ID: 1102495649

View in Genome Browser
Species Human (GRCh38)
Location 12:113317072-113317094
Sequence GTTTAGGGGTGCAAGTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102495640_1102495649 16 Left 1102495640 12:113317033-113317055 CCCAGACCATTTTCGAGGGGGCA 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1102495649 12:113317072-113317094 GTTTAGGGGTGCAAGTGTTCAGG 0: 1
1: 0
2: 1
3: 6
4: 113
1102495642_1102495649 10 Left 1102495642 12:113317039-113317061 CCATTTTCGAGGGGGCACACTGG 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1102495649 12:113317072-113317094 GTTTAGGGGTGCAAGTGTTCAGG 0: 1
1: 0
2: 1
3: 6
4: 113
1102495641_1102495649 15 Left 1102495641 12:113317034-113317056 CCAGACCATTTTCGAGGGGGCAC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1102495649 12:113317072-113317094 GTTTAGGGGTGCAAGTGTTCAGG 0: 1
1: 0
2: 1
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102495649 Original CRISPR GTTTAGGGGTGCAAGTGTTC AGG Intronic
900582085 1:3414351-3414373 GTCTAGGGGTGCAGGTGGGCTGG + Intronic
904529625 1:31159873-31159895 GTTTAGCTGTGCAAGGGCTCAGG - Intergenic
907968799 1:59360479-59360501 GTTTTGGGGTTCAAGTGGCCAGG + Intronic
910084791 1:83387306-83387328 GTTTTGTGGTGTCAGTGTTCTGG - Intergenic
910899448 1:92104011-92104033 ATTTAGGTGTGCATGTGTGCAGG + Intronic
911658415 1:100472089-100472111 GTGTAGGAGTGTAAGTATTCTGG - Intronic
915751472 1:158214228-158214250 TTTAAGGGGTGAAAGTGTTACGG - Intergenic
916653826 1:166855119-166855141 GTTCAGAGGTACAAGTGTGCAGG - Intronic
921422440 1:214964061-214964083 ATTTTGGGGTGGAAGTGTTTAGG + Intergenic
922066812 1:222152178-222152200 GATTGGGGGTGCATGTGTTTGGG + Intergenic
923030799 1:230247705-230247727 GTGTGGGGGTGCAGGTCTTCTGG + Intronic
924258085 1:242202481-242202503 TTTTAGGGCTGAAAGTGGTCTGG - Intronic
1064048686 10:12042430-12042452 GTGGAGGGGCGAAAGTGTTCGGG - Intronic
1071751804 10:88487298-88487320 GTTCAGGGGTGCATGTGTCATGG - Intronic
1072688465 10:97553549-97553571 GTATAGGGCTGCAAATGTTTGGG + Intronic
1082734462 11:56840459-56840481 GTGTGGGGGTTCCAGTGTTCAGG - Intergenic
1082752159 11:57031031-57031053 GGTTAGGGGTGGAATTGTTCTGG - Intergenic
1085594456 11:77795933-77795955 GTTTAGAGGTGTATGTGTCCAGG + Intronic
1088720736 11:112589936-112589958 GTTTCTGTGTGGAAGTGTTCTGG - Intergenic
1089547048 11:119236164-119236186 GTTGGGGGGTGAAAATGTTCTGG - Intronic
1090544163 11:127744491-127744513 GTTTAGTGTTGTCAGTGTTCTGG + Intergenic
1094562495 12:31568738-31568760 GTTTTTGGGGGCATGTGTTCAGG - Intronic
1095379867 12:41577886-41577908 GTTTAGGAGGGCAAGTGTTGTGG - Intergenic
1097744403 12:63285493-63285515 GTTTTGGGGTGCATCTGTGCAGG + Intergenic
1102495649 12:113317072-113317094 GTTTAGGGGTGCAAGTGTTCAGG + Intronic
1106037415 13:26056598-26056620 CTTTTGGGGTGAAAATGTTCTGG + Intergenic
1108248056 13:48536911-48536933 GGTTAGGGATGGAAGTGTTAGGG + Intergenic
1109285427 13:60403089-60403111 GTTAAACTGTGCAAGTGTTCAGG + Intronic
1109829735 13:67771335-67771357 GCTCAGGTTTGCAAGTGTTCTGG + Intergenic
1116054018 14:39840280-39840302 GATTAGAGGTGCAAGAGATCTGG - Intergenic
1126055582 15:44726856-44726878 GTTTGGGGTTGCATGTGTTATGG - Intergenic
1129035215 15:72644990-72645012 GTGTAGTGGTGAGAGTGTTCTGG - Intergenic
1129118491 15:73380023-73380045 GTCTCTGGGTGCAAGGGTTCAGG - Intergenic
1129214669 15:74092226-74092248 GTGTAGTGGTGAGAGTGTTCTGG + Intergenic
1140880276 16:79191908-79191930 GTTTAAGGGAGCAAGAGATCAGG + Intronic
1141054221 16:80802341-80802363 GTTTAGGGGTGAAAGTGATCTGG - Intronic
1141335531 16:83151515-83151537 TTTTAGGGGTTCAGTTGTTCTGG - Intronic
1143722825 17:8824831-8824853 ATTTAGGGGTGCACATTTTCTGG - Intronic
1149421762 17:56518618-56518640 GGTAAGTGGTGCAAGTTTTCAGG - Intergenic
1157154790 18:45255012-45255034 GGGTAGGGGAGCAAGTGTGCTGG - Intronic
1157902807 18:51536436-51536458 ATTTTGGGGAGCAAGTGTTGAGG + Intergenic
1158251612 18:55494622-55494644 GTTTAAGGATGCAAGTCATCAGG + Intronic
1158340823 18:56464491-56464513 CTTTAGGGCTCCAAGTGTGCAGG - Intergenic
1159492780 18:69159912-69159934 ATTTAGGGGTGCAAATGATGAGG - Intergenic
1163122827 19:15228151-15228173 GTGTAGGGGTGCAGGTGTATGGG - Intronic
1163544887 19:17935341-17935363 TTTGGGGGGTGCAAGTGTTCTGG + Intronic
1165068344 19:33241511-33241533 GTTGGGGGGTGCATGTGGTCCGG + Intergenic
1165282285 19:34807609-34807631 GTTTAGGGGTGAAGATGGTCAGG - Intergenic
1165809067 19:38599866-38599888 GTTAAGGGGTCCAAGGGTTCGGG - Intronic
928756429 2:34531280-34531302 GTACAGTGGTGGAAGTGTTCAGG - Intergenic
933063385 2:77767290-77767312 GTGAAGGGGTGCAAGTGGTGGGG + Intergenic
937353085 2:121179643-121179665 CTTTCCGGGTTCAAGTGTTCAGG - Intergenic
937657528 2:124393659-124393681 GTTTTGGGGTGCAGGAGATCTGG - Intronic
938450132 2:131411153-131411175 GTTTAGGGGTACAAATGTGCAGG - Intergenic
941140969 2:161781594-161781616 GTTTAGTGCTGCTAGTGTTTAGG + Intronic
944457860 2:199914207-199914229 GTTGAGGGGTGTCAGTGTACAGG - Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
1169316947 20:4600619-4600641 GTCTAGGGGTGCAATTGTCAAGG + Intergenic
1169886132 20:10399901-10399923 GTTTCTGGGTCCAAGTGTACTGG - Intergenic
1171012927 20:21518259-21518281 GTTGAGGGGTCCAGCTGTTCAGG - Intergenic
1172207641 20:33175646-33175668 GCCTAGTGGTGAAAGTGTTCAGG + Intronic
1175842953 20:62042042-62042064 ATTTAGGGCTGCAGGTGTCCAGG - Intronic
1176026118 20:62986465-62986487 GGGTAGGGGTGCAGGTGTGCAGG + Intergenic
1176958989 21:15138677-15138699 GATTAGGGCTGCACCTGTTCAGG - Intergenic
1177163008 21:17569407-17569429 GTTTAGTAGTGTAAATGTTCTGG + Exonic
1178012978 21:28307882-28307904 TTTTGGGGGTCCAAGTGTTAAGG - Intergenic
1179998353 21:44984276-44984298 GTGGAGGGGTGCAAGTGTGGGGG - Intergenic
1180845499 22:18979049-18979071 GTCAAGGGGTGCAAGTGGTGGGG - Intergenic
1182727558 22:32460143-32460165 GATTAGGGATGGAAGTGTCCAGG + Intronic
1185344206 22:50304320-50304342 GGTGCGGGGTGCCAGTGTTCAGG + Intronic
953008499 3:39000638-39000660 ATTTTGGGGTGCAACTGTTACGG + Intergenic
965379848 3:167974861-167974883 GTTGAAAGGTGCAAGTGTTAGGG + Intergenic
965483088 3:169244293-169244315 GTTTACTGCTGCAAATGTTCTGG + Intronic
965635487 3:170776187-170776209 GATAAGGTGTGCAACTGTTCTGG + Intronic
967972552 3:195010283-195010305 GTTTAGGGGTGTATGTGTGTAGG - Intergenic
968030268 3:195477773-195477795 ATTTAGTGTTGTAAGTGTTCTGG - Intergenic
969932358 4:10643063-10643085 GTTTCAGGATGTAAGTGTTCTGG + Intronic
970347634 4:15169031-15169053 GTTTAGGAGTGAAAGTGTGGAGG - Intergenic
970943285 4:21660917-21660939 ATTTAGGGCTGCAAGTTTCCAGG - Intronic
976696911 4:87926717-87926739 TTTTTAGGTTGCAAGTGTTCTGG + Intergenic
976890451 4:90039979-90040001 ATTTAGGGCTGCAGGTCTTCAGG + Intergenic
978047391 4:104147458-104147480 ATTTAGGGTTGTCAGTGTTCTGG + Intergenic
983411770 4:167408178-167408200 TTTTAGGAGTCCAAGAGTTCAGG + Intergenic
983641202 4:169945381-169945403 GTTTAGGGGTGAAGGTGGTGGGG + Intergenic
986789089 5:11143258-11143280 GTACAGGGGTGCAAGTGTATAGG - Intronic
989541969 5:42628287-42628309 ATTTAGGGCTGCAGGTCTTCAGG + Intronic
989542244 5:42630966-42630988 ATTTAGGGCTGCAGGTCTTCAGG + Intronic
992295737 5:75324768-75324790 CTTTAAGGGTGCCAGAGTTCTGG + Intergenic
994736549 5:103562904-103562926 GATTGGGGGTGGAAGTGTTTGGG + Intergenic
997531475 5:134584077-134584099 GTCTAGGGGTGAAGGGGTTCAGG + Intergenic
1001874117 5:175184572-175184594 GATTGGGGGTGCAAATATTCAGG - Intergenic
1002624787 5:180518385-180518407 GTTTAGGAGTGCCATTATTCCGG + Intronic
1006428235 6:33979384-33979406 ATTTAGGGGTGGCGGTGTTCTGG - Intergenic
1013760888 6:113516167-113516189 ATTTAGAGGTACAAGTGTTCTGG - Intergenic
1018242170 6:161788350-161788372 GTTTAGAGGTCCAAGTCTTGGGG + Intronic
1019958667 7:4437650-4437672 TCTTTGGGGTGCAAGTGTACTGG - Intergenic
1021733394 7:23618985-23619007 GTATAGGCCTGTAAGTGTTCTGG + Intronic
1024346517 7:48319952-48319974 TGTGAGGGGTACAAGTGTTCAGG - Intronic
1024490557 7:49977397-49977419 GTTCAGGGATGCAAGTCTTTAGG + Intronic
1026507250 7:70995467-70995489 TTTCAGGAGTGCAAGGGTTCAGG + Intergenic
1027301611 7:76843416-76843438 GTTTTGTGGTGTCAGTGTTCTGG - Intergenic
1027802697 7:82775396-82775418 ATTTGGTGGTGCCAGTGTTCTGG + Intronic
1028088931 7:86673064-86673086 GTTTAGGGCTCCAGGTGATCTGG + Intronic
1030059062 7:105608669-105608691 ATGAAGGGCTGCAAGTGTTCTGG + Intronic
1031639964 7:124150546-124150568 GTATAGGGGTAGAGGTGTTCTGG - Intergenic
1032826240 7:135571385-135571407 GTTTAGGGGTACATGTCATCAGG - Intronic
1034112635 7:148553039-148553061 GATTAAGGGTGGAAGTGGTCCGG - Intergenic
1035891585 8:3349533-3349555 CTCTCGGGGTGCAAGTGTTGAGG + Intronic
1038228108 8:25675247-25675269 GGTTAGGTGTCCAAGTGTTTAGG + Intergenic
1044206441 8:89496708-89496730 CTTTAGGTTTGTAAGTGTTCTGG - Intergenic
1044250498 8:90000060-90000082 ATTTAAGAGGGCAAGTGTTCTGG + Intronic
1050934714 9:11380471-11380493 GTTTAGGGCTGCAGGTATCCAGG + Intergenic
1052133141 9:24875445-24875467 ATTTAGTGTTGTAAGTGTTCTGG + Intergenic
1056561530 9:87734062-87734084 GCTGAAGGGAGCAAGTGTTCTGG - Intergenic
1058587480 9:106525737-106525759 CTTTAGGGGTACAAGTGGTTTGG - Intergenic
1062235821 9:135507090-135507112 GGCTGGGGGTGCAAGTGTGCAGG + Intergenic
1185612377 X:1400422-1400444 GTGTAGAGGTGTGAGTGTTCAGG - Intergenic
1190616383 X:52237234-52237256 GTTTAGTAGTGTAAATGTTCTGG - Intergenic
1197893559 X:131288536-131288558 GTTTAGGGGTCCAAGTGGCAAGG - Intronic
1200079093 X:153566719-153566741 GTGCAGGGGTGCAGGTGTGCAGG - Intronic
1201322656 Y:12717325-12717347 GTTGAGGGGTGGGAGGGTTCAGG - Intronic