ID: 1102491040

View in Genome Browser
Species Human (GRCh38)
Location 12:113289775-113289797
Sequence CCTCAAGAGCAGATCCTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102491035_1102491040 3 Left 1102491035 12:113289749-113289771 CCCTGGGACTGTGGCCTAGTGTC 0: 1
1: 0
2: 2
3: 10
4: 162
Right 1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 120
1102491030_1102491040 20 Left 1102491030 12:113289732-113289754 CCAGTAGGGAATTCCTTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 120
1102491034_1102491040 7 Left 1102491034 12:113289745-113289767 CCTTCCCTGGGACTGTGGCCTAG 0: 1
1: 0
2: 0
3: 19
4: 283
Right 1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 120
1102491028_1102491040 22 Left 1102491028 12:113289730-113289752 CCCCAGTAGGGAATTCCTTCCCT 0: 1
1: 0
2: 4
3: 21
4: 184
Right 1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 120
1102491036_1102491040 2 Left 1102491036 12:113289750-113289772 CCTGGGACTGTGGCCTAGTGTCC 0: 1
1: 0
2: 1
3: 5
4: 168
Right 1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 120
1102491029_1102491040 21 Left 1102491029 12:113289731-113289753 CCCAGTAGGGAATTCCTTCCCTG 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG 0: 1
1: 0
2: 0
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102491040 Original CRISPR CCTCAAGAGCAGATCCTAGA TGG Intronic
903578468 1:24353697-24353719 CATCAGGAGCAGCTTCTAGAGGG + Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
912459333 1:109820536-109820558 CCTAGAGAGCAGATCCTCTAAGG + Intergenic
913665283 1:121042645-121042667 TCTCAAGAGCAGAGCCTACCAGG + Intergenic
914016676 1:143825914-143825936 TCTCAAGAGCAGAGCCTACCAGG + Intergenic
914161110 1:145135097-145135119 TCTCAAGAGCAGAGCCTACCAGG - Intergenic
914655289 1:149734455-149734477 TCTCAAGAGCAGAGCCTACCAGG + Intergenic
915440504 1:155942677-155942699 CCTCAACCGCAGATCCCTGAAGG - Exonic
915569810 1:156738422-156738444 CCACAGGTGGAGATCCTAGAAGG - Exonic
916080707 1:161230230-161230252 CTTCTAGAGCAGGTTCTAGAAGG + Exonic
917105135 1:171484278-171484300 ACTATAGACCAGATCCTAGAAGG + Intergenic
920327760 1:205180027-205180049 CCTCAAGAGCTAACCCTGGAAGG + Intronic
921369170 1:214403930-214403952 CCTCCAGAGCAGATGTCAGAAGG + Intronic
924517087 1:244775158-244775180 CCTCAAGAGAAGTTCCTGAAAGG + Intergenic
1063957149 10:11277514-11277536 ACTCATGAGCAGCTCTTAGAGGG - Intronic
1068009453 10:51429707-51429729 GCTCAAGAGCAGCTTCAAGATGG + Intronic
1069160360 10:65084639-65084661 CCTCAGAAGCAGATTCTGGAGGG + Intergenic
1070462514 10:76684062-76684084 CCTCAAGGGCAGGCCCCAGAAGG + Intergenic
1075570391 10:123537603-123537625 TCCCAAGCGCAGATCCTGGAAGG - Intergenic
1076187772 10:128462287-128462309 CCTCAACACCAGTCCCTAGAGGG + Intergenic
1076583783 10:131532034-131532056 CTCCAAGAGCAGATCCTTGTAGG - Intergenic
1080722926 11:34867351-34867373 CCTCTGGAGCAGATGCTAGCTGG + Intronic
1090461128 11:126892409-126892431 CCTCCTGAGCATATCCTAAATGG - Intronic
1090872871 11:130763399-130763421 GCCCAAGAGCAGATTCCAGACGG - Intergenic
1092475796 12:8818096-8818118 CCTCATGAGCAGAGACCAGATGG - Intergenic
1095675958 12:44918230-44918252 CCTAAAGTACAGATCCTATATGG + Intronic
1096618594 12:52848485-52848507 CATCAAGAGCAGCTCCTCCAAGG + Intronic
1097718163 12:62989505-62989527 CCTCAATAGCAGATTTCAGATGG + Intergenic
1099191784 12:79568746-79568768 CCTCAATTGCAGATCTCAGAAGG + Intergenic
1100887235 12:99084792-99084814 CCTCAAGAGCAGATCTTCTTAGG - Intronic
1102491040 12:113289775-113289797 CCTCAAGAGCAGATCCTAGATGG + Intronic
1107398034 13:40038787-40038809 ACTCAAGAACAGTTCCAAGAAGG + Intergenic
1108140814 13:47419214-47419236 TTTCAGGAGCATATCCTAGAAGG - Intergenic
1115213139 14:30988261-30988283 CCTCATAAGCAAATCCTAAAAGG + Intronic
1117473695 14:56072614-56072636 CCACAAGAGCAGCTACAAGATGG + Intergenic
1119708971 14:76807557-76807579 CCTCAGGACCTGCTCCTAGAGGG - Intronic
1119883928 14:78124424-78124446 CCTCAAGACAAGATTCTATAAGG - Intergenic
1121868889 14:97389012-97389034 CTTCAAGAGCAGATTCTACATGG + Intergenic
1125896591 15:43307842-43307864 GCTCAGGAGCTGATCCTAGGTGG - Intergenic
1125957731 15:43802009-43802031 CCTCATGTGCAGATGCTAGGTGG + Exonic
1126333512 15:47560447-47560469 GCTCAAGAGCAGATTTGAGATGG + Intronic
1131058051 15:89387809-89387831 ACTCCAGAGCATGTCCTAGATGG - Intergenic
1132999033 16:2839996-2840018 CCTCAGCAGCAGATTCTCGAAGG - Intergenic
1134843841 16:17423428-17423450 CCTCAAGGGCACTTCCTTGAGGG + Intronic
1140729532 16:77843606-77843628 CCTCAAGAGCAGCAGCTAAAAGG + Intronic
1143939653 17:10526886-10526908 CCTCATGAGCTGATTCTACATGG - Intronic
1151294100 17:73171106-73171128 CCCCAAGGGCAGAGGCTAGAAGG - Intergenic
1156742540 18:40349751-40349773 CCTGAAGAGAAGATTCAAGAGGG + Intergenic
1157464745 18:47933256-47933278 CCTCAATTGTAGATCCTGGAAGG - Intergenic
1157805317 18:50653583-50653605 CCTCAAGATCACACCCTAGAAGG - Intronic
1158216515 18:55105561-55105583 CCTCAAGAGCAGATTCCTCATGG + Intergenic
1164044448 19:21523912-21523934 CCTTATGTGCAGATCCTAGATGG - Intronic
1166433167 19:42743182-42743204 CCTCAATATCAGACCCTGGATGG - Intronic
1167620157 19:50556140-50556162 CCTCATCAGCAGCTCCTAGGGGG - Intronic
925209318 2:2033219-2033241 CGCCCAGAGCAGATTCTAGATGG + Intronic
927883290 2:26703914-26703936 ACTCGTGAGCAGATCCTGGAGGG + Intronic
928061130 2:28114474-28114496 CTTCAATAGGAGATCCTACAAGG - Intronic
928611004 2:32992767-32992789 CCTCAGGAGGAGATCCTGCAGGG + Intronic
928841890 2:35617745-35617767 CATCAAAAGCAGTTCCAAGAGGG - Intergenic
930541262 2:52709901-52709923 ACTCAAGAGAAGATTCTAAAGGG + Intergenic
934694226 2:96387413-96387435 GCTCAAGAGCAGATTGAAGATGG - Intergenic
936395343 2:112123308-112123330 GCTCAAGAGCAGATCTGAGCAGG + Intergenic
940982059 2:160014761-160014783 AGTTCAGAGCAGATCCTAGATGG - Intronic
942076457 2:172360730-172360752 ACTCAAGAAAAGATCCTAGGTGG - Intergenic
942830217 2:180231280-180231302 TCTCAAGAGCAGAATCTACAAGG + Intergenic
948619466 2:239225428-239225450 CCACAAGAGCAGATCCACGAAGG + Intronic
1173845832 20:46187939-46187961 TCTCAAGACCTGATCCTAAAAGG + Intronic
1175428161 20:58883595-58883617 ACTCAACAGCAGAGCCCAGATGG - Intronic
1180639463 22:17286774-17286796 CCTGAAGAGCAGATCGCAGGTGG + Intergenic
1182970848 22:34575085-34575107 CCTCAAAAGCAGTTCTTGGAGGG - Intergenic
952399890 3:32953667-32953689 CACGAAGAGCAGATCCGAGATGG - Exonic
954332822 3:49899942-49899964 CCTCAAGAGGAGAGCCCAGTTGG + Intronic
954882961 3:53847894-53847916 CATCAAAAGGAGATCTTAGAAGG + Intronic
955561887 3:60200355-60200377 CCACAAGAGCAAATCCAACATGG - Intronic
958468773 3:94492495-94492517 CCCCAAAAGCAGTGCCTAGAGGG + Intergenic
959869994 3:111315531-111315553 CTTCATGAGCAAATCATAGAAGG + Intronic
961009359 3:123425603-123425625 CCTCTAGAGCAGTCCCCAGAAGG + Intronic
961425888 3:126847583-126847605 ACTCAAGAGGAGATCCCACAGGG + Intronic
963888859 3:150611629-150611651 CCAGAAGAGCATATCCCAGAAGG - Intronic
964767382 3:160191978-160192000 ACTCAGGAGCAGAGCATAGATGG + Intergenic
967665098 3:192162174-192162196 TCTTAATAGCAGATCATAGAAGG + Intronic
968920655 4:3520832-3520854 CCACGTGGGCAGATCCTAGAGGG - Intronic
973569773 4:52226206-52226228 CCTAAAGAGAAGATCCTCAACGG - Intergenic
977557132 4:98497743-98497765 CCTCAGGAGCTGAGTCTAGAGGG + Intronic
984570930 4:181392560-181392582 CCTCAAAAACAGATGCTAAATGG + Intergenic
987138675 5:14922813-14922835 CCTCAACAGTAGAACCCAGAAGG + Intergenic
990347616 5:54884943-54884965 CCAGAGGAGCAGATTCTAGAAGG - Intergenic
995164325 5:109021120-109021142 CCTCATGATCAGATCCAAAAAGG + Intronic
996475476 5:123914921-123914943 CCTCAACAGCAGATGGGAGATGG + Intergenic
999202168 5:149824306-149824328 CTCAAAGAGCAGATTCTAGAGGG - Intronic
1000983035 5:167837319-167837341 CCTCAAGAAAACATCCTACAAGG + Intronic
1002690968 5:181050316-181050338 GCTCAAGAGGAGATTCTGGATGG - Exonic
1004504751 6:16238762-16238784 CCTCAAGAGCCGAGCCGAGGTGG + Exonic
1004595106 6:17092308-17092330 CCTCAAGAACAAAAACTAGATGG + Intergenic
1007245047 6:40455441-40455463 CTTCAAGAGCAGACCCTTAAGGG + Intronic
1008690279 6:53971264-53971286 CCTCTCAAGCAGATCCTAAATGG + Intronic
1012990757 6:105923341-105923363 CATCAAGAGCAGAAACTAGCAGG + Intergenic
1014207214 6:118669275-118669297 CCTCAAAAGCAGATCTGAGTTGG - Intronic
1016519837 6:144934603-144934625 ACTCAAGAGCAGATTTGAGATGG + Intergenic
1017405473 6:154114250-154114272 ACTCAAAAGTTGATCCTAGACGG - Intronic
1018164948 6:161084669-161084691 CCTCATGGTGAGATCCTAGAAGG + Intronic
1018928247 6:168222054-168222076 CATCAAGTGCAGGCCCTAGAGGG - Intergenic
1019736559 7:2652787-2652809 CCTGCAGAGCAGAGCCTTGATGG + Intronic
1019885274 7:3899174-3899196 CCTCAACAGCAGATCAGGGAGGG - Intronic
1021903361 7:25309824-25309846 TCTCAAGGGTAGATCATAGAGGG - Intergenic
1022585968 7:31612112-31612134 CCTCAACATCAGATCTGAGATGG - Intronic
1033511854 7:142067251-142067273 CCTCAAGTTCAGATCCAAGTCGG - Intronic
1033514926 7:142096241-142096263 CCTCAAGTTCAGATCCAAGTCGG - Intronic
1033598367 7:142872026-142872048 CTTGAAGAACAGATCCAAGAAGG + Intronic
1034324290 7:150216639-150216661 CCTCAGGAGCAGGTCCCAGAGGG - Intergenic
1034768903 7:153752592-153752614 CCTCAGGAGCAGGTCCCAGAGGG + Intergenic
1035577741 8:718841-718863 CCACACGAGCAGATTCGAGAGGG + Intronic
1035938985 8:3875083-3875105 CCTGGGGACCAGATCCTAGAGGG + Intronic
1036084615 8:5599936-5599958 TCCCAAGGGCAGATCCTAGCTGG - Intergenic
1036137981 8:6179792-6179814 GCTCAGAAGCAGATCCTTGAGGG - Intergenic
1036182553 8:6597832-6597854 CCTCATAAGCACATCCTAGGTGG + Intronic
1037293450 8:17375275-17375297 CCTCTAGAGCTACTCCTAGAGGG - Intronic
1049078876 8:140425173-140425195 CCCCAAGAGCAGAGGCCAGAAGG + Intronic
1052225559 9:26080992-26081014 ACTCAAGAACAGATCCTAACTGG + Intergenic
1056560464 9:87725532-87725554 CGTCAAGACCAGACCCTAGGAGG - Exonic
1058812673 9:108656504-108656526 CCTCAAGAGCATAGACAAGAAGG + Intergenic
1061305839 9:129732835-129732857 CCTCAAGTGCACATCCTAGGGGG + Intergenic
1061842543 9:133367695-133367717 CCTCTGGGGCAGATCCTATAGGG + Intronic
1186274273 X:7922913-7922935 CTCCAAGAGCAGGTCATAGAGGG + Intronic
1187168141 X:16824108-16824130 CCTGAAGTGCAGATGCTACAGGG - Intronic
1194975468 X:100392055-100392077 CCTCAAGAGGAGATCATGGAAGG - Intronic
1195813872 X:108864062-108864084 CCTCAAGAACAGCAGCTAGATGG - Intergenic
1196707540 X:118728534-118728556 CCTTAGGAGCAGCTCCTGGAAGG + Intronic
1200107620 X:153723889-153723911 CCGCAAGAGCGACTCCTAGAGGG + Exonic