ID: 1102488738

View in Genome Browser
Species Human (GRCh38)
Location 12:113276196-113276218
Sequence ATTTTTTCCCTGTGGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102488738_1102488744 -6 Left 1102488738 12:113276196-113276218 CCTTTGATCCACAGGGAAAAAAT 0: 1
1: 0
2: 3
3: 24
4: 298
Right 1102488744 12:113276213-113276235 AAAAATGGGGGACCAGTTTGAGG 0: 1
1: 0
2: 0
3: 14
4: 161
1102488738_1102488745 -5 Left 1102488738 12:113276196-113276218 CCTTTGATCCACAGGGAAAAAAT 0: 1
1: 0
2: 3
3: 24
4: 298
Right 1102488745 12:113276214-113276236 AAAATGGGGGACCAGTTTGAGGG 0: 1
1: 0
2: 1
3: 13
4: 186
1102488738_1102488746 0 Left 1102488738 12:113276196-113276218 CCTTTGATCCACAGGGAAAAAAT 0: 1
1: 0
2: 3
3: 24
4: 298
Right 1102488746 12:113276219-113276241 GGGGGACCAGTTTGAGGGAAAGG 0: 1
1: 0
2: 0
3: 15
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102488738 Original CRISPR ATTTTTTCCCTGTGGATCAA AGG (reversed) Intronic
901777300 1:11569039-11569061 TTTTCTTCCCTGTGTACCAAAGG + Intergenic
902050277 1:13558830-13558852 ATGTATTCCCTGAGGATAAAAGG - Intergenic
903113332 1:21157145-21157167 ATTTTATCCCAGTGGATCTTCGG + Intronic
906363668 1:45186434-45186456 TTTTTTTTCCTGAGGTTCAAGGG - Intronic
907509987 1:54950753-54950775 TTTTTTCCCCTGTGGCTCACGGG + Intergenic
908216331 1:61957340-61957362 ATTTTCTCTCAGTGGAACAATGG + Intronic
909302587 1:74032044-74032066 ATTTTTCCCAAGTGGATCTATGG + Intronic
910226774 1:84943950-84943972 TTTTTTTCCCCTTGGATCCATGG + Intronic
910419638 1:87044836-87044858 TTTTTTCCCCTTTGGAACAAAGG + Intronic
910857865 1:91713968-91713990 ATTTTTTCCCTCTGCTACAAAGG - Intronic
911647861 1:100354546-100354568 ATCTTTTTCCTGTAGATCAGTGG - Intronic
914416580 1:147488990-147489012 ATTTTTTCAGTGTGGCCCAATGG - Intergenic
919133624 1:193481585-193481607 ATTTATTCCCCGTGAATAAAGGG - Intergenic
921001563 1:211049574-211049596 AGTTCTTACCTGTGCATCAAGGG - Intronic
1062828566 10:589355-589377 TTTTCTTCCCTATGGATCATTGG + Intronic
1064215570 10:13397406-13397428 ATCTTTTCCCTGGTGATCCAGGG - Intergenic
1064961091 10:20965608-20965630 TTTTCTTCCCTGTGGGTCATGGG + Intronic
1065399754 10:25285618-25285640 TTTTTTTCCCTCTGGATCCCTGG + Intronic
1065830846 10:29612285-29612307 ATATTTTCCCTGAGAATCACTGG - Intronic
1066234769 10:33475164-33475186 ATTTTTTCACTGTCCATTAAGGG + Intergenic
1069672198 10:70216660-70216682 ATTTTTTTGCTGTTGATAAATGG - Intronic
1071233650 10:83618822-83618844 ATGTATCCCCTGTGGATAAAGGG - Intergenic
1072030097 10:91511326-91511348 AATTTTTACATGTGCATCAAGGG + Intronic
1072337804 10:94415113-94415135 ATTTTTTCCATGTGGGTAAGAGG - Intronic
1072967134 10:99983348-99983370 ATTTTTTCCCTTCGCATGAAAGG + Intronic
1073934971 10:108620163-108620185 ATTTTTATCCTGTGGGTAAAAGG - Intergenic
1077430403 11:2513376-2513398 CTGTTTGCCCTGTGGATCAAAGG + Intronic
1078312826 11:10262891-10262913 ATTCTTTACCTGAGGATAAAAGG + Intronic
1078954112 11:16170657-16170679 ATTTTGTCCCTTTGGAACACAGG + Intronic
1080947621 11:36992688-36992710 AATTTAGCCCTGTGGATGAATGG + Intergenic
1081761797 11:45581767-45581789 TTTAGTACCCTGTGGATCAAAGG + Intergenic
1082093192 11:48106103-48106125 ATTTTTTTACTGTGGATTGAAGG + Intronic
1084344302 11:68534257-68534279 TTTTATTTCCTGTGGAACAAAGG + Intronic
1084609001 11:70188924-70188946 ATTTTTTTTCTGTAGCTCAAAGG + Exonic
1086007040 11:82049039-82049061 AATTTTTCCTTGTGGCCCAAGGG - Intergenic
1086253951 11:84852078-84852100 ATATTTACCTTTTGGATCAATGG + Intronic
1087521199 11:99239358-99239380 ATGTTTTCATTATGGATCAATGG + Intronic
1089075478 11:115735092-115735114 ATATTTTCCCTCTGGAACAATGG - Intergenic
1089624471 11:119742470-119742492 AATTTTTGCCAGTGGATCATCGG + Intergenic
1090687912 11:129144854-129144876 AATTTTTCCCTGTGGTTAATTGG - Intronic
1091579246 12:1771952-1771974 ATTTTCTCCCTATGTATCAATGG - Intronic
1093509955 12:19914853-19914875 TCTTTTTCCTTGTGGATGAAAGG + Intergenic
1095081127 12:38000877-38000899 ATTTTCTCCATGGGCATCAATGG - Intergenic
1098157458 12:67614464-67614486 ATGTCTTCCCTGTGGCTAAATGG + Intergenic
1098480140 12:70948362-70948384 ATTTTTTCCCTGTGGTGCTTGGG - Intergenic
1098879227 12:75899794-75899816 ATTTATTTACTGTGGCTCAAAGG - Intergenic
1098909586 12:76195411-76195433 GTTCTATCCCTGCGGATCAAGGG + Intergenic
1100077114 12:90798873-90798895 TTTTTTTTCCTGTGGAGCAGAGG - Intergenic
1101070109 12:101065301-101065323 ATGTATTACCTGTGGATAAAAGG + Intronic
1101458666 12:104865169-104865191 ATTTTTTGCCTGGGGGTAAAAGG + Intronic
1101668739 12:106846368-106846390 ATTTTTTCCCTCTGTATTTATGG + Intronic
1101919648 12:108922179-108922201 ACTGTTTCCCTCTGGAGCAAAGG + Intronic
1102488738 12:113276196-113276218 ATTTTTTCCCTGTGGATCAAAGG - Intronic
1102512289 12:113423809-113423831 ATTTTTCCCCTGGGGATCCTGGG - Intronic
1104312640 12:127667797-127667819 TTTATTTCCCTCTGAATCAATGG + Intergenic
1104438193 12:128773207-128773229 ATTTTATCCCTGTGGAAGGACGG + Intergenic
1105712004 13:23020050-23020072 ATTTTTTCTCTGTAGTTCCAAGG + Intergenic
1107001299 13:35548393-35548415 ATTTTTTCCTTCTGGAGCTATGG - Intronic
1107458947 13:40582155-40582177 TTTGTTTCCCTGTGCATAAAAGG + Intronic
1107501473 13:40982068-40982090 ATTTTTCTCATGTGGATCTAAGG - Exonic
1109755567 13:66754938-66754960 ATTTTTTCCCTGTTGATAAGAGG - Intronic
1109922491 13:69086718-69086740 TTTTTTTCCCTGTGTATAATGGG + Intergenic
1110374679 13:74779081-74779103 ATTTTTTTGCTTTTGATCAAAGG + Intergenic
1110908211 13:80919583-80919605 ATTTTTTCCTTGTAGAATAAGGG - Intergenic
1111866896 13:93779968-93779990 TTTTTTTCCTTATGGATCCAAGG + Intronic
1112375963 13:98841155-98841177 TTTTTTTGTCTGTGGATCAAAGG - Intronic
1115013346 14:28577782-28577804 ATTCTTCCCCTGTGAATCACAGG - Intergenic
1115460833 14:33658739-33658761 CTGTGATCCCTGTGGATCAAAGG + Intronic
1116086157 14:40240653-40240675 AATTTTTGGCTGTGGCTCAAAGG + Intergenic
1116397388 14:44462963-44462985 ATGTATCCCCTGTGGATAAATGG - Intergenic
1116809278 14:49523783-49523805 TTTTTTTCCCCTTGGACCAAAGG - Intergenic
1116920360 14:50565744-50565766 ATTATTTCCCTGGTGATCACAGG - Intronic
1117154409 14:52923691-52923713 ATTTTTTTTCTGTGGGTAAACGG - Intronic
1117612081 14:57494346-57494368 ATTTTTTTCCTGGGGATAAGGGG + Intergenic
1117984195 14:61371539-61371561 ATGTTTTTCCTGTGGTTCAAGGG + Intronic
1118108560 14:62689748-62689770 ATTTGTTCCTTTTGGTTCAAAGG - Intergenic
1118531322 14:66709343-66709365 ATTTATCCCCTGTGGATAAAAGG - Intronic
1120099958 14:80434025-80434047 ATTATTTTCCTGTGTATCATTGG - Intergenic
1122362957 14:101178253-101178275 TTTTTGTCCCTGTGGACCCAGGG - Intergenic
1122376246 14:101261065-101261087 ACGTATTCCCTGTGGATAAAGGG + Intergenic
1124056599 15:26245922-26245944 ATTTTTGTACTTTGGATCAATGG - Intergenic
1124085432 15:26545736-26545758 ATTTTTTCCATGGGTAACAATGG - Exonic
1125723425 15:41856178-41856200 CTTTTTTCCCTCTAGATCAGTGG - Intronic
1125877307 15:43161146-43161168 ATGTGTCCCCTGTGGATAAAGGG + Intronic
1127232984 15:57016799-57016821 AGTTTCTCCCTCTGGAACAAAGG + Intronic
1127484180 15:59404218-59404240 TTTTTTGCCCTGAGAATCAATGG - Intronic
1129013241 15:72442103-72442125 AGTTTTTCCCTGTGCATTCATGG + Intergenic
1130757155 15:86776708-86776730 TTTTATTCTCTGTGAATCAATGG + Intronic
1130954526 15:88617825-88617847 ATTTTTTTCCAGCTGATCAATGG - Intergenic
1135238470 16:20781053-20781075 GTTTTTTCTCCGTGGATCCAGGG + Exonic
1135783222 16:25324616-25324638 TTTCTTTCCCAGTGGCTCAAAGG + Intergenic
1138532538 16:57642481-57642503 CTTTTTTCCATGTGGATAACAGG + Intronic
1140041128 16:71408935-71408957 TTTTTTTCCCTTAGGAGCAAAGG - Intergenic
1140445578 16:75024919-75024941 AATTTTTGCCTCTGGATGAATGG + Intronic
1140730335 16:77850518-77850540 AGTTTATGCCTGTTGATCAAGGG + Intronic
1141601237 16:85127598-85127620 ATTTTTATCCTGTAGATCAGTGG - Intergenic
1141645534 16:85365393-85365415 CTCTTTTCCCTGTGGACAAAGGG + Intergenic
1142273623 16:89104216-89104238 CTTTTTTTCCTGTGAATAAAAGG - Intronic
1144257081 17:13479723-13479745 ATTTTTTGCTTTTGGACCAAAGG + Intergenic
1144363084 17:14515190-14515212 TTTACTTCCCTGTGGAGCAATGG - Intergenic
1144660501 17:17065394-17065416 TTTTTTTGCCTGTGGACGAAGGG + Intronic
1146605759 17:34256373-34256395 AGTTCTTCCTTGTGGAGCAAGGG + Intronic
1147543945 17:41383978-41384000 TTTGTTTCCCTGCGGAACAAAGG - Intronic
1148154203 17:45413368-45413390 TCTTTTTCCCTCTGAATCAATGG - Intronic
1149256299 17:54831185-54831207 ATTTTTTCCCTGTGTAGAGAAGG - Intergenic
1149402203 17:56309619-56309641 ATGTATCCCCTGTGGATGAAAGG - Intronic
1149577044 17:57721413-57721435 ACTTATCCCCTGTGGATAAAGGG - Intergenic
1149669092 17:58389504-58389526 TTTTGGTCCCTGTTGATCAACGG - Intronic
1149692754 17:58591699-58591721 TTTTTTTTCCTGTGGATAAATGG - Intronic
1203167958 17_GL000205v2_random:115753-115775 TTTTTATTTCTGTGGATCAATGG - Intergenic
1154089758 18:11345769-11345791 ACATTTTCCCTGTGGATAATGGG - Intergenic
1155729336 18:29133127-29133149 ATTTTTTCCACAAGGATCAAAGG - Intergenic
1158110007 18:53930500-53930522 AATTTTTCAGTGTGGTTCAAAGG - Intergenic
1158566784 18:58560785-58560807 TTCTTTTCCCTATGGAACAAAGG - Intronic
1158784976 18:60700251-60700273 ATTTTTTCCTTGTGGAACTTGGG + Intergenic
1159997775 18:74983065-74983087 AGTTATGCCATGTGGATCAAAGG + Intronic
1162283189 19:9716950-9716972 AATATTTCCCTGTTGATCTAGGG + Intergenic
1164577367 19:29413360-29413382 TTTTTTTCCCTGTGCAACAGTGG - Intergenic
1165241193 19:34469289-34469311 ATTTTTTCCCTTTGGAACAAAGG - Exonic
926983604 2:18597434-18597456 ATTTTTTCCCAATCCATCAAAGG - Intergenic
929033256 2:37668405-37668427 ATTATTTCCCTGAGGATTAAAGG - Intronic
929227903 2:39529285-39529307 ATTTTCTCCCAGTTTATCAAGGG - Intergenic
930656878 2:54015466-54015488 TTTTTTTCCCTGGAGAACAATGG - Intronic
930808199 2:55513148-55513170 ACTTTTTCTCTGAGCATCAATGG - Intergenic
931189022 2:59981686-59981708 ATTTTTTCCTTCTGCATCTAAGG + Intergenic
931314715 2:61118013-61118035 TTTTTTTCCCTTCAGATCAACGG + Exonic
933256211 2:80083785-80083807 ATTTTTTCATTGTGGGTTAAAGG + Intronic
933626238 2:84603784-84603806 CTCTTTTCCCTGTACATCAAGGG + Intronic
935017403 2:99196955-99196977 ATTTTTTCCTCATGGAACAAGGG + Exonic
935068114 2:99669484-99669506 ATTTTTGCACTTTGTATCAATGG - Intronic
935314530 2:101818539-101818561 ATTTTTTCCCATTCCATCAATGG - Intronic
935753981 2:106262857-106262879 ATTTTGCTCCTGTAGATCAATGG - Intergenic
936507004 2:113115948-113115970 ATTTCTTCCCTGGGGAGCTAGGG - Intronic
937388007 2:121454474-121454496 ATTCTTTCCCTGTGGCCCAGAGG - Intronic
937838974 2:126506428-126506450 ATTATTTCTATATGGATCAAAGG + Intergenic
938664554 2:133521009-133521031 AATTTATCCAAGTGGATCAAAGG + Intronic
939442573 2:142268810-142268832 ATTTTTTCTCTGTGTATCAAAGG - Intergenic
939636309 2:144586589-144586611 ACTTTTTACCTAAGGATCAAAGG - Intergenic
942646751 2:178119806-178119828 TTTTTTTGCTTCTGGATCAAGGG - Intronic
942786767 2:179709636-179709658 AGTTCTTCACTGTGGCTCAAAGG - Intronic
942920053 2:181362215-181362237 ATGTATCCCCTGTGGATAAAGGG - Intergenic
943792391 2:191948131-191948153 ATTTTTTCTCTTGGGAGCAAAGG - Intergenic
944978180 2:205082242-205082264 ATGTATTTCCTGTGGATAAAGGG - Intronic
946574739 2:221062657-221062679 ATATTTCCTCTGTGGATCCATGG - Intergenic
946646281 2:221838270-221838292 ATATTTTTCCTGTGGAGCACTGG + Intergenic
946777053 2:223153924-223153946 ATGTTTTCCCTGTGGATCTCTGG + Intronic
1169272609 20:4212135-4212157 AGTGTTACCCTGTGCATCAAAGG - Intergenic
1169437500 20:5606095-5606117 ATTTCTTCCCTGTCAGTCAAAGG + Intronic
1170564948 20:17594123-17594145 ATTTTTTACCTTCAGATCAATGG + Intronic
1172176783 20:32977325-32977347 CCTCTTTCCCTGTGGATCCAGGG + Intergenic
1172729751 20:37076176-37076198 ATATATTCCCTGAGGATAAATGG - Intronic
1175581598 20:60104134-60104156 ATTTTTTCCCAGCGTATTAATGG - Intergenic
1176403799 21:6343383-6343405 TTTTTATTTCTGTGGATCAATGG + Intergenic
1176433358 21:6645721-6645743 TTTTTATTTCTGTGGATCAATGG - Intergenic
1177304623 21:19297156-19297178 AATTTTTGCCTGTGGCTGAATGG - Intergenic
1178072012 21:28978366-28978388 TTTTTTTCCCTGTTGATCTGTGG - Intronic
1178721008 21:35008889-35008911 CTTTCTTCCCTTTGGATCAATGG - Intronic
949660929 3:6277497-6277519 ATTTTTTTCCTGGGGAAAAATGG + Intergenic
949866391 3:8550913-8550935 ATTTGTTCTGTGTGGAACAAAGG + Intronic
949906985 3:8865982-8866004 ATTTTTTCTGTGTTGATTAATGG + Intronic
949942363 3:9164835-9164857 AGGATTTCTCTGTGGATCAAAGG - Intronic
950759024 3:15204035-15204057 TTTTTTTCCCTTTGGTTAAATGG - Intergenic
950821728 3:15767409-15767431 ATTTTATTCCTGTGGACAAAAGG - Intronic
951165776 3:19483790-19483812 TTTTTTTCACTGAGGATCAAGGG + Intronic
951169680 3:19526306-19526328 ATTTTTTCTCTGCCTATCAACGG + Intronic
951491447 3:23274004-23274026 TTTTTTTCCCATTGTATCAAAGG - Intronic
955991520 3:64632813-64632835 TTTTTTTGCCTGTGGTCCAAAGG - Intronic
957257613 3:77858389-77858411 ATTTTTTCCCTCTGCCTCAATGG + Intergenic
957401660 3:79723234-79723256 CTTCTTTCCCTTGGGATCAAAGG + Intronic
960370719 3:116834890-116834912 ATTTTTTCCCAGTGCAATAATGG - Intronic
961919610 3:130412275-130412297 ATTTTTTCCATCTGGAAAAATGG - Intronic
961951219 3:130751389-130751411 ATTTTTTCCCTTAGGATGCAAGG - Intergenic
963386742 3:144605838-144605860 ATTGTTTCCCTGTTGATGAATGG - Intergenic
963429339 3:145178085-145178107 ATTTTTTCCCTGTGCCTGAATGG - Intergenic
963626960 3:147685266-147685288 AATTTTTCCCTGTGTCTCAAGGG - Intergenic
963985618 3:151590589-151590611 ATTTTTTTCCTGTGCAACCATGG - Intergenic
965307076 3:167079487-167079509 ATTTTTTCCCTATGTATGTAAGG + Intergenic
965315267 3:167182880-167182902 ATTATTTCCCTGTTGATCTGGGG + Intergenic
966052050 3:175630680-175630702 TTTTTTTCACTGAGGATAAATGG + Intronic
966759040 3:183399386-183399408 ATTTATTCCCTTTGGATCACAGG - Intronic
967067103 3:185928176-185928198 ATGTTTTCCCTGAGCATCAAAGG - Intronic
967369494 3:188728155-188728177 ATATTTTCTCAGTGGATCTAGGG - Intronic
967642817 3:191886907-191886929 GATTTTTACCTGTGGATCAGAGG - Intergenic
967696282 3:192535299-192535321 ATTTTTTCCCTATGGATATATGG - Intronic
969638091 4:8380979-8381001 ATTTTTTCCCTGTGGCTTCCTGG + Intronic
971012777 4:22457075-22457097 ATTGTTTCCCAGAGAATCAATGG - Intronic
971470611 4:27021869-27021891 ATTTTTCCACTGTGGAGAAAAGG + Intronic
973225390 4:47778119-47778141 TTTTTCTCTCTGTGAATCAAAGG + Intronic
973301847 4:48593921-48593943 TTTTTTTACCTCTGGATTAATGG + Exonic
973816689 4:54625999-54626021 TTTTTTTTCCTCTGGTTCAAAGG + Intergenic
974070341 4:57117870-57117892 AGGTTTTCCCTGAGGTTCAAAGG + Intergenic
974635881 4:64563625-64563647 AATGTTTCCCTGTTGATCTAGGG - Intergenic
975644467 4:76532468-76532490 ATGTCTCCCCTGTGGATCAGGGG - Intronic
976052769 4:81028820-81028842 ATTTTTTCCCTGTGAACTATTGG - Intergenic
976373992 4:84323634-84323656 ATTTTTTCCATGTGAAACATAGG - Intergenic
976426363 4:84907761-84907783 ATTTTTTCCCTGTGTCTGTAGGG - Intronic
976613188 4:87050613-87050635 ATTTTTTCCCTTAGGATCTTTGG - Intronic
976694856 4:87908440-87908462 AGTTTTTCTCTGTGGTTCATGGG + Intergenic
977048004 4:92091069-92091091 ATTATTTCCCTTTGGATCTCGGG + Intergenic
977073858 4:92428490-92428512 ATTTTTTCCTTGTGGACAATTGG + Intronic
977644067 4:99391538-99391560 ATTTTTTGCCTGTGGATATCCGG - Intergenic
978962928 4:114705995-114706017 ATTTTATTCCTGTGCATCAGGGG - Intergenic
979400285 4:120240792-120240814 ATTTTCTCCCTGTGTTTTAAGGG + Intergenic
979437498 4:120711174-120711196 ATTTGTACCCTCTAGATCAAGGG - Intronic
981600671 4:146485058-146485080 ATTTTTTTCCAGTGGGTAAAAGG - Intronic
982282024 4:153693381-153693403 AATATTTCCCTGTTGATCTACGG + Intergenic
984637367 4:182125463-182125485 ACTTATTCCCTGTGGATAAGGGG + Intergenic
986347915 5:6851529-6851551 ATTTTTTCTCAGTGGTTTAATGG + Intergenic
987603164 5:20099788-20099810 ATTTTTTTCCTTTGGATACAGGG + Intronic
987963745 5:24845635-24845657 ACTTTCTCCCTGTGCCTCAAAGG - Intergenic
988045072 5:25940680-25940702 ATATTTTCCCTTTAGATAAAAGG + Intergenic
988103692 5:26715282-26715304 ATGTTTTTCAAGTGGATCAATGG - Intergenic
988135895 5:27171537-27171559 TTTTTTTCCCTCTTGATAAATGG + Intergenic
988218161 5:28303890-28303912 ATTTTTTCCCTGTGAGCAAAAGG - Intergenic
994670893 5:102760145-102760167 ATTCTTTCCCTCTGAAGCAAAGG + Intronic
994863825 5:105237051-105237073 ATTATTTCCCAGTGGAGCCAAGG - Intergenic
995368896 5:111396110-111396132 ATTTTTTCCCTTTTCATCATTGG - Intronic
995939931 5:117569559-117569581 ACATTTTCCCAGTGGATCAATGG + Intergenic
996290715 5:121849459-121849481 ATTATTTCCCTGTAAATAAAAGG - Intergenic
996291756 5:121859911-121859933 AATATTTCCCTGTTGATCTAGGG + Intergenic
996545747 5:124677335-124677357 AGTTTTTCCCTGAGGAGCCATGG + Intronic
997473252 5:134128427-134128449 CTTGTTTCCCTTTGGATAAATGG + Intronic
998448196 5:142214518-142214540 ACGTATTCCCTGTGGATAAAGGG - Intergenic
998722179 5:144965679-144965701 AGTTTTTCCCTGAGGAGCAAAGG + Intergenic
998884019 5:146675467-146675489 ATTTTTGCCCAGTGAATGAAAGG + Intronic
1000541974 5:162551285-162551307 ATTTTTTGCCTGTGTCTCCAGGG + Intergenic
1001195990 5:169674107-169674129 ATTTATTCCCCGTGGACCACAGG - Intronic
1001868523 5:175129049-175129071 ATCATTTCCATTTGGATCAATGG + Intergenic
1002922511 6:1582483-1582505 ATGTTTTTCCTGTGTATGAATGG - Intergenic
1004262481 6:14120081-14120103 CTTTTTTTCCTGTTGATCCATGG + Intronic
1004416390 6:15428209-15428231 ATTTTTTCCTTTAGGCTCAATGG + Intronic
1006040850 6:31253494-31253516 CTCTTTTCCTTGTGGATCAGGGG + Intergenic
1006833490 6:36983182-36983204 ATTTTGACCCAGTGGAGCAAAGG + Intronic
1007862339 6:44924739-44924761 ATTTTTTTCCTTAGGATCAGTGG + Intronic
1008430560 6:51411930-51411952 ATTTTTTCCCTTGGGTTCATGGG - Intergenic
1008740142 6:54596876-54596898 ATGTATTCCCTGTGGATAAGGGG - Intergenic
1008939537 6:57031231-57031253 ATTTTTTCCTCATGGAACAAGGG + Intergenic
1011277866 6:85646812-85646834 ATTTTTACCCTGTGAATTGAAGG - Intergenic
1011411681 6:87073112-87073134 ATTTTTCCCATATGGATAAATGG - Intergenic
1011500174 6:87979580-87979602 AATTTTTCCCTGTCCCTCAAAGG + Intergenic
1013890344 6:115019561-115019583 ATTTTTTCCCTTTAAAGCAAAGG - Intergenic
1014596465 6:123347378-123347400 TTTTTTTCTGTGTGTATCAAGGG + Intronic
1016252591 6:142063121-142063143 ATTTTTTCTCTTTGCAACAAAGG - Intronic
1016796628 6:148125012-148125034 ACTTATTTCCTGTGGATAAAAGG + Intergenic
1020349915 7:7208437-7208459 ACATATTCCCTGTGGATAAAGGG + Intronic
1021326843 7:19281589-19281611 ATTTGTCCCCTGTAGATAAAGGG - Intergenic
1023502492 7:40865410-40865432 TTTCTTTCCCTGTGTTTCAAGGG - Intergenic
1025008685 7:55377304-55377326 ATTTTTTCCATGTACATCACAGG - Intronic
1025171613 7:56763376-56763398 ATTTTTTCCCAGTTTGTCAATGG + Intergenic
1029342742 7:99958108-99958130 TTTTTTTCCCTGTGGATATTAGG - Intergenic
1030425606 7:109373544-109373566 ATTTTTTCCATGTAAATAAAGGG - Intergenic
1030558049 7:111051325-111051347 ATATTTTCCCTGGGGAGCATAGG + Intronic
1030758455 7:113320049-113320071 ACCATTTCCCTGTGGAGCAAAGG + Intergenic
1031382910 7:121110702-121110724 ATTTTTTCCCTATGGGCAAAGGG + Intronic
1031969892 7:128056696-128056718 ATGTATTCCCTGTGGATAAGGGG - Intronic
1032666740 7:134044223-134044245 ATTACTTCCCTGTGGCTCAGAGG - Intronic
1032967331 7:137114571-137114593 TTTTTTTTCCTGTGAATCCATGG + Intergenic
1033197942 7:139343010-139343032 GTATTTTCCCTGTGGAGAAAGGG - Intronic
1036769414 8:11568462-11568484 ATGTATTCCCTGTGGATAAGGGG + Intergenic
1037162950 8:15794767-15794789 TTTTCCCCCCTGTGGATCAAAGG - Intergenic
1037962877 8:23112332-23112354 ATATATTCCCTGTGGATAGAAGG + Intronic
1038092488 8:24269757-24269779 ATTTTTTCACTGCGGAACAGGGG - Intergenic
1039026824 8:33267703-33267725 ATGTATCCCCTGTGGATGAAAGG - Intergenic
1039624196 8:39031206-39031228 ATTAACTCCATGTGGATCAAAGG - Intronic
1039691711 8:39871420-39871442 AATATTTCCCTGTTGATCTAGGG - Intergenic
1039783207 8:40808260-40808282 ATTTTTTTTCTTTAGATCAAAGG + Intronic
1042801948 8:72728682-72728704 ATTTTTTACCTGTAAAGCAAAGG + Intronic
1043014839 8:74924995-74925017 ATTTATTAAATGTGGATCAAAGG - Intergenic
1043109536 8:76161726-76161748 ATGTATTCCCTGTGGATAAAGGG + Intergenic
1043922807 8:86003273-86003295 ATGTTTTCCCCGTGGATAAGGGG + Intronic
1044271281 8:90247151-90247173 ATTGTTTTCCTGTTAATCAAGGG - Intergenic
1046268999 8:111868411-111868433 ATTTATTCCATGTGGAGGAAAGG + Intergenic
1046719947 8:117608257-117608279 ACCTTTTCCTTGTGGATTAAGGG + Intergenic
1047063098 8:121250115-121250137 ATTTTTCCCCTATGGATATATGG + Intergenic
1047597346 8:126392341-126392363 ATTTTTCCCCTGTGAATCCTGGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049961651 9:743165-743187 AGTTTATCTCTGTGGATCACAGG + Intronic
1051414174 9:16821415-16821437 TTTTTTTCTCTGTAGATAAAAGG - Intronic
1051951898 9:22645993-22646015 AATTTTTGCCTGTGTGTCAAGGG + Intergenic
1052727906 9:32251805-32251827 ATTTGATCCCTGTGCATCAGAGG + Intergenic
1052919805 9:33955963-33955985 ATTTTTTCCCTTTTTATCCAAGG - Intronic
1052984742 9:34478658-34478680 AATTTAGCCCTGCGGATCAATGG - Intronic
1053828945 9:42055218-42055240 ATTTTTTCCCTCTGGGTAATGGG - Intronic
1054601614 9:67132235-67132257 ATTTTTTCCCTCTGGGTAATGGG + Intergenic
1055092068 9:72373077-72373099 ATTTATTCCATGTGGATCAATGG + Intergenic
1055587469 9:77770219-77770241 GTTTTTTCTCTGTGGATAAGAGG + Intronic
1056693679 9:88828520-88828542 TTTCTTTCCCTGGGGAACAATGG - Intergenic
1057927586 9:99166901-99166923 ATTTTATCCCCATGGATCCATGG + Intergenic
1058451945 9:105105318-105105340 CTTTTCTGACTGTGGATCAATGG + Intergenic
1058827248 9:108786035-108786057 CTTTTTTGCCAGTGGAACAAAGG - Intergenic
1059182474 9:112230452-112230474 ATTTTTTCCCCGTAAATCAGTGG - Intronic
1059209353 9:112497942-112497964 TTATTTTCCCTATTGATCAAAGG + Intronic
1061653810 9:132072334-132072356 ATTTTTTTCCCTTGTATCAAGGG + Intronic
1062221521 9:135418602-135418624 ATTTTTGTGCTCTGGATCAAAGG - Intergenic
1203438178 Un_GL000195v1:162949-162971 TTTTTATTTCTGTGGATCAATGG + Intergenic
1185595096 X:1301497-1301519 ATTGTTTCCCAGTGGAGCAGAGG - Intronic
1188343190 X:29030319-29030341 ATTCTTTCCCCCTTGATCAATGG - Intronic
1189575592 X:42349731-42349753 ATATTTTCCCACTGTATCAAGGG + Intergenic
1189600581 X:42620826-42620848 AAGTTTTCCCTGTGTATGAAAGG + Intergenic
1189725303 X:43962883-43962905 ATTATTTCCCTGAGGATGACAGG - Intronic
1190478814 X:50854140-50854162 ATTCATTCCATGTGGATTAATGG - Intergenic
1192127909 X:68519308-68519330 ATTTTTTCCCGCTCTATCAATGG - Intronic
1193340542 X:80343983-80344005 GTTTTTCCCCTCTGAATCAATGG + Intronic
1193961147 X:87925756-87925778 ATCTTTTTCCTGTGAAACAAAGG + Intergenic
1194149977 X:90311536-90311558 AGTGTTTCCCTTTGGAGCAAAGG - Intergenic
1194680843 X:96850630-96850652 ATGTTTTCCCTGTGAACAAAGGG - Intronic
1195160092 X:102162486-102162508 ACTTTTGCCCTCTGGAGCAATGG + Intergenic
1196294682 X:113984196-113984218 AATATTTCCCTGTGGAACATTGG - Intergenic
1199295162 X:146148981-146149003 ATTTGTTGCCTGAGGACCAAGGG + Intergenic
1199466477 X:148143483-148143505 ATTTTTTCCCTTTCGGTCCATGG + Intergenic
1199826067 X:151501317-151501339 TTTTTTTTCCTGTTGATCTATGG - Intergenic
1200695461 Y:6354784-6354806 TTTTTTCCTCTGTGGAACAAAGG - Intergenic
1200714261 Y:6520149-6520171 ATGTGTTCCTTGTGGGTCAATGG + Intergenic
1200831188 Y:7689842-7689864 ATGTGTTCCCTGTGGGTCAATGG - Intergenic
1200951642 Y:8903913-8903935 ATGTGTTCTCTGTGGGTCAATGG + Intergenic
1201019561 Y:9641008-9641030 ATGTGTTCCTTGTGGGTCAATGG - Intergenic
1201039816 Y:9819926-9819948 TTTTTTCCTCTGTGGAACAAAGG + Intergenic
1201370065 Y:13253543-13253565 AATATTTCCCTGTTGATCTAGGG - Intronic
1201777421 Y:17681486-17681508 ATTTTTTTCATGAGCATCAATGG + Intergenic
1201824136 Y:18224506-18224528 ATTTTTTTCATGAGCATCAATGG - Intergenic
1202088725 Y:21165779-21165801 ATTTTTTCCCCATGGGTCATGGG + Intergenic
1202115745 Y:21467841-21467863 ATGTGTTCCCTGTGGGTCAATGG + Intergenic
1202161306 Y:21939407-21939429 ATGTGTTCCCTGTGAGTCAATGG - Intergenic
1202230050 Y:22646966-22646988 ATGTGTTCCCTGTGAGTCAATGG + Intergenic
1202313106 Y:23549199-23549221 ATGTGTTCCCTGTGAGTCAATGG - Intergenic
1202557696 Y:26121395-26121417 ATGTGTTCCCTGTGAGTCAATGG + Intergenic