intronic
944453501 2:199869425-199869447 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
944614315 2:201444328-201444350 ATGAGGGAGGAGAAGCAGGCAGG - Intronic
944758308 2:202786784-202786806 ATGAACAAGTAGAAACAATAAGG + Intronic
944936279 2:204572302-204572324 TTGAAGGAGGAGGAAAAGGAGGG + Intronic
945148951 2:206767765-206767787 TTGAAGAAGGAGAGAAGGGAAGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945435344 2:209811020-209811042 TTTAAGAAGGAGAAATGGGATGG + Intronic
945666709 2:212752926-212752948 ATCAAGAGGGAGAAAGAGCAAGG + Intergenic
945719230 2:213397974-213397996 ATTAAGAAGGAGAACATGGAAGG - Intronic
946017332 2:216614528-216614550 AGGAAGGAGGAGAAAGAAGAAGG - Intergenic
946140995 2:217690475-217690497 ATGAAGACAGAGAGACAGCAGGG - Intronic
946377639 2:219322661-219322683 ATGAAAAGAGCGAAACAGGAGGG - Intergenic
946610239 2:221449943-221449965 TTAAAGAAGGAGAAAAAGAATGG - Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
947180550 2:227407577-227407599 TTGAGGAAGGAGGAACAGAAAGG + Intergenic
947308149 2:228770415-228770437 ATAAAGTAGGAAAAAAAGGAAGG - Intergenic
947664048 2:231891952-231891974 AAGATGTAGGAGACACAGGAGGG + Intergenic
947894583 2:233657444-233657466 AAGAAGCAAGAGAAAAAGGAGGG + Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948091959 2:235302248-235302270 AGGAGGAGGGAGAAAGAGGAGGG - Intergenic
948127211 2:235572968-235572990 AAGAAGAAGAAGAAAAAAGATGG - Intronic
948422298 2:237867313-237867335 AAGAAGGAGGAGCAAGAGGAGGG + Intronic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
948648295 2:239422835-239422857 GTGAAGCAGGAGGAGCAGGAAGG + Intergenic
1168838089 20:891131-891153 ATGAAAAAGGGGAAACAGCAAGG + Intronic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169252718 20:4072595-4072617 ATGAAGAAGGGAAACCAGGCAGG + Exonic
1169419580 20:5449145-5449167 AAGGAGAAGGGGAAACAGGGAGG - Intergenic
1169472050 20:5894938-5894960 ATGAATAAGGAAAAAGAGGTGGG - Intergenic
1169586041 20:7086313-7086335 AGAAAGAAGAAAAAACAGGAAGG - Intergenic
1169598912 20:7234381-7234403 AGGAAGAAGGAGATGTAGGAAGG - Intergenic
1169611810 20:7389313-7389335 ATGAAGGGGGAAAAAAAGGAAGG - Intergenic
1169760001 20:9080882-9080904 ATGAAGATTTAGAAACCGGAAGG - Intronic
1169777652 20:9273600-9273622 GTGAAGGAGGAGGAAGAGGAAGG + Intronic
1170051496 20:12150538-12150560 GAGAAGAAGGAGAATCAGTAGGG + Intergenic
1170105044 20:12746051-12746073 AACAAGAAGGAAAAACAAGAGGG - Intergenic
1170163489 20:13339416-13339438 ATAAAGAAGGTGAAAAATGATGG - Intergenic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1170779611 20:19412542-19412564 AGGAAGACGGAGAAGGAGGAGGG + Intronic
1170976995 20:21174028-21174050 AAGAACGAGGAGAACCAGGAGGG + Intronic
1171015526 20:21537608-21537630 AGAAAGAAAGAGAAAGAGGAGGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171202629 20:23254531-23254553 AGGATGAAGGAGAAGAAGGAAGG + Intergenic
1172200663 20:33123939-33123961 AACAAGAAGGAAAAACAAGAGGG + Intergenic
1172784793 20:37460694-37460716 AGTAAGAAGGAGGAAGAGGAAGG + Intergenic
1173052825 20:39581132-39581154 ATCAAGCAAGAGAACCAGGAAGG + Intergenic
1173115865 20:40242056-40242078 AGGAAGTTGGAAAAACAGGAAGG + Intergenic
1173349541 20:42232560-42232582 ATGAGGAAGAGGAAACAGAAAGG - Intronic
1173484821 20:43433286-43433308 AAGAAGAAAGAAAGACAGGAAGG + Intergenic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173761563 20:45565073-45565095 AGGAAGAAAGAGAAAGAGGGAGG + Intronic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173878718 20:46394286-46394308 AGTAAGAACGAGCAACAGGAAGG - Intronic
1173917963 20:46723692-46723714 ATGAGGCAGGAGAAATAGGCAGG - Intronic
1173931707 20:46826354-46826376 AAGCAGAAGAACAAACAGGAGGG + Intergenic
1174149368 20:48475376-48475398 ATGAAGCTGGAGACACAGGGAGG - Intergenic
1174175465 20:48641901-48641923 AGGAAGGAAAAGAAACAGGAGGG + Intronic
1174501340 20:50987259-50987281 AGGAAGAATGAGAAACAGGCAGG + Intergenic
1174651705 20:52131131-52131153 AGGAAGAAAGGAAAACAGGAAGG + Intronic
1174763529 20:53229947-53229969 AGGAAGAAAGAGAAAGAAGAAGG + Intronic
1174835392 20:53852073-53852095 AGGAAGAAGGGGAAAAAGGACGG - Intergenic
1174846992 20:53951973-53951995 AGGAAGAAGGGAAAAAAGGAAGG + Intronic
1174990698 20:55506186-55506208 ATGAAGAAGGGTAAACTGAAAGG - Intergenic
1175083679 20:56441760-56441782 AGGAGGAAGGAGAAACACAAAGG - Intronic
1175159471 20:56997134-56997156 ATGAAGCTGAAGAAAGAGGAAGG + Intergenic
1175175387 20:57108808-57108830 ATGAAGAAGGAGGCAGAGGCAGG - Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175676760 20:60952921-60952943 ATCAGGAAGGAGAAGCAGGATGG + Intergenic
1175719628 20:61278122-61278144 ATGAAGCAGGAGTCACAGGTGGG - Intronic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176031125 20:63012574-63012596 TTTAAGAAGGAAAAACAGGATGG - Intergenic
1176668966 21:9714178-9714200 AAGAAGAAAGAGAAAAAAGAAGG - Intergenic
1176729278 21:10475284-10475306 ATGATGAAGTAGTAACAAGAGGG - Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177919934 21:27139878-27139900 AACAAAAAGGAGAAACAGAATGG + Intergenic
1178083486 21:29089928-29089950 AAGAAGGAGGAAAGACAGGAAGG + Intronic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1178234953 21:30830780-30830802 ATGAAGAACGTAAACCAGGAAGG + Intergenic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1178471010 21:32892944-32892966 ATAAAGAAGGAAGAAAAGGAAGG - Intergenic
1178496222 21:33088700-33088722 AAAAAGAAGGAGAAAAAGGAGGG + Intergenic
1178562706 21:33654025-33654047 AGAAAGAAAGAGAAAGAGGAAGG - Intronic
1178712870 21:34934913-34934935 ATGAAAAAGGGGAAAAATGAAGG - Intronic
1178723997 21:35035254-35035276 AGGAAAAGGGAGAAACAGAAAGG + Intronic
1179020902 21:37640054-37640076 TTACAGAAGGAGACACAGGAAGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179081846 21:38178669-38178691 AAGAAGAAGGAAGAAGAGGAAGG + Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179182291 21:39055722-39055744 ATTTTGCAGGAGAAACAGGAAGG + Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179485544 21:41708081-41708103 AGGAAGAAAGTGACACAGGATGG - Intergenic
1179488587 21:41726499-41726521 AGGAGGAAGGAGGAGCAGGAAGG - Intergenic
1180324390 22:11355941-11355963 AGAAAGAAGGTGACACAGGAAGG + Intergenic
1180469421 22:15641860-15641882 ATGGAGGGGGAGAAACAGGGTGG - Intergenic
1180592938 22:16956206-16956228 ATGAAGAAGGTGAACAAGAAGGG + Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181296830 22:21847096-21847118 CTGAGGCAGGAGAAACAGGCAGG - Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182024117 22:27104095-27104117 ATCAGGAAGGGGAAACAGGAGGG + Intergenic
1182029533 22:27147005-27147027 AGGAAGGAGGAGATACAGGCTGG - Intergenic
1182126088 22:27816834-27816856 AGGAAGAAGGGAAAAAAGGAGGG - Intergenic
1182404667 22:30115797-30115819 ATGAAGAAGGAGGGATTGGATGG + Intronic
1182593224 22:31398306-31398328 ATAAAGAGGGAGAAACAGAAGGG - Intergenic
1182706370 22:32283120-32283142 ATGCAGAAGGAGCAATAGGAGGG - Intergenic
1182707352 22:32293688-32293710 AGGAATAAAGAGCAACAGGAAGG - Intergenic
1182890198 22:33811808-33811830 ATGGATTAGGAGACACAGGAAGG + Intronic
1182907400 22:33950013-33950035 CTGAAGAAGGAGAAACAGAGGGG - Intergenic
1182972669 22:34592476-34592498 ATCACGAAGGAGGAAAAGGAAGG + Intergenic
1183237014 22:36626462-36626484 GGGAAGAAGGAGGAAGAGGAAGG - Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183466647 22:37983603-37983625 GTCAAGAAGGAGCAGCAGGACGG - Exonic
1183628693 22:39020536-39020558 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183632172 22:39040295-39040317 GGGAAGAAGGAGAAGCAGGAAGG + Intergenic
1183637993 22:39076696-39076718 GGGAAGAAGGAGAAGCAGGAAGG + Intronic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1183993783 22:41617996-41618018 AGGAAGAAGTAGCCACAGGAGGG - Intronic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184307657 22:43617521-43617543 ATGAGGAAGGGGAAAATGGATGG - Intronic
1184395693 22:44237077-44237099 AGGAATAAAGAGCAACAGGAAGG - Intergenic
1184656127 22:45943163-45943185 AGGGAGAGGGAGAAACAGGGGGG - Intronic
1184672550 22:46023020-46023042 ATGAAGAAGGAGGAGAAGAAAGG + Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184959117 22:47916076-47916098 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1184990212 22:48162707-48162729 AGAATGAAGGAGAAACAGGGCGG - Intergenic
1185308958 22:50142271-50142293 ATGCAGAAGGAAGAACAGTAGGG + Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949310444 3:2691390-2691412 AAGAAGAAAGAGGAAGAGGAGGG + Intronic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949373121 3:3356599-3356621 ATGAAGAAATAGTAACAGTAGGG + Intergenic
949570142 3:5284623-5284645 ATGAGGCAGGAGAATCAGGCAGG + Intergenic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949825750 3:8163411-8163433 ATTAAGAAGGAGATAGAGGCAGG + Intergenic
949882018 3:8669001-8669023 AAGAAGAAAGGGAAAAAGGAAGG + Intronic
950096493 3:10333733-10333755 ATGAAGAGGGAGAGGCAAGATGG + Intronic
950346733 3:12302242-12302264 ATACAGAAGAAGAAACAAGAAGG + Intronic
950525850 3:13522799-13522821 AAGAAGAGGGAGTAGCAGGATGG - Intergenic
950921163 3:16696086-16696108 AAGAGGAAGGAGGAACAGGGTGG + Intergenic
950996419 3:17502404-17502426 AAGTAGAAGGAAAACCAGGATGG - Intronic
951001330 3:17563438-17563460 ATGAATCAGGAAAATCAGGAAGG + Intronic
951129248 3:19022423-19022445 AGAAAGAAGGTCAAACAGGAAGG - Intergenic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
951781653 3:26370008-26370030 ACCAAGAAGGAAAGACAGGAAGG - Intergenic
951875207 3:27417246-27417268 ATGAACAGGGAGAACCAGGCAGG + Intronic
952169488 3:30791241-30791263 CTGAAAAGGGAGAAAAAGGATGG - Intronic
952516944 3:34114011-34114033 ATGAAGAAGAAGAAAAAGAAAGG - Intergenic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
953552388 3:43913606-43913628 ATGGTGAAGGAGAAACACAAAGG - Intergenic
953688894 3:45100622-45100644 AGGAAGAAAGAGAAATAGAAAGG - Intronic
953763860 3:45717662-45717684 ATGTGGAAGGAGAAAAAGTAAGG + Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954006644 3:47596596-47596618 AAGAAGAAGAAGAAAAAAGATGG + Intronic
954093904 3:48307461-48307483 ATGAAAATGGAGAAAGAAGAGGG - Intronic
954294175 3:49665004-49665026 ATGTGGGAGGAGAAAAAGGAGGG + Intronic
954367420 3:50154107-50154129 AGGAAAGAGGAGAAAGAGGAGGG + Intergenic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
955307457 3:57848584-57848606 AGGAGGAAGGAGGAAGAGGAGGG - Intronic
955959673 3:64327429-64327451 AGGAAAAAAGAGAAAAAGGAGGG + Intronic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956082027 3:65567534-65567556 AAGAAGAAAGAGGAAAAGGATGG + Intronic
956137137 3:66110572-66110594 ATGAAGAGAGAGAAAGAGAAAGG + Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956313961 3:67913835-67913857 TAGAAGAAGGAGGAAAAGGAGGG - Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956429245 3:69167801-69167823 ATGAAAACAGAGAAACAGGCCGG + Intergenic
956673591 3:71714327-71714349 AGAAAGAAAGAGAAAAAGGAAGG + Intronic
956726191 3:72158438-72158460 ATGGAGAGAGAGAGACAGGAAGG + Intergenic
956864659 3:73357106-73357128 ATGAAGAAAGAAAAAGAGGGAGG - Intergenic
956916882 3:73881039-73881061 AAGCAGCAGTAGAAACAGGAAGG + Intergenic
957001328 3:74888934-74888956 AGGAAGAAGGAACAACAGAATGG - Intergenic
957036525 3:75298469-75298491 AGGAAGAAGGAAAGAAAGGAAGG + Intergenic
957047336 3:75386185-75386207 AGAAAGAAGGAGAAGAAGGAAGG + Intergenic
957179884 3:76862718-76862740 AGAAAAAAGCAGAAACAGGAAGG - Intronic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
957926155 3:86814673-86814695 ATGATGCAGGGGAAAAAGGAGGG - Intergenic
957953842 3:87158796-87158818 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
958111983 3:89159940-89159962 AGGAAGAAGGAAAAGAAGGAAGG - Intronic
958134245 3:89466852-89466874 ATTAAAAAAGAGAGACAGGAGGG - Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959188300 3:103075593-103075615 TTGAAAAAGGAGAAAATGGAGGG + Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959580988 3:107982086-107982108 AAGAGGAAGGTGAAAAAGGAAGG + Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959967162 3:112369230-112369252 ATAAAAAAGGAGACACAGGGAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960052596 3:113252527-113252549 ATGGAGAAGCAGTAACAGAATGG + Intronic
960066164 3:113375437-113375459 ATGGAGAAAGACAAAAAGGATGG + Intronic
960373724 3:116872701-116872723 ATGAAGCAGGAGAAAGAAGTCGG + Intronic
960480919 3:118189181-118189203 ATGAAGAGGGAGTAATATGAAGG + Intergenic
960682644 3:120265073-120265095 ATGACTTAGGAGAAGCAGGAGGG + Intronic
960799665 3:121525447-121525469 CTGATGAAGGAGAAACAGAAGGG + Intronic
960953189 3:123012759-123012781 AGGATGAAGGAGGAAGAGGAGGG - Intronic
961080259 3:124020924-124020946 GTGAAGAAGGAAAGAAAGGAAGG + Intergenic
961135647 3:124507938-124507960 ACAAAGAAGGAAAAACAGAAAGG - Intronic
961186057 3:124916028-124916050 AAGAAAAAGGAGAAACAACAGGG - Intronic
961194867 3:124993197-124993219 ATGCAGAATGAGACACAGCAGGG - Intronic
961624874 3:128254908-128254930 ATTAAGAATGAAAATCAGGATGG + Intronic
961661950 3:128473630-128473652 TGGGAGAAGGAGAAACAGAATGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
961987670 3:131154818-131154840 ATGAAGCTGGAGAGACAGGCAGG + Intronic
962108245 3:132416072-132416094 AGGAGGAAAAAGAAACAGGAGGG - Intergenic
962201325 3:133403327-133403349 CTGCAGGTGGAGAAACAGGAGGG - Intronic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962595705 3:136941458-136941480 ATACAGAAAGAGAAACAAGAAGG - Intronic
962938075 3:140100000-140100022 AAAACGAAGGAGAAAGAGGATGG - Intronic
963049580 3:141129485-141129507 AGGAAGCAGGTGCAACAGGATGG - Intronic
963225893 3:142861280-142861302 ATGAAGAAAGATAAACACCAAGG - Intronic
963303088 3:143620613-143620635 TTGAAAAAGGAGAAACAGGGGGG + Intronic
963652943 3:148006989-148007011 AGAAAGAAGGAGGAAGAGGAAGG - Intergenic
963762273 3:149295784-149295806 ATGCACAAGGAGCAGCAGGAAGG - Intergenic
963873096 3:150441386-150441408 AGGTAGAAGGAAAAACAGGAGGG - Intronic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
964564315 3:158033109-158033131 AAGAAGAAGAAGAAAAAGAAGGG + Intergenic
964628761 3:158785623-158785645 TTGAAGAAGGAGAACCAAGTGGG + Intronic
964637029 3:158869415-158869437 AAGAAGAAGACGAAAAAGGAGGG - Intergenic
964785093 3:160387585-160387607 AGGAAGATTGAGAAACAGGTTGG + Intronic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
965043947 3:163551167-163551189 ATGTAGAAAGAGAAAAATGAAGG - Intergenic
965301827 3:167014490-167014512 ATGTAGAATGAGAAATGGGAAGG - Intergenic
965468722 3:169064026-169064048 CTAAAGAAGGAAAAACAGTATGG + Intergenic
965478530 3:169187315-169187337 GTAAAGAATGAGAAACAGTATGG - Intronic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965764430 3:172115158-172115180 AAGAATGAGGAGACACAGGATGG - Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
965924058 3:173956390-173956412 GGGAAGAAGGAGGAAGAGGAAGG - Intronic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966685416 3:182688478-182688500 AGGAAGAAGTAGAAAAAAGAAGG + Intergenic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967280669 3:187820261-187820283 AGGAAGGAGGAGGAAGAGGAGGG - Intergenic
967617561 3:191590377-191590399 TGGAAGAAGGAGAAACAGCATGG + Intergenic
967630984 3:191742784-191742806 AAGATAAAGGAGCAACAGGAGGG - Intergenic
967674413 3:192278860-192278882 ATGGAGAGGGAGGAGCAGGAAGG - Intronic
967949752 3:194831738-194831760 ATGAAACAGGAGACATAGGAGGG + Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968323187 3:197789844-197789866 ATAAAGTAGGACAAACTGGAAGG - Intergenic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968991632 4:3917301-3917323 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
969154382 4:5197132-5197154 ATGAAGAAGGACAATAGGGAGGG + Intronic
969253105 4:5982866-5982888 ATGAAGAAGGTGAAGAATGAGGG + Intronic
969727189 4:8927306-8927328 TAGTAAAAGGAGAAACAGGAGGG - Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970074097 4:12197598-12197620 ATGAGGAAGGAGGCACAGGAAGG + Intergenic
970122162 4:12768182-12768204 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970218840 4:13786497-13786519 ATGAAGAAGGAAAAAAGGGAGGG - Intergenic
970219689 4:13797969-13797991 AGGAAGAAGGAGAAGAAAGAAGG + Intergenic
970286029 4:14516587-14516609 ATGAAGTAGGGCAAACAGCATGG + Intergenic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970696734 4:18686604-18686626 ATAAGGAAGAAGAAAGAGGAGGG + Intergenic
970898772 4:21134212-21134234 ACTAAGAAGGAGGAAGAGGAGGG - Intronic
971055307 4:22906581-22906603 CTGAAGAAGGAACAACTGGAAGG - Intergenic
971132030 4:23822179-23822201 ATCAATAAGGAGCAACAAGATGG - Intronic
971218788 4:24686282-24686304 AAGAAAAAGTAGTAACAGGAGGG + Intergenic
971226825 4:24761825-24761847 CTGAAGAAGGAGAAAGATAAAGG + Intergenic
971278366 4:25219555-25219577 GAGAAGGAGGAGAAACAGGAGGG + Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971394338 4:26214641-26214663 AAAAAGAAAGAGAAAAAGGAAGG + Intronic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971667427 4:29507582-29507604 GTGAAGAAAGAGAAACACAAAGG - Intergenic
971735660 4:30447116-30447138 GTGAAGAAGCATACACAGGAGGG + Intergenic
971736887 4:30465128-30465150 ATGAAGAAGGAGGAAAAAGTTGG + Intergenic
971823685 4:31593193-31593215 AAAAAGAAAGAGAAAAAGGAAGG - Intergenic
971918572 4:32908186-32908208 TTGATGAAGGAGAAACAACATGG + Intergenic
971945405 4:33268898-33268920 ATTAAGAGAGAGAAACAGGTCGG - Intergenic
972162988 4:36247630-36247652 AAGTAGAAGGAGGAAAAGGAGGG - Intergenic
972684073 4:41334914-41334936 ATGAAGATGGAGGCACAGGTTGG + Intergenic
972739850 4:41879050-41879072 TTGAAGAGAGAGAAACGGGAGGG - Intergenic
972790241 4:42364867-42364889 AGAAAGAAAGAGAAAGAGGAAGG - Intergenic
973329375 4:48896907-48896929 ATGAAGAAGGAAGAACAGAGAGG + Intronic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
973717734 4:53693815-53693837 AGGAAGAGGGAGAAACCTGAGGG + Intronic
973730797 4:53820611-53820633 ATGAAGGGGGAGAGAAAGGAGGG - Intronic
973816054 4:54620086-54620108 ATGAATAAGGAAAGACAGAAAGG - Intergenic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974332859 4:60502888-60502910 AAAAAGGAGGAGAAAAAGGAGGG - Intergenic
974423362 4:61707705-61707727 ATGAAGAAGAAGTAAAAGAAAGG + Intronic
974546047 4:63308206-63308228 AGGAAACAGAAGAAACAGGAAGG + Intergenic
974685927 4:65229229-65229251 AGGAAGAAACAGAAACAGCAGGG - Intergenic
975105045 4:70557987-70558009 ATGAAGAAAGAGAAACTTGGGGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975390656 4:73813400-73813422 ATGAGGATGGAGAGACAGGATGG + Intergenic
975391468 4:73822890-73822912 AAGAAGAGGGAGAAAGGGGAGGG + Intergenic
975486311 4:74936845-74936867 CTCAAGAAGGACAAAAAGGAAGG + Intronic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
976267676 4:83200357-83200379 ATTAAGAAGGCAAAACAGGCTGG + Intergenic
976335016 4:83875578-83875600 ATGCAGAATTAGATACAGGATGG - Intergenic
976380881 4:84396936-84396958 ATGAAGAAGAAAAAATATGATGG + Intergenic
976441574 4:85081965-85081987 ATGAAGATGTAGAAATAGCAAGG - Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976858079 4:89628474-89628496 ATGAAGAGGGAGAGGTAGGAAGG - Intergenic
976958472 4:90935322-90935344 AGGAAGCAGGAGAGACAGCAGGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977572150 4:98639728-98639750 GTGAAGAAAGTGAAACAGAAAGG - Intronic
977790927 4:101102214-101102236 ATGAAGAAGGAAAGAAAGGAGGG + Intronic
978212122 4:106149514-106149536 ATGAAGAGGGAGAAAAATGGAGG + Intronic
978277332 4:106967811-106967833 AGGAAGAAAGAAAAAAAGGAAGG + Intronic
978521295 4:109618439-109618461 ATAAAGCAGGAGAAAGAGAATGG - Intronic
978765288 4:112399081-112399103 TCGAGGAAAGAGAAACAGGATGG + Intronic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
978912290 4:114078414-114078436 AAGAAGAAGAAGAAACACAAAGG + Intergenic
979133935 4:117085232-117085254 CTGAAGAGTGAGAAACACGATGG + Exonic
979193656 4:117894206-117894228 AGGAAGAAAGAGAAAAAGAAGGG + Intergenic
979193869 4:117896909-117896931 AGGAAGAAAGAGAAAAAGAAGGG + Intergenic
979303772 4:119118616-119118638 ATGAAGAGGAAGGAACAGTATGG - Intergenic
979382492 4:120024168-120024190 CTGAAGAAGGAGAAAAAAAAAGG + Intergenic
979402545 4:120266150-120266172 AACAAGAGGGAGAGACAGGATGG - Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979670719 4:123357546-123357568 AGGAAGAAGGAAAAGCAGGAGGG - Intergenic
979717208 4:123854356-123854378 ATGCCGCAGTAGAAACAGGAAGG - Intergenic
979730611 4:124018619-124018641 AGGAAGAAAGGGAAAGAGGAAGG - Intergenic
980198239 4:129619616-129619638 ATGATGATGGATAAAAAGGATGG - Intergenic
980276992 4:130665665-130665687 ATGAAGAATGACAAATTGGAAGG - Intergenic
980395671 4:132211733-132211755 ATGAAGTATAAGAAATAGGAAGG + Intergenic
980742570 4:136972059-136972081 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980838271 4:138224785-138224807 AGGAAGAAGGAAAAGAAGGAAGG + Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981075771 4:140589851-140589873 AAGAAGAAGGAGAAACAAAACGG - Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981614192 4:146629481-146629503 AGGAAGAAGGGGAATAAGGAAGG + Intergenic
981806692 4:148724363-148724385 ATGAAGAATCAAAAACATGATGG - Intergenic
981856147 4:149295306-149295328 AAGAAGAAAGAGAAACACGAGGG + Intergenic
982057081 4:151562273-151562295 ATGAAGAAGGAGGGGTAGGAAGG + Intronic
982079731 4:151777687-151777709 ATGAAGAAAGAGATACAGGGAGG - Intergenic
982101406 4:151971801-151971823 AAGAAGGAAGAGAGACAGGAGGG - Intergenic
982106574 4:152016568-152016590 ATGAGAGAGGAGAGACAGGAGGG + Intergenic
982204824 4:152989799-152989821 GTGAAGAAGGCAAGACAGGAGGG + Intergenic
982373821 4:154664800-154664822 CTGAGGCAGGAGAACCAGGAAGG - Intronic
982601535 4:157457122-157457144 AAAAAGAAAGAGAAAAAGGAAGG - Intergenic
982636812 4:157907180-157907202 ATGAGGTATGAGAAAAAGGAAGG + Intergenic
982924243 4:161316043-161316065 ATGAAGAGGGAAAATTAGGATGG + Intergenic
983170623 4:164531719-164531741 ATGAAGAAGGCAAAAGAGAAAGG - Intergenic
983203160 4:164884205-164884227 AAGAAGAAAGAAAAAGAGGAAGG + Intronic
983226384 4:165089732-165089754 AAGAAGGACAAGAAACAGGAGGG + Intronic
983273655 4:165592059-165592081 ATGAACAAAGAGAAAGAGGGAGG - Intergenic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983661268 4:170132734-170132756 AAAAAGGAGGAGAAACGGGAAGG - Intergenic
983787055 4:171745900-171745922 AGGTAGAAGGATAAACAGAAAGG - Intergenic
983928940 4:173432422-173432444 AGGAAGAAGGAGGAGAAGGAAGG - Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984085034 4:175299698-175299720 ATAAAGTAGAAGAAACAGGAAGG + Intergenic
984107321 4:175564459-175564481 ATGAAGATGGAGACAGAGGTTGG + Intergenic
984161061 4:176252438-176252460 AGGAAGAAAGGGAAAGAGGAAGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984282359 4:177686650-177686672 TTGAAGAAAGAGGAACAAGAGGG + Intergenic
984389150 4:179105865-179105887 ATCAAGATGGAGAAGCAGGGAGG + Intergenic
984581230 4:181512064-181512086 ATGAAGAAGGCGAGAAAGCAGGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984633428 4:182085073-182085095 ATAAAGAAAGAGGAAGAGGAAGG + Intergenic
984781212 4:183527405-183527427 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985376444 4:189344664-189344686 ATGAAGATGGAGAACAGGGAAGG + Intergenic
985405816 4:189637337-189637359 AAGAAGAAAGAGAAAAAAGAAGG + Intergenic
985481825 5:117002-117024 AGAAAGAAGGTGAAACAGGCAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985851629 5:2392633-2392655 AGGAAGGAAGAGAAAGAGGAAGG - Intergenic
986228203 5:5836764-5836786 ATGACACAGGAGAATCAGGAGGG - Intergenic
986377667 5:7148793-7148815 ATGAAAAAAGAGAAGCAGCAAGG + Intergenic
986470375 5:8067830-8067852 ATGAAGTAGGAGAGAAAGGAGGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986685266 5:10270841-10270863 ATGAAGGGCCAGAAACAGGAGGG - Intergenic
986901179 5:12435738-12435760 ATGAAAAAAGAGGAAAAGGAAGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987263807 5:16230146-16230168 GTGAAAAAGGAGATAAAGGAAGG + Intergenic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
987369430 5:17179778-17179800 ACAATGAAGGAGACACAGGAGGG - Intronic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987712105 5:21513652-21513674 AGTAAGAATAAGAAACAGGATGG - Intergenic
987881909 5:23758711-23758733 ATGAAGTTAGAGAAACATGAAGG - Intergenic
988032502 5:25781848-25781870 ACGAAGAAGGAGAGAAAGGGTGG - Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988092231 5:26558642-26558664 ATGAAAAAAGAAAAAAAGGAAGG + Intergenic
988219964 5:28331999-28332021 ATGAAGAAGAAAAAAGAGTATGG - Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988283111 5:29175275-29175297 ATCAAGAAGGAGATAAAGGTGGG + Intergenic
988302304 5:29447136-29447158 AGTAAGAATAAGAAACAGGATGG + Intergenic
988452622 5:31358670-31358692 AGGAAGAAAGAGAAAGAAGATGG - Intergenic
988537789 5:32084371-32084393 ATGAGGACGGAGAAACAGCGTGG - Intronic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
988713753 5:33804211-33804233 ATGAAGATGGGGGAAGAGGAAGG - Intronic
988919786 5:35929679-35929701 ATGAAGTAAGAGATGCAGGAAGG + Intronic
989344448 5:40413521-40413543 CTCAAGAAAGAGAAATAGGAAGG + Intergenic
989492668 5:42076471-42076493 ATGAAGAAGGAAGAAAAGCAGGG + Intergenic
989637429 5:43551121-43551143 AGGAAGTAGGAAAAACAGGATGG + Intronic
990082922 5:51939072-51939094 ATGAAGCAGAAGAAACATCATGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990527424 5:56641670-56641692 GAGAGGAAGGAGAAACAGGTGGG + Intergenic
990876581 5:60493303-60493325 TTGAAGGAGGAGAAAAAAGAGGG + Intronic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
991115038 5:62945512-62945534 GTGAATACGGAGAAACATGATGG - Intergenic
991604975 5:68392182-68392204 ATGAAGAGAGAGAAAGGGGAGGG + Intergenic
991618465 5:68520538-68520560 GTCAAGAAGGAGCACCAGGACGG + Intergenic
991762468 5:69932788-69932810 AGTAAGAATAAGAAACAGGATGG - Intergenic
991784857 5:70185318-70185340 AGTAAGAATAAGAAACAGGATGG + Intergenic
991841696 5:70807838-70807860 AGTAAGAATAAGAAACAGGATGG - Intergenic
991877304 5:71185711-71185733 AGTAAGAATAAGAAACAGGATGG + Intergenic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
992397197 5:76378917-76378939 CTGAGGCAGGAGAAACCGGAAGG + Intergenic
992552183 5:77869361-77869383 ATAAAGAAGGAGAATCAATAGGG - Intergenic
992560245 5:77944886-77944908 AAGAAGAAAGAGAGAGAGGAAGG + Intergenic
992603829 5:78434551-78434573 AAGAAGGAGGAGGAAAAGGAAGG - Intronic
992719255 5:79543667-79543689 ATAAAGAATGAGAAACAGGCTGG - Intergenic
993033711 5:82733739-82733761 ATGAAGGATGAGAGACAGGAGGG + Intergenic
993313329 5:86366363-86366385 ATGAAAAAGGAGAAAAAATATGG - Intergenic
993389295 5:87298425-87298447 AAAAAGAAGAAGAAACAGGAAGG + Intronic
993723140 5:91341458-91341480 AGGCAGAAGTAGAAACAGGGAGG + Intergenic
993837754 5:92835602-92835624 ATGGAGAAGGAGGAAAAGCAGGG - Intergenic
994450568 5:99936406-99936428 ATGGAGAAGGTAAACCAGGATGG + Intergenic
994464545 5:100109977-100109999 AGGAAGAAGGAGAAAAATAATGG - Intergenic
994667369 5:102722222-102722244 ACAAAGAAGGAGAAATATGAAGG + Intergenic
994793717 5:104265884-104265906 AAGAAGGAGGAAAAGCAGGAAGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995601556 5:113802916-113802938 ATTAAGAAAGGCAAACAGGAAGG - Intergenic
995646698 5:114320734-114320756 ATGGAGAAGAAGATACATGAAGG - Intergenic
996083108 5:119276675-119276697 ATGAAGAGGGAGAGACACCAGGG - Intronic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996207631 5:120761142-120761164 ATGAAGCAATAGATACAGGAGGG - Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996596823 5:125212881-125212903 ATGAAGGAAGAGAAAAGGGAAGG - Intergenic
996813746 5:127550309-127550331 ATGAATAAAAAGAAACAGGGAGG - Intronic
997026570 5:130069802-130069824 AAGAAGAAGGAGAAACATAAAGG - Intronic
997192064 5:131946369-131946391 AAGAAGAAGAAGAAACAGATCGG - Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
998335753 5:141370935-141370957 ATTCAGAAGGAGAACCTGGATGG + Exonic
998338843 5:141398668-141398690 ATAATTAAGGAGAAACAGGATGG + Exonic
998597683 5:143550767-143550789 AAAAAGAAGGAGGAAGAGGAGGG - Intergenic
998809371 5:145950640-145950662 AAGAAGGAGGAGAAAAGGGAGGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998977939 5:147668770-147668792 ATGAAGAAGGAAAAACACAGAGG + Intronic
998981526 5:147708471-147708493 ACGTAGAAGGAGAAACAGGTTGG + Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999890903 5:155977739-155977761 GTGAAGAATGAGGAACTGGAAGG + Intronic
999914367 5:156241555-156241577 TTAAAGAAGGAAAAACTGGATGG - Intronic
1000152148 5:158513834-158513856 AACGAGGAGGAGAAACAGGAGGG + Intergenic
1000293097 5:159889561-159889583 ATGAAGAAGTAGAGACAGAGAGG + Intergenic
1000422294 5:161052617-161052639 AGGAAGTAGTAGAATCAGGATGG - Intergenic
1000965589 5:167652370-167652392 ATAAAGAAGAAGAAAAAGCAAGG - Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001142674 5:169158021-169158043 AAGAAGAGGGAGAGAAAGGATGG + Intronic
1001143697 5:169166021-169166043 ATAAAGAAACAGAAACAGGGAGG + Intronic
1001642139 5:173252112-173252134 CTGCAGAAGGAGAAACAAGCAGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1002000964 5:176196034-176196056 AGGATGCAGGAGAAAGAGGAGGG - Intergenic
1002253370 5:177942938-177942960 AGGATGCAGGAGAAAGAGGAGGG + Intergenic
1002580417 5:180206875-180206897 TTGCAGAAAGAGACACAGGAAGG + Intronic
1002692603 5:181060596-181060618 TTTAAAAAGGAGAAACAGGAAGG + Exonic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1002809681 6:615539-615561 ATGAAAAACCAGAAACAGGCTGG + Intronic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003190221 6:3867924-3867946 AGGAAGACGAAGAAACAGAATGG - Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003380406 6:5619801-5619823 ATGAAGAGAGGGAGACAGGAAGG - Intronic
1003403361 6:5809088-5809110 AAGGAGAAGGGGAAAAAGGAAGG - Intergenic
1003426246 6:6000038-6000060 CTGGGGAGGGAGAAACAGGAGGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003631480 6:7791498-7791520 ATGAAGATGGAGAAGCAGAGAGG - Intronic
1003652676 6:7975819-7975841 ATGTAGACAGAGAAGCAGGATGG + Intronic
1003700546 6:8459951-8459973 ATCAAGAAGTAGAAAGAGGCTGG - Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004000623 6:11593812-11593834 ATTAAGAAGGAGAAATGGGCCGG - Intergenic
1004115212 6:12760100-12760122 AAGCAGAAGGAGAAACATAATGG - Intronic
1004149123 6:13098329-13098351 AGAGAGAAGGAAAAACAGGAAGG - Intronic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004404982 6:15324481-15324503 AAAAAGAAGAAGAAAAAGGAGGG - Intronic
1004420614 6:15466235-15466257 AGGAAACAGGAGAAGCAGGAGGG - Intronic
1004462717 6:15853434-15853456 AAGAAGAAGGAGAAGCAGAAGGG - Intergenic
1004589719 6:17037837-17037859 ACGAAAAAGGAGAATCTGGATGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005648294 6:27863459-27863481 ATTAAAATGGAGAAAGAGGAAGG - Intronic
1005677015 6:28165079-28165101 ATGAAGAGGGAGGAAAAGGGAGG - Intergenic
1005881860 6:30068291-30068313 AGGAAGACGGAGAAACAGCAAGG + Intronic
1006000183 6:30958525-30958547 AAGGAGAAGGAAAAACTGGAAGG - Intergenic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006252698 6:32802534-32802556 ATGAAGAAGTGGAAATGGGAGGG - Intergenic
1006258639 6:32850821-32850843 ATGAAGATGGAGAATCAGTAAGG + Intronic
1006805963 6:36789295-36789317 GGGAAGAAGGAGGAAGAGGAAGG + Intronic
1006937289 6:37727335-37727357 AAGAGGAAGGAGAAAAAGTAGGG + Intergenic
1007009139 6:38397983-38398005 ATGGAGCAGGAGAAACTGCATGG + Intronic
1007184873 6:39961221-39961243 ATGGGAAATGAGAAACAGGAAGG - Intergenic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1007793433 6:44327996-44328018 ATAAAGAAGGAGAGGCAGAAGGG - Intronic
1007813979 6:44507075-44507097 ATGATGATGGAGGAAGAGGAGGG + Intergenic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1008087806 6:47262741-47262763 ATGGACAAGGAGGAGCAGGAAGG + Intronic
1008209712 6:48705399-48705421 AGAAAGAAAGAAAAACAGGAAGG + Intergenic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1008439490 6:51516302-51516324 AAAAACAAGGAGAACCAGGAAGG - Intergenic
1008459530 6:51752113-51752135 AGGAAGATGGGGAATCAGGAAGG - Intronic
1008777021 6:55052173-55052195 TTGTAGAAGGACAAAAAGGAGGG - Intergenic
1008780715 6:55101121-55101143 ATGAAGAATGAGAAACCAGCCGG - Intergenic
1008800492 6:55362978-55363000 AGGAAGAAGAGGAAACAGGAAGG + Intronic
1008803065 6:55393632-55393654 AGGAAGTAAGAGAAAGAGGAAGG + Intronic
1008906298 6:56681151-56681173 ATGCAGGAGGAAATACAGGAAGG - Intronic
1009005601 6:57783042-57783064 AGTAAGAATAAGAAACAGGATGG + Intergenic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009317333 6:62237513-62237535 ATCAAAAAGCAGAAACATGATGG + Intronic
1009851609 6:69206696-69206718 ATGAAGAAGGAAACAAAAGAAGG + Intronic
1009887402 6:69640050-69640072 ATGAGGTAGGAGACACAGGCAGG + Intergenic
1010151091 6:72732979-72733001 ATAAAGAAGTGAAAACAGGAAGG + Intronic
1010160770 6:72852024-72852046 AAGAAAAATGAGAAACAGAAAGG - Intronic
1010187132 6:73157339-73157361 AGGAGGAAGGGGAAACAGGAAGG + Intronic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010292035 6:74148398-74148420 ATAAAGAAACAGAAACAGGGAGG - Intergenic
1010311383 6:74389880-74389902 AAGAAGAAGGAAGAAGAGGAAGG - Intergenic
1010582460 6:77616516-77616538 ATAAAAAAAGAGAAACAGAAAGG - Intergenic
1011180569 6:84615202-84615224 ATGAAGAAAGAGAAAGATTAGGG - Intergenic
1011216984 6:85015481-85015503 AAGAAAAAGGAGAGACAGAATGG + Intergenic
1011247241 6:85332260-85332282 ATGAAGCAGGAAAGACAGGGTGG - Intergenic
1011441689 6:87393802-87393824 ATCGATAAGGAGTAACAGGATGG - Intronic
1011484727 6:87829897-87829919 GAGGAGAAGGAGGAACAGGAGGG - Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012407732 6:98919525-98919547 ATGAGGAAAGAGAAGCAGGCTGG + Intronic
1012512425 6:100018549-100018571 ATCATGAAGGAGAAACAGCTTGG + Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013175453 6:107673059-107673081 AAGAAGAAAGAGAAATAAGAAGG + Intergenic
1013312852 6:108913777-108913799 AACCAGAAGGAGAAACAGGGAGG - Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013521509 6:110937954-110937976 ATGAACAAGAAGAGACTGGAAGG + Intergenic
1013702168 6:112785895-112785917 CTAAAGAATGTGAAACAGGAAGG - Intergenic
1013859078 6:114611998-114612020 AGGAAGAAAGAGAAAGAAGAAGG - Intergenic
1014041736 6:116835112-116835134 GAGAAGAAGGAGGAAAAGGAGGG - Intergenic
1014302131 6:119694802-119694824 ATGAGGAAGGAGAGGCAAGAAGG - Intergenic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1014356053 6:120411634-120411656 ATGAAAAAGAAAGAACAGGAAGG + Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015214239 6:130731695-130731717 ATGAAGAGTGAGAGAAAGGAGGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015515351 6:134077929-134077951 ATGAAGAAGGATAACCAAGAAGG + Intergenic
1015691320 6:135926690-135926712 AGAAAGCAGTAGAAACAGGAAGG - Intronic
1015996487 6:138999903-138999925 ATGTAGAATGAGAAGCAGAAAGG + Intergenic
1016029876 6:139326348-139326370 ATAAAGGATGAGAGACAGGAGGG - Intergenic
1016142840 6:140634313-140634335 AGGAAGAAAGAGAGAAAGGAAGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016528907 6:145036630-145036652 ATGGAGGAGGAGCCACAGGACGG - Intergenic
1016624908 6:146155741-146155763 ATGAAGTTGGAGAAATTGGAAGG - Intronic
1016701320 6:147057396-147057418 ATAAAAAAGGAGGAACAAGAAGG - Intergenic
1016804972 6:148203393-148203415 GTGATAAAGGAGAAACAGAAAGG - Intergenic
1016808217 6:148234527-148234549 AAGAAGAAGGAGGAACTGGCCGG + Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017531577 6:155297652-155297674 ATGTAAAAGGAAAAACAGGAGGG + Intronic
1017587439 6:155942764-155942786 AAGAAGAAGGAGGAAAAGAAAGG + Intergenic
1017767532 6:157618930-157618952 AGGAAGAAGGTGAAAAAAGATGG - Intronic
1017961455 6:159225454-159225476 ATGAGGAAGGAAAAACAGCGAGG + Intronic
1018038060 6:159898597-159898619 AGGAAGGAGGAGGAAGAGGAAGG - Intergenic
1018038084 6:159898681-159898703 ATGAAGGAGGAGGAAGAGGGAGG - Intergenic
1018279813 6:162173035-162173057 ATGGGGAAGGAGAAACTGGGGGG + Intronic
1018414765 6:163591315-163591337 ATGACGACGGAGAGACAGGCAGG - Intergenic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1018729634 6:166638973-166638995 ATGAAGAGGGAGGAAGAAGAGGG + Intronic
1018824973 6:167402045-167402067 CTGGAGAAGGAGGAACCGGAGGG + Intergenic
1019118823 6:169787021-169787043 AGGAAGAAGGAGAGGAAGGAAGG - Intergenic
1019201586 6:170320809-170320831 AGGAGGAAGGAGAATAAGGAGGG + Intronic
1019351811 7:557552-557574 CAGAGGAGGGAGAAACAGGATGG + Intronic
1019495487 7:1337766-1337788 AGAAAGAAGGAGAGAGAGGAGGG - Intergenic
1019772802 7:2894376-2894398 ATGAAGAAGGAGACACAGAGAGG - Intergenic
1019971119 7:4541684-4541706 TTGAAGAAGGAAAACAAGGAAGG - Intergenic
1020226994 7:6288317-6288339 AGGAAGGAGGAAAAAGAGGAAGG - Intergenic
1020314453 7:6895119-6895141 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1020657382 7:10943649-10943671 ATTAAGAATGAGAAATAGGCTGG + Intergenic
1021114521 7:16732504-16732526 ATAAAGAAGGAAAGAAAGGAAGG - Intergenic
1021201593 7:17733737-17733759 GAGGAGAAGGAGGAACAGGAGGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022088104 7:27088245-27088267 AGGAAGCAGGAGAAACGGAACGG + Intergenic
1022253865 7:28636166-28636188 TTGATGAAAGAGAAACACGAAGG + Intronic
1022551907 7:31248752-31248774 GTGAAGAAGGAGAAAGAAGCAGG - Intergenic
1022566893 7:31412877-31412899 ATGAAGAAGGAGGGAAAGGAAGG + Intergenic
1022770833 7:33471159-33471181 ATGAAACAGGAGAAACAGCTTGG - Intronic
1022869821 7:34464539-34464561 AGGAAGAAAGAAAAAAAGGAAGG - Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023224605 7:37956105-37956127 GTGAAGAAGAAGGAGCAGGAAGG + Intronic
1023362003 7:39426567-39426589 AAGAAGAGGGAGGAAGAGGAGGG - Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1023602092 7:41890318-41890340 AAGAAGGAGGAGAAAAAGAAGGG - Intergenic
1023621769 7:42080656-42080678 ATGAAGAATGAAAAGCAGTATGG + Intronic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1024032259 7:45471425-45471447 AAGAAGGAGGAGAAACAAGAAGG + Intergenic
1024059155 7:45685499-45685521 TGGAGGCAGGAGAAACAGGAAGG + Intronic
1024102889 7:46050889-46050911 AGGGAGAAGGGCAAACAGGAAGG + Intergenic
1024207934 7:47179765-47179787 GTGCAGAAGGAGAAAGAGAAGGG + Intergenic
1024475198 7:49801907-49801929 GTGAAGGAGGAGAAACAGGGTGG - Intronic
1024707847 7:51980627-51980649 AGAAAGAAGGAGAAAGAGAATGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025207146 7:57000450-57000472 ATGAAGAATGGGAAAGGGGAGGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025664790 7:63576440-63576462 ATGAAGAATGGGAAAGGGGAGGG + Intergenic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1025945318 7:66100123-66100145 AGGAAGAGGGAGAAACAGCCAGG + Intronic
1026104155 7:67407864-67407886 ATGAGGAAGGGGAGACAGGAGGG - Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026183023 7:68059050-68059072 AGGTAGAAGGAGAGACAGGGAGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026606905 7:71824274-71824296 TTGAGGAAGGGGAAACAGGCAGG - Intronic
1026680876 7:72465780-72465802 ATGATCAAAGAGAAACAGAAAGG + Intergenic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1026941853 7:74291686-74291708 CTGAAGAAGGACAAACAGCCTGG - Intronic
1027025916 7:74851524-74851546 AGAAAGAAAGAGAAAAAGGAGGG - Exonic
1027061840 7:75092586-75092608 AGAAAGAAAGAGAAAAAGGAGGG + Exonic
1027201273 7:76065270-76065292 ATGAACAAGGAGCGACAGGGAGG - Intronic
1027301978 7:76848556-76848578 ATGAGGAAAGAAAGACAGGAAGG - Intergenic
1027351158 7:77312941-77312963 AAGAAGAATGAGAAACACAAGGG - Intronic
1027351164 7:77313031-77313053 AGGAAGAATGAGAAACATGAGGG - Intronic
1027386353 7:77662993-77663015 GGGAAGAAGGAGAGAGAGGAAGG + Intergenic
1027703660 7:81501013-81501035 GGGAAGAAGGAAAAAAAGGAAGG - Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028248097 7:88507087-88507109 AAGAAAAAGGAGAAACACAATGG - Intergenic
1028453934 7:91018110-91018132 AGGAAGCAAAAGAAACAGGAAGG + Intronic
1028472463 7:91220089-91220111 ATGAAAATGGAGAGAAAGGAAGG - Intergenic
1028642080 7:93053786-93053808 AGGAAGAAGAAAAAACAGAAGGG + Intergenic
1028741931 7:94285315-94285337 ATGAAGAAGGTGTTTCAGGAAGG - Intergenic
1028970602 7:96854410-96854432 ATGAAGAAAGTGAAACAGGGAGG + Intergenic
1029150280 7:98475504-98475526 AGAAAGAAGGAAAAAAAGGAAGG + Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029651129 7:101892897-101892919 CTGAAGAAGGAAAAAGAGAAAGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030016777 7:105230516-105230538 ATGAAGAAAGAAAGACAGGAAGG + Intronic
1030114018 7:106049683-106049705 ATGCAGAATGGGAGACAGGAGGG + Intergenic
1030318655 7:108141796-108141818 GATAAGAAAGAGAAACAGGATGG + Intergenic
1030333931 7:108303331-108303353 ATGAAGAATGAGGAAGAGCAAGG - Intronic
1030398524 7:109018962-109018984 AAGGAGAAGGAAAAACAGAAAGG + Intergenic
1030735624 7:113044507-113044529 AGAAAGAAAGAGAAAAAGGAAGG + Intergenic
1030954743 7:115838092-115838114 TTGAATAATGAGACACAGGAAGG - Intergenic
1031014901 7:116562891-116562913 AGGAAGGAAGAGAAAGAGGAAGG + Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031258281 7:119484008-119484030 AGTAAGAAGAAGGAACAGGATGG + Intergenic
1031328283 7:120430265-120430287 AAGAAGAAGGAGAGACACCAGGG - Intronic
1031459323 7:122026559-122026581 ATGAGGAATGAGAGACATGAGGG - Intronic
1031510561 7:122643701-122643723 AAGGAGAGGGAGAAAAAGGAGGG + Intronic
1031555968 7:123176778-123176800 AGGTAGGAGGAGAACCAGGAGGG - Intronic
1031775057 7:125898552-125898574 GTGAAGAAGTAGAAAAATGATGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032682461 7:134199277-134199299 ATGAACAAGGAAAAATATGAGGG + Exonic
1032799843 7:135309184-135309206 AGGAAGAAGAAGGAAGAGGAAGG + Intergenic
1033318616 7:140319206-140319228 GAGCAGAAAGAGAAACAGGATGG + Intronic
1033435370 7:141328980-141329002 ATAAAGAAGGCCAATCAGGAAGG - Intronic
1033478666 7:141716378-141716400 GTGAGGAAGGAGAAAAGGGAGGG - Intronic
1033564372 7:142564283-142564305 AAGGAGAAGGAGAAACACCAGGG - Intergenic
1033718553 7:144030721-144030743 ATGAGAGAGGAGAGACAGGAAGG - Intergenic
1033832594 7:145271507-145271529 AGGAAGAAGGAGAAAGAAAAAGG + Intergenic
1033854390 7:145540714-145540736 AAGAAGAAGGAAAAAAAGGAAGG - Intergenic
1034004377 7:147452978-147453000 GGGAAGAAGTAGAAACAGAAAGG + Intronic
1034230522 7:149523411-149523433 ATGAAGAAGGAGAACAAAGTTGG + Intergenic
1034534900 7:151720644-151720666 ATGAAGGAGGAGAGAATGGAGGG + Intronic
1034600313 7:152246313-152246335 ATGATGAAGTAGTAACAAGAGGG + Intronic
1034788066 7:153943457-153943479 ATGGAGAAGGACAAAAAAGAGGG - Intronic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035006941 7:155670791-155670813 ATGACTAATGAGAAACAGGATGG - Intronic
1035110311 7:156476180-156476202 GGGAAGAAGGAAGAACAGGAAGG + Intergenic
1035111098 7:156482532-156482554 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035440030 7:158889382-158889404 ATGAACTAGGAAAAACAGGAGGG - Intronic
1035878815 8:3221319-3221341 ATGAAGAAGGAATAAAAGGTTGG + Intronic
1036158510 8:6364603-6364625 ATGAAGAAGGAGAATCACCTGGG + Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037740962 8:21608907-21608929 CTGAAGCAGGAGACACAGTAAGG + Intergenic
1037745356 8:21639425-21639447 AGGAAGAGGGAGAAACAGGGAGG + Intergenic
1037816182 8:22113385-22113407 AAGAAGAAGGACAGAGAGGAGGG + Intergenic
1037986188 8:23292040-23292062 AAAAAGAAGGAAAGACAGGAGGG - Intronic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038326806 8:26577972-26577994 AAGGAGAGAGAGAAACAGGAGGG - Exonic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1039005136 8:33027811-33027833 CTGAAGAAGAATAAACAGAAGGG - Intergenic
1039045744 8:33447669-33447691 AGGAAGAAGGAAAAACAAGGAGG + Intronic
1039142741 8:34411146-34411168 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1039198018 8:35053992-35054014 AGAAAGAAAGAGAGACAGGAAGG - Intergenic
1039513157 8:38107566-38107588 ATGAGAAAGGAAAAAAAGGATGG - Intronic
1039824523 8:41161719-41161741 AAGAAGAAGGAAAGAAAGGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039963761 8:42269503-42269525 AGGAAGGAGGAGAGATAGGAAGG + Intergenic
1040063626 8:43126395-43126417 AGGCAGGAGGAGCAACAGGAGGG - Intergenic
1040104467 8:43533804-43533826 AAGAAAAAGGGAAAACAGGAGGG - Intergenic
1040636639 8:49282668-49282690 ATAAAGAAAGAGGAACAGAAAGG + Intergenic
1040740392 8:50567952-50567974 ATGAATACAGAGATACAGGAAGG - Intronic
1041321249 8:56615151-56615173 AGGAAAAAAGAGAAAGAGGAAGG - Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041775220 8:61515445-61515467 AGGAGGAAGGAGAACCAAGAAGG - Intronic
1042120399 8:65481259-65481281 AGGAAGAAGAAGAAACAGGTGGG - Intergenic
1042147075 8:65740898-65740920 ATGGAGCAGGTGAAACTGGAGGG - Intronic
1042190757 8:66184572-66184594 ATGAAAAATGAGAATCAGGCTGG - Intergenic
1042552353 8:70005213-70005235 AGGAAGAAAGAGAGAGAGGAAGG + Intergenic
1042593187 8:70418099-70418121 ATTAAGAAGTAGAAATGGGAGGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043033204 8:75164844-75164866 ATGAGGAAGAAGAAAAAAGATGG + Intergenic
1043043685 8:75294228-75294250 ATCAAGATGGAAAAACAGGAAGG + Intergenic
1043055935 8:75438533-75438555 ATGAAGAGAGAGAAAGAGGGAGG - Intronic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043276549 8:78403403-78403425 AAGAAAAAGGAAAAACAGAAGGG + Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1044152432 8:88798034-88798056 AAGAAGAAAGAAAAAGAGGAAGG - Intergenic
1044274035 8:90279502-90279524 ATGTAGAAAGAGAGACAGGCAGG - Intergenic
1044311335 8:90696209-90696231 AGGAAGAAGGGGAAGCAGCATGG + Intronic
1044460987 8:92443684-92443706 ATGAAGAAGGAGGAGCAGGTTGG + Intergenic
1044614672 8:94127590-94127612 AGGATGAAGGGGACACAGGATGG + Exonic
1044642301 8:94396073-94396095 AAGAAGAAGGAAAAAGAGTAAGG + Intronic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1044834150 8:96279486-96279508 GTGAAGGAGGGGACACAGGATGG - Intronic
1045049143 8:98306977-98306999 AGAAAGAAGGAGAAAAAAGAAGG - Intergenic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045359532 8:101419886-101419908 ATAAAGAAGGAAAAAAAGGAAGG + Intergenic
1045364325 8:101461793-101461815 ATGAAGAAGGAGGGAAACGAGGG - Intergenic
1045648164 8:104319377-104319399 ATGAGGAAGGAGGAAGAGGTTGG + Intergenic
1045885033 8:107085791-107085813 AGGAGGAAGGAAAAATAGGAGGG - Intergenic
1045977553 8:108146805-108146827 GAGAAGAAGGAAAGACAGGAAGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046184474 8:110694624-110694646 AGGAAGAAGGACAAAGAGGAAGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046485905 8:114888313-114888335 AGGAAGAAATGGAAACAGGAAGG - Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046918919 8:119706859-119706881 AAGAAGAAAGAGAGAGAGGAAGG - Intergenic
1046939088 8:119913936-119913958 ATTTAGAAGGAAAAGCAGGAGGG - Intronic
1047426635 8:124752449-124752471 AAGAAGGAGGAAAAACAGAAGGG + Intergenic
1047568487 8:126072785-126072807 AAGAAAAAGGAGAAAAAGAAGGG + Intergenic
1047874991 8:129126296-129126318 AAGAAGAAGAAGAAAAAAGAAGG + Intergenic
1047921508 8:129639408-129639430 ATGAAGAGGGAGAATCAGGGAGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048202595 8:132388060-132388082 AAGAAGAAGAAGAAACATAAAGG + Intronic
1048403759 8:134097269-134097291 AAGAAAAAGGAGAAATAGGGAGG + Intergenic
1048872026 8:138807033-138807055 ATGCAGGAGGAGAAATAGGGGGG + Intronic
1049688489 8:143948761-143948783 ACAAGGAAGGAGAAAAAGGAGGG + Intronic
1049887880 9:40399-40421 AGGAAGAAGGAGAAGAAGAAAGG - Intergenic
1049899861 9:149135-149157 AGGAAGGAGGAGCAACAGGTCGG - Intronic
1050000249 9:1069947-1069969 AGGAAGGAGGAGGAAGAGGAGGG + Intergenic
1050169589 9:2801496-2801518 ATGAAGATTGAGAATAAGGATGG + Intronic
1050475928 9:6041041-6041063 AGAAGGAAGGAGAAAGAGGAAGG - Intergenic
1050489283 9:6170670-6170692 AAGAAGAAGGAAAAATAGGTAGG - Intergenic
1050688495 9:8198929-8198951 AATAGGAAGGAGAAGCAGGAAGG + Intergenic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1050970217 9:11861091-11861113 ATGAAGAAGGATAAATATGGTGG + Intergenic
1051169408 9:14304228-14304250 ATGAAGAAGGAAAAAAAGTGTGG + Intronic
1051182015 9:14421166-14421188 ATGAAGGAAGAAAAACAGGAAGG - Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051283373 9:15466954-15466976 ATTAAGTAGTAGAAACACGATGG - Intronic
1051410950 9:16788856-16788878 ATCTAGAAGGAAAAACAGGTGGG - Intronic
1051951650 9:22641928-22641950 GTGAAGCAGGGGAACCAGGACGG + Intergenic
1052041224 9:23741364-23741386 ATGAGGAAGGAGGCACACGAGGG + Intronic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052277088 9:26688919-26688941 AAGATGAAGGATAACCAGGATGG - Intergenic
1052425590 9:28300689-28300711 ATGAAGAAGGTGAAAAGGAAAGG - Intronic
1052426006 9:28306273-28306295 ATGAAGAAGGTGAAAAGGAAAGG + Intronic
1052603003 9:30662301-30662323 GTGAAGCAGGAAAAACAGAAGGG - Intergenic
1052629977 9:31025326-31025348 ATGAAGAAAGAGAAAGTAGAGGG + Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1053008389 9:34619583-34619605 AGGTAGAAGGAAAACCAGGAGGG + Intronic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053185153 9:36009722-36009744 ATGAGGCAGGAGAAGCAGAAAGG + Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053556621 9:39144713-39144735 AGAAAGAAGGGGAAACAGGGAGG + Intronic
1053742911 9:41159426-41159448 AGGAAGGAGGAGCAACAGGTCGG - Intronic
1053820733 9:41964996-41965018 AGAAAGAAGGGGAAACAGGGAGG + Intronic
1054089600 9:60833135-60833157 AGAAAGAAGGGGAAACAGGGAGG + Intergenic
1054111011 9:61108693-61108715 AGAAAGAAGGGGAAACAGGGAGG + Intergenic
1054348187 9:63989250-63989272 AGGAAGGAGGAGCAACAGGTCGG - Intergenic
1054445914 9:65315609-65315631 AGGAAGGAGGAGCAACAGGTCGG - Intergenic
1054484356 9:65705901-65705923 AGGAAGGAGGAGCAACAGGTCGG + Intronic
1054609846 9:67222432-67222454 AGAAAGAAGGGGAAACAGGGAGG - Intergenic
1054685431 9:68271874-68271896 AGGAAGGAGGAGCAACAGGTCGG + Intronic
1054850985 9:69846540-69846562 GTGAAGAATGAAAAACAAGATGG - Intronic
1055015622 9:71614804-71614826 ATGCGGAAGGAAAAACAGGTTGG - Intergenic
1055016955 9:71629056-71629078 TTGAAGATGGAGATGCAGGAAGG - Intergenic
1055212762 9:73817170-73817192 AGGAAAAAGGAGAAAAAGGCGGG + Intergenic
1055410433 9:76023283-76023305 ATGAACAAGGGAAGACAGGAAGG - Intronic
1055802830 9:80059247-80059269 AGAAAGAATGTGAAACAGGAGGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057544296 9:96005821-96005843 ATGAACAAGGGGTAACAAGAAGG + Intronic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1058245682 9:102622086-102622108 ATTAAAAAGGAAAACCAGGATGG - Intergenic
1058532998 9:105925328-105925350 ATGGAGAAGGAGAGAAAGGTGGG + Intergenic
1058552317 9:106127965-106127987 AGGAAGAAGGGGAAAAATGATGG + Intergenic
1058556404 9:106173312-106173334 AAGAAGAAGGAGAACAAGAAGGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058654367 9:107206457-107206479 TTGAAAAAGGTGGAACAGGATGG + Intergenic
1058863894 9:109144126-109144148 AGGCAGCAGGAGAAACAGCAGGG - Intronic
1059287339 9:113186177-113186199 ATGAAGGAGGAGCAAGAAGAGGG + Intronic
1059492619 9:114681792-114681814 ATGAATGAGGTCAAACAGGAAGG + Intergenic
1059578590 9:115519183-115519205 AAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1059619253 9:115985252-115985274 ATGTAGAAGGAGAAAACTGAGGG - Intergenic
1060109152 9:120894297-120894319 AGCAGAAAGGAGAAACAGGATGG + Intronic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060540610 9:124427695-124427717 ATGAGGAAGGAAAAAAAGTAGGG + Intergenic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1060753845 9:126194579-126194601 ATGAAGAAGGAGGGAAGGGAGGG - Intergenic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1060890858 9:127187312-127187334 ATGAGGAAGGAGGAACACGGTGG - Intronic
1061021840 9:128020773-128020795 AGGGGGAAGGAGAAACAGAAAGG - Intergenic
1061195111 9:129103228-129103250 ATGAAGAAGCACACACAGGCTGG - Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061743961 9:132726294-132726316 AGGAAGAAGAAGAGAAAGGAAGG - Intronic
1061774148 9:132949413-132949435 CTCAAGAAGGAGAATCAGGCTGG - Intronic
1061777946 9:132978221-132978243 AGGAAGAAGGAAAATAAGGAAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062097960 9:134712424-134712446 AAGAAGGAGGGGGAACAGGAAGG - Intronic
1062098022 9:134712624-134712646 AGGAAGGAGGGGGAACAGGAAGG - Intronic
1062098028 9:134712640-134712662 AGGAAGGAGGGGGAACAGGAAGG - Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1203365408 Un_KI270442v1:251028-251050 AAGAAGAAGCAAACACAGGAAGG - Intergenic
1203372048 Un_KI270442v1:316512-316534 AGAAAGAAGGTGACACAGGAAGG + Intergenic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1203656900 Un_KI270753v1:6757-6779 AAGAAGAAAGAGAAAAAAGAAGG + Intergenic
1185449548 X:275191-275213 AGGAAGAAGGAGGGAGAGGATGG + Intergenic
1185550627 X:980670-980692 ATGATGGAGGAGGAAGAGGAGGG + Intergenic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185661999 X:1735474-1735496 AAGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185662002 X:1735487-1735509 AGGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185727639 X:2435157-2435179 ATGCAGAGAGAGAAACAGGAGGG + Intronic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1185921758 X:4100849-4100871 AAGGAGGAGGAGAAACAAGAGGG + Intergenic
1185992653 X:4909519-4909541 AGGAAGAAAGAGAAAGAAGAAGG - Intergenic
1186039917 X:5464393-5464415 ATGAGAAAGGAAGAACAGGAAGG + Intergenic
1186058824 X:5681522-5681544 AGGAAGAAAGGGAAGCAGGAAGG + Intergenic
1186068292 X:5790140-5790162 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186311067 X:8319684-8319706 ATGGAGAAGAATAAACAGGCTGG - Intergenic
1186327867 X:8499118-8499140 ATGAAGAAAGAGAGAAAAGAAGG + Intergenic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025792 X:15434140-15434162 AGGAGGAAGGAGAAAGAAGAAGG + Intronic
1187025794 X:15434156-15434178 AAGAAGGAGGAGAAAGAAGAAGG + Intronic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187025802 X:15434217-15434239 AAGAAGAAGGAGATAGAAGAAGG + Intronic
1187025806 X:15434240-15434262 AGGAGGAAGGAGAAAGAAGAAGG + Intronic
1187025818 X:15434328-15434350 AGGAGGAACGAGAAAAAGGAGGG + Intronic
1187167544 X:16818543-16818565 AAGGAGAAGGAGAAAAAAGATGG - Intronic
1187286482 X:17909395-17909417 ATGAATAAGAAGAATCAGTATGG - Intergenic
1187307890 X:18113715-18113737 ATGGTGGAGGAGAAACAGGCAGG - Intergenic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187457044 X:19450711-19450733 AGGAGGAAGGACAAAAAGGAGGG + Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188215638 X:27473458-27473480 AGGAAGAAAGTAAAACAGGAAGG - Intergenic
1188661194 X:32760897-32760919 ATGAAGAAGAAATAAGAGGAAGG - Intronic
1188773120 X:34178880-34178902 ATGAAGAAAGAGAAAAATTACGG - Intergenic
1189066242 X:37812356-37812378 AGGAAGAAGGAGAAAGAGCTGGG + Exonic
1189087490 X:38041143-38041165 AGAAGGAAGGAGAAACAGGAGGG + Intronic
1189170169 X:38901345-38901367 TTGAAAAGGGACAAACAGGAAGG - Intergenic
1189284456 X:39841459-39841481 TGGAAGAAGGAGGACCAGGAAGG + Intergenic
1189400112 X:40659951-40659973 ATGAAGAAGGAGAACTAGATGGG + Intronic
1189647775 X:43152922-43152944 AAGAAGAAGGAAGAACAAGAGGG + Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190012257 X:46795606-46795628 AGAAAGAAAGAGAAAAAGGAAGG - Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190384714 X:49873902-49873924 AAGAAGAAGAAGAAACAATAAGG + Intergenic
1190409697 X:50124209-50124231 ATGAAGAAAGATAAACAGAATGG + Intergenic
1190739468 X:53279881-53279903 AGGAAGATGGAGAGAGAGGAAGG + Intronic
1190867614 X:54397876-54397898 ATAAAGAAGTAGATACAGGCTGG - Intergenic
1190882010 X:54498210-54498232 ACAAAGAAGGACAAACAGGTTGG - Intergenic
1190902069 X:54685540-54685562 AGGAAGAAGGAAAGAAAGGAAGG - Intergenic
1191680638 X:63836549-63836571 AAGAAGCACGAGAGACAGGAGGG - Intergenic
1191887728 X:65906213-65906235 ATGAAGAAAGAAATACAGGAGGG + Intergenic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192475737 X:71440911-71440933 AGAAAGAAGGAGAAAGAAGAAGG - Intronic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1193046469 X:77059905-77059927 AGGAAGGAAGAGAAAGAGGAGGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193245442 X:79223344-79223366 AGAAAGAAGGAAAGACAGGAAGG + Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1193940556 X:87676753-87676775 AGGAAAAAGGAGAAAAAGGGGGG + Intergenic
1194142568 X:90223044-90223066 AGGAAGAAAGAAAAAGAGGACGG + Intergenic
1194755158 X:97730746-97730768 ATGAAGAAGGACATAAGGGAGGG - Intergenic
1195091394 X:101463081-101463103 ATGGAGAAAGAGAGACAGAATGG - Intronic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195329463 X:103785553-103785575 AAGAAGAAGGGGAAACAGTCAGG - Intronic
1195781016 X:108464183-108464205 ATGAAGAAAGGGGATCAGGAAGG - Intronic
1195891924 X:109704759-109704781 GGGTAGAGGGAGAAACAGGATGG + Intronic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196022931 X:111009230-111009252 ATGAGGAAGGAGAAACAAAGTGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196102201 X:111858407-111858429 AGGAAAGAGGAGAAACAAGAAGG + Intronic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1197048494 X:122029365-122029387 ATGGAGAGAGAGCAACAGGAAGG + Intergenic
1197707623 X:129646082-129646104 ATGAGGCAGGAGACACAGAAAGG + Exonic
1197823573 X:130565558-130565580 ATGAAGATAGAGAAGCAGGGAGG + Intergenic
1197882470 X:131181349-131181371 CAGAAGGAAGAGAAACAGGAAGG - Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1198142957 X:133824151-133824173 AAGAGGAATGAGAAACAGAAAGG + Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1200488322 Y:3792145-3792167 AGGAAGAAAGAAAAAGAGGACGG + Intergenic
1200683839 Y:6243647-6243669 ACCAAGAAGGAGAAAGAGTATGG + Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200830053 Y:7680498-7680520 GCCAAGAAGGAGAAAAAGGATGG - Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201048796 Y:9910739-9910761 ACCAAGAAGGAGAAAGAGTATGG - Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201697402 Y:16841019-16841041 GTAAAGAAGGAGAGAAAGGAAGG + Intergenic
1201972465 Y:19812597-19812619 TTGAAGAAGTAGAATCGGGAAGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic
1202161648 Y:21941027-21941049 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202229708 Y:22645346-22645368 GTCAAGAAGGAGAAACAGGATGG + Intergenic
1202313448 Y:23550819-23550841 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202557355 Y:26119776-26119798 GTCAAGAAGGAGAAACAGGATGG + Intergenic