ID: 1102493824

View in Genome Browser
Species Human (GRCh38)
Location 12:113305601-113305623
Sequence ATCAGCCCTCCGGCCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102493819_1102493824 26 Left 1102493819 12:113305552-113305574 CCAGGCTGGCTATATCCGTCTTT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG 0: 1
1: 0
2: 0
3: 6
4: 60
1102493818_1102493824 27 Left 1102493818 12:113305551-113305573 CCCAGGCTGGCTATATCCGTCTT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG 0: 1
1: 0
2: 0
3: 6
4: 60
1102493822_1102493824 -7 Left 1102493822 12:113305585-113305607 CCAAAAGTTGGCAAACATCAGCC 0: 1
1: 0
2: 1
3: 21
4: 141
Right 1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG 0: 1
1: 0
2: 0
3: 6
4: 60
1102493820_1102493824 11 Left 1102493820 12:113305567-113305589 CCGTCTTTTCTATATAGACCAAA 0: 1
1: 0
2: 0
3: 29
4: 516
Right 1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG 0: 1
1: 0
2: 0
3: 6
4: 60
1102493817_1102493824 28 Left 1102493817 12:113305550-113305572 CCCCAGGCTGGCTATATCCGTCT 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102493824 Original CRISPR ATCAGCCCTCCGGCCAAATT TGG Intronic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
911061133 1:93748833-93748855 CTCAGCCCTCCAGCTAGATTGGG + Intronic
921558367 1:216626631-216626653 AGCAACCCTCCCGCCACATTTGG + Intronic
1064217151 10:13410010-13410032 AACAGCCCTCCAGGCAAATCCGG - Intergenic
1071815181 10:89225117-89225139 ACTAGCCCTATGGCCAAATTAGG - Exonic
1072466099 10:95663720-95663742 ATCAGCCCTCAGGCACAGTTGGG - Exonic
1074434074 10:113418752-113418774 ATTACCCCTCCAGCCAAACTTGG - Intergenic
1077499532 11:2902905-2902927 ATCAGCCCTCTGGCCACAGAAGG + Intronic
1086444754 11:86860719-86860741 GTCAAACCACCGGCCAAATTTGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1094526698 12:31235837-31235859 ATGAGCCCTTGGCCCAAATTTGG + Intergenic
1095108339 12:38261614-38261636 AACAGCCCTGCTGCCAAAGTGGG - Intergenic
1097309452 12:58102482-58102504 ATCATCCCTTTGGCCAAACTTGG + Intergenic
1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG + Intronic
1103045783 12:117733441-117733463 TTCAGCCCACAGGCCAAATCTGG + Intronic
1114193089 14:20455360-20455382 ATCTGCCCTCCAGCCAATTGAGG - Exonic
1120976592 14:90254249-90254271 ATGAGCCCTCCGTCCACGTTTGG + Intergenic
1123919902 15:25062883-25062905 TTCAGCCCTCCTGCCAATGTTGG + Intergenic
1124559067 15:30755433-30755455 TTCAGCCCTCCAGCCAGCTTGGG + Intronic
1124672192 15:31650292-31650314 TTCAGCCCTCCAGCCAGCTTGGG - Intronic
1130832600 15:87616738-87616760 ATCAGCCCTCCAGACAGACTTGG - Intergenic
1132406580 15:101545009-101545031 AGCAGCTCTAGGGCCAAATTTGG - Intergenic
1137330515 16:47490754-47490776 ATCTGCCCTTTGGCAAAATTTGG - Intronic
1143362374 17:6382559-6382581 ATCCAGCCTCCGGCCACATTGGG + Intergenic
1149583751 17:57770197-57770219 ATCACCTCACCGGCCAAATCTGG - Intergenic
1151266051 17:72955956-72955978 ATCAGCCCTGCGACCACATGAGG + Intronic
1160109570 18:76013337-76013359 ATCAGCCCCACACCCAAATTTGG + Intergenic
1168258437 19:55179686-55179708 ACCCGCCCTCCAGCAAAATTGGG - Intronic
931931154 2:67135484-67135506 ATCAGGCCTCCAGCCAATTGTGG - Intergenic
931988408 2:67764131-67764153 CTCAACCCTCCACCCAAATTGGG + Intergenic
937343563 2:121108073-121108095 GTTAGCCCACAGGCCAAATTTGG + Intergenic
940090219 2:149907162-149907184 CTCAGGACTCCAGCCAAATTAGG - Intergenic
940305720 2:152224128-152224150 ATCAGGACTCAGGCCATATTTGG - Intergenic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1173150678 20:40564172-40564194 ACCAGCCCTTGGGCCAAATCTGG - Intergenic
1181914009 22:26264760-26264782 TACAGCCCACTGGCCAAATTTGG - Intronic
1184741649 22:46432041-46432063 ATCTGCCCTCCTCCCAAATGAGG + Intronic
949168995 3:976245-976267 TTCAGCCCTAGGGCCAAATTTGG - Intergenic
949680044 3:6503094-6503116 ATCAGCCCAGCGGCTACATTAGG - Intergenic
953409340 3:42681131-42681153 ATCAGCCCTTCGCCAAAATATGG + Intergenic
958731565 3:97965535-97965557 TTCAGCCCTCAGGCCAGACTAGG - Intronic
960975435 3:123169536-123169558 CTCAGCCCTCCTGCTAAAATGGG - Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966005986 3:175012613-175012635 TACAGCCCTCAGGCCAAATCTGG + Intronic
970074072 4:12197352-12197374 AGCAAACCTCTGGCCAAATTAGG + Intergenic
973811849 4:54578670-54578692 TTCAGCCCTGGGGCCAAATTAGG + Intergenic
981124921 4:141094621-141094643 AACAGGCCTCAGGCCAGATTTGG + Intronic
988555576 5:32233124-32233146 GCCACCCCTCCGGCCAAATCTGG + Intronic
1000618317 5:163455077-163455099 TACAGCCCTTGGGCCAAATTTGG - Intronic
1002671308 5:180869925-180869947 ACCAACTCTCCGTCCAAATTAGG - Intergenic
1008139870 6:47819984-47820006 TACAGCCCTCTGGCCAAATCTGG + Intronic
1011552394 6:88541739-88541761 CTCATCCCTCCAGCCAAATAAGG - Intergenic
1011918395 6:92539903-92539925 CTCTGCCCTCCAGCCAGATTGGG - Intergenic
1017830451 6:158123342-158123364 ATAAGCCCTCCAGCCATGTTTGG - Intronic
1020790962 7:12627768-12627790 CTCAGCCCTCCTGGCAAACTTGG + Intronic
1022656502 7:32323998-32324020 ATCAGCCCATGGGCCAAATCTGG + Intergenic
1038896432 8:31787996-31788018 CTCAACCCTCTGGCAAAATTGGG - Intronic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1055862998 9:80776183-80776205 AACAGCCCACAGGCCAAATCTGG - Intergenic
1056128011 9:83555387-83555409 AGCAGCAGTCTGGCCAAATTTGG + Intergenic
1057613795 9:96570137-96570159 ATCAGACCTACAGACAAATTAGG - Intronic
1187905195 X:24059241-24059263 GTCAGCCCTTAGGCCAAATCTGG - Intronic
1188269632 X:28122864-28122886 AGCAGCACTCCAGCCAAATGAGG - Intergenic
1193800989 X:85935798-85935820 CTCTGCCCTCCCTCCAAATTAGG - Intronic
1195645128 X:107222029-107222051 ATCATTCCTCCCTCCAAATTTGG - Intronic
1198373544 X:136015082-136015104 TCCAGCCCTCCGGCCACATCCGG + Intronic