ID: 1102489321

View in Genome Browser
Species Human (GRCh38)
Location 12:113279716-113279738
Sequence TTTTGCCCTCCTCTTATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102489314_1102489321 4 Left 1102489314 12:113279689-113279711 CCACTGCGCCCGACCCCGATAAT 0: 1
1: 0
2: 9
3: 103
4: 897
Right 1102489321 12:113279716-113279738 TTTTGCCCTCCTCTTATGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 116
1102489317_1102489321 -9 Left 1102489317 12:113279702-113279724 CCCCGATAATATATTTTTGCCCT 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1102489321 12:113279716-113279738 TTTTGCCCTCCTCTTATGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 116
1102489315_1102489321 -4 Left 1102489315 12:113279697-113279719 CCCGACCCCGATAATATATTTTT 0: 1
1: 0
2: 2
3: 39
4: 699
Right 1102489321 12:113279716-113279738 TTTTGCCCTCCTCTTATGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 116
1102489313_1102489321 24 Left 1102489313 12:113279669-113279691 CCTGGGATTACAGGCGTGAGCCA 0: 1131
1: 3348
2: 3812
3: 3957
4: 4698
Right 1102489321 12:113279716-113279738 TTTTGCCCTCCTCTTATGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 116
1102489316_1102489321 -5 Left 1102489316 12:113279698-113279720 CCGACCCCGATAATATATTTTTG 0: 1
1: 0
2: 1
3: 11
4: 187
Right 1102489321 12:113279716-113279738 TTTTGCCCTCCTCTTATGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 116
1102489318_1102489321 -10 Left 1102489318 12:113279703-113279725 CCCGATAATATATTTTTGCCCTC 0: 1
1: 0
2: 3
3: 11
4: 197
Right 1102489321 12:113279716-113279738 TTTTGCCCTCCTCTTATGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102489321 Original CRISPR TTTTGCCCTCCTCTTATGGC AGG Intronic
901366349 1:8753200-8753222 TTATTCCCTCCTTTTATCGCAGG - Intronic
902249193 1:15142119-15142141 TATTCCCCTCCTCCTTTGGCTGG - Intergenic
903029069 1:20449732-20449754 TTTTGTCCTCCTTTTATAGAAGG + Intergenic
904459204 1:30665476-30665498 TGTGGCCCTGCTCTTGTGGCTGG - Intergenic
905479965 1:38254888-38254910 TTTTGCCCTCCTCTGAGCTCTGG - Intergenic
917384007 1:174448629-174448651 TCTTGCCTTCCTTTTTTGGCTGG + Exonic
920020336 1:202950953-202950975 GTTTGCCCTTCTCTTCTAGCAGG + Exonic
921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG + Intronic
1070151900 10:73810720-73810742 TTTTCCCTACCTCTTAGGGCTGG - Intronic
1070681788 10:78453898-78453920 TTTTGGCTTCCTCTTGTGCCAGG + Intergenic
1075560491 10:123464653-123464675 CTTTGCCCCACTCTTATAGCTGG + Intergenic
1078617723 11:12880992-12881014 TTTTGCCTTCCAGTTCTGGCCGG + Exonic
1080924954 11:36746725-36746747 TTTTGCCCTCAGCTTAACGCTGG + Intergenic
1082930323 11:58596448-58596470 TTTTGACTTCCTTTTATGACAGG - Intronic
1084397016 11:68918271-68918293 TTTTTTCCTGCTCTTCTGGCTGG + Intronic
1088593672 11:111423907-111423929 TCTCGGCCTCCTCTTCTGGCAGG - Intronic
1090332623 11:125943452-125943474 TTTTTCCATCCTCTGGTGGCAGG - Intergenic
1090332890 11:125945055-125945077 TTTTTCCATCCTCTGGTGGCAGG - Intergenic
1090470531 11:126977185-126977207 TTTTGTCCTCTTCTTCTGCCAGG + Intronic
1090630612 11:128644134-128644156 TTTTCCCCTCCTCTTCTCTCTGG + Intergenic
1090943354 11:131408209-131408231 TTTTGTCTCCCTCTTTTGGCCGG - Intronic
1093717160 12:22396362-22396384 TCTCTCCCTACTCTTATGGCTGG - Intronic
1094559096 12:31533166-31533188 ATTTGCCCTCCTATTACAGCAGG + Intronic
1095489429 12:42717732-42717754 TTGTGCCATCCACATATGGCGGG + Intergenic
1099178950 12:79455792-79455814 TTTGTCCCTCCTCTTAGGGCTGG - Intergenic
1100075468 12:90776304-90776326 TTTTGCCGGACTCTTATTGCTGG + Intergenic
1102489321 12:113279716-113279738 TTTTGCCCTCCTCTTATGGCAGG + Intronic
1103282583 12:119772117-119772139 TTTCACCCTCCTCCTATTGCTGG - Intronic
1107662150 13:42649835-42649857 ATTAGCCCTCCTGTTGTGGCTGG - Intergenic
1110706739 13:78606950-78606972 TTTTCTCCTCCTCCTTTGGCAGG + Intergenic
1112192168 13:97188630-97188652 TTTTTCCTTTCTCTTTTGGCTGG - Intergenic
1116954115 14:50906385-50906407 TTTTATCCTCCTCTTATTACAGG - Intronic
1116966290 14:51018414-51018436 TTTTGCCATCGTTTTATGACAGG - Intronic
1118284650 14:64460724-64460746 TTTTTTCCTCCTCTTCTGGCTGG + Intronic
1121527836 14:94631963-94631985 ATTTGCCCTTCTCTTGTAGCAGG - Intergenic
1121534997 14:94685169-94685191 TGCTGCCCTCCTCTGGTGGCTGG + Intergenic
1121802672 14:96787787-96787809 TGTTGCACTCCTATTATGGGAGG - Intergenic
1122234012 14:100322067-100322089 TTTTCCTGTCCTCTAATGGCTGG - Intergenic
1123781994 15:23637843-23637865 ATTTACATTCCTCTTATGGCTGG - Intergenic
1124931525 15:34124496-34124518 TTTTGCCCTTCTCTTGGAGCTGG + Intergenic
1127254993 15:57282469-57282491 TTCTTCCCTTCTCTTAAGGCAGG - Exonic
1131741779 15:95400657-95400679 CTTTCCCCTCTTTTTATGGCTGG + Intergenic
1132303003 15:100788023-100788045 TTTTGGCATCCTGTGATGGCAGG + Intergenic
1139662520 16:68430742-68430764 TTTGGCCTTCCTCTTCTGCCTGG + Intronic
1141680983 16:85543717-85543739 TTTAGACCTCCTACTATGGCTGG - Intergenic
1146488909 17:33265818-33265840 TTTTGTCTTCCTCATGTGGCAGG + Intronic
1148634921 17:49141719-49141741 CTCTGCCCTCCTTTTATGGTGGG + Intronic
1148927647 17:51101433-51101455 TTTTGCCATCATCTGATGCCTGG + Intronic
1149282040 17:55116772-55116794 TTGTGCTCTCCTGTTATAGCAGG + Intronic
1151378785 17:73710506-73710528 TTCTGCCTCCCTCTGATGGCTGG - Intergenic
1153707055 18:7756839-7756861 TTTTGCCCTCCTTTTTTGCCAGG + Intronic
1159046091 18:63369664-63369686 TTTTGCCCTTGGCTTATGGGAGG - Intergenic
1160774772 19:850409-850431 TTCTCCCCTCCCCTTTTGGCAGG - Intergenic
926559600 2:14401805-14401827 ATTTGCCCTCCTCTGATCCCTGG - Intergenic
927121830 2:19971749-19971771 TATTCTCCTCCTCTTATGGATGG - Intronic
928395667 2:30941672-30941694 TTTTGCCCTTATCTTATAGTGGG - Intronic
929878996 2:45820470-45820492 TATTGCCCTCCTACTATGCCAGG - Intronic
931230798 2:60372801-60372823 TTGTGTACTCCTCTTCTGGCTGG - Intergenic
935611343 2:105029071-105029093 TTTAGCCCTCCACTGTTGGCAGG - Intergenic
938169992 2:129066973-129066995 TTTTGCACCTCTCATATGGCTGG + Intergenic
938599782 2:132825381-132825403 TTTTGTCTTCCTCTTAGGGGTGG - Intronic
938649013 2:133361626-133361648 TTTTGGCCTTTTCTTGTGGCAGG - Intronic
939586989 2:144017907-144017929 TTTAGCCATCCACTTAAGGCAGG + Intronic
942124240 2:172807467-172807489 TTTTGCCCTCTTGATTTGGCAGG + Intronic
943560375 2:189454351-189454373 TTTTACCCTAATATTATGGCAGG + Intronic
1169236193 20:3931809-3931831 TTGTGCTCTCCTCTCATGGCTGG + Exonic
1170296972 20:14838171-14838193 TTTTGCCCATCTCTTTTGTCAGG + Intronic
1172159832 20:32859446-32859468 TTTTGCCCTTTTCTTTTGGGTGG + Intronic
1175397468 20:58676165-58676187 TTTTTCCCTCCTCTTTTTGTAGG + Exonic
1181886122 22:26023656-26023678 TGTTGCCCTCCTCAGGTGGCAGG + Intronic
1183073744 22:35413633-35413655 TTTAACCCTCCTCTTCTGGGAGG + Intronic
1184315868 22:43688790-43688812 TTTTGCCATCCTGTTAGGGAAGG - Intronic
949568102 3:5264144-5264166 TTTTTCACACCTCTTATGACAGG + Intergenic
953193544 3:40711772-40711794 TGTGGCCATCCTCTAATGGCAGG + Intergenic
954594267 3:51811980-51812002 TTTTGCCCTTCTCTCATGCGAGG - Intergenic
956159818 3:66338232-66338254 TTTAGCCCTTCTCTTATTGATGG + Intronic
959190362 3:103103418-103103440 TTCTGCCCTGCTATTATGTCAGG + Intergenic
959468418 3:106719530-106719552 TTTTGCTTTCTTCTGATGGCAGG - Intergenic
961323957 3:126098814-126098836 TTTTCCCCTCCACTGCTGGCAGG + Intronic
961433652 3:126901282-126901304 TTTTGCCGTCCTCTGACGGGAGG + Intronic
962255645 3:133868291-133868313 TTCTGCCCACCCCTTATGGTTGG - Intronic
969470024 4:7382160-7382182 CTTTGCCCTGCTCTGAGGGCTGG - Intronic
970077415 4:12239633-12239655 TTTGGCCCTCCTTTCATGGAAGG - Intergenic
972448337 4:39169506-39169528 TTTTCCCCTCCTCTTATCTCTGG + Intergenic
982196216 4:152917909-152917931 TTTTTTCCTCATTTTATGGCTGG - Intronic
983531728 4:168816611-168816633 AATTGCCCTCATCCTATGGCAGG - Intronic
984386844 4:179071697-179071719 TAATGCCTTCCTTTTATGGCAGG - Intergenic
985248020 4:187996231-187996253 TTTTCCTCTCCTCTTATCTCTGG + Intronic
985971946 5:3385028-3385050 TTTTGCTCTCCCCATTTGGCTGG - Intergenic
986224438 5:5800098-5800120 TTTTGCTCTCCTCATGGGGCAGG - Intergenic
987112633 5:14701634-14701656 TTTTGCCCTCCTCGTGTTGAGGG + Intergenic
996108923 5:119541883-119541905 TTTTTCCCTCCTCTCCTTGCAGG + Exonic
998102209 5:139443842-139443864 TTTTTCCCTCATCCTATGGGAGG - Intronic
1001034842 5:168290384-168290406 TTTTGCCCTCGGCATATGGCAGG - Intergenic
1005117317 6:22353187-22353209 TTTTGCCCTTGTCTCATGGGAGG + Intergenic
1005282070 6:24284766-24284788 TTCTGCCCTCCTCACATGCCAGG + Intronic
1010653331 6:78480434-78480456 TCTTGCCTTCCTCTTATGGAGGG - Intergenic
1012361169 6:98382393-98382415 CTTTGCCCTTCTATTATGGTTGG - Intergenic
1021759993 7:23894387-23894409 TTTTGTCATCCCCTTTTGGCCGG + Intergenic
1021982768 7:26070814-26070836 GTTTCCTCTCTTCTTATGGCTGG - Intergenic
1023173836 7:37416579-37416601 TGTGGCCCTCCTTTTAGGGCGGG - Intronic
1023470739 7:40515475-40515497 TTCTTCCCTCCCCTTATCGCTGG + Intronic
1033174880 7:139114640-139114662 TTTTTCCCTCCTCCTTTAGCTGG + Intergenic
1040981933 8:53252724-53252746 TTCTGCCCTCCGCTGATGGAGGG - Intergenic
1042099709 8:65261890-65261912 TTATGCTCTCCCCTTATGGAAGG + Intergenic
1043295662 8:78659609-78659631 TTTTGTTCTCCTCTGTTGGCTGG - Intergenic
1043869797 8:85419573-85419595 ATTTGCACTTCTCTGATGGCCGG + Intronic
1048465296 8:134660513-134660535 TGGTGGCCTCCTCTTGTGGCAGG - Intronic
1050044492 9:1528772-1528794 TTTTTTCCTCCTCTTTTAGCTGG + Intergenic
1051954711 9:22677892-22677914 TTTTGCCCTTCTCTGATGTTGGG - Intergenic
1053138652 9:35667982-35668004 TTTTACCTTCATCTTAAGGCTGG + Intronic
1053476581 9:38386245-38386267 CTTTCCCATCCTGTTATGGCTGG - Intergenic
1055609704 9:78009043-78009065 CTTTACCCTCCTCCTAAGGCAGG - Intronic
1056584678 9:87920306-87920328 TTTTGCCCACCTCACCTGGCGGG - Intergenic
1056612196 9:88132634-88132656 TTTTGCCCACCTCACCTGGCGGG + Intergenic
1058443663 9:105034079-105034101 TTTTATCCTCCTCTTTTGTCTGG + Intergenic
1059128782 9:111722085-111722107 TTTTGACCTCCTTTTTTGGGAGG + Intronic
1060984218 9:127810317-127810339 TCTGGCCCTCCTCTTAAGCCTGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1187094275 X:16129962-16129984 ATTTCCCCTTCTCTGATGGCTGG + Intronic
1188917865 X:35934599-35934621 CTTTTCCCTCCACTTATGTCAGG + Intronic
1198646817 X:138817134-138817156 ATTTGCCCTCCTATCATTGCAGG - Intronic
1199662386 X:150065031-150065053 TTTTGCCCTTCTCGTAAGGAGGG - Intergenic
1200046631 X:153406432-153406454 TTTTCCACTCCTCTTTTGGGAGG + Intergenic
1202628359 Y:56883338-56883360 TTATTCCCTCCTGCTATGGCAGG - Intergenic