ID: 1102498828

View in Genome Browser
Species Human (GRCh38)
Location 12:113337393-113337415
Sequence AGGCTCTAAGTGTTTATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102498828_1102498830 4 Left 1102498828 12:113337393-113337415 CCTTCTATAAACACTTAGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1102498830 12:113337420-113337442 TTGAGCCTCAGTTTCCCCCTTGG 0: 1
1: 4
2: 41
3: 219
4: 757
1102498828_1102498833 13 Left 1102498828 12:113337393-113337415 CCTTCTATAAACACTTAGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1102498833 12:113337429-113337451 AGTTTCCCCCTTGGTGAAATGGG 0: 1
1: 3
2: 36
3: 231
4: 1432
1102498828_1102498832 12 Left 1102498828 12:113337393-113337415 CCTTCTATAAACACTTAGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1102498832 12:113337428-113337450 CAGTTTCCCCCTTGGTGAAATGG 0: 1
1: 2
2: 39
3: 289
4: 1771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102498828 Original CRISPR AGGCTCTAAGTGTTTATAGA AGG (reversed) Intronic
902744487 1:18464329-18464351 AGGATCTAAGTGCTCAGAGATGG + Intergenic
903818591 1:26083406-26083428 AGTCACTGAGTATTTATAGATGG - Intergenic
905451761 1:38061612-38061634 AGGCACTAAATGTTTGTTGAAGG - Intergenic
907098027 1:51799657-51799679 AGGCTCTACCTGCTAATAGAGGG + Intronic
908662463 1:66451925-66451947 AGGCTGTCAGTCTTTATAGCAGG - Intergenic
909288344 1:73849925-73849947 ATGTTCTAAGGCTTTATAGATGG - Intergenic
911886553 1:103308174-103308196 AGGATCTAAGTGTTTACATTTGG + Intergenic
913426942 1:118742661-118742683 AGCCTTTAAGTGTTTAGAAAAGG - Intergenic
914410326 1:147421193-147421215 AGTCCCCAAGTGTTTATAGATGG - Intergenic
915972767 1:160366179-160366201 AGGCTCTGAGTGTGTTTTGAGGG - Intergenic
917505283 1:175621760-175621782 AGTTTCTAAGTGCTTAGAGAAGG - Intronic
917709107 1:177666328-177666350 AAACTCTCAGTGTTTACAGAGGG - Intergenic
919134835 1:193494616-193494638 AGGCCCTAATTGTTTATATCTGG - Intergenic
922644036 1:227267039-227267061 AAGCTTTAAATGTCTATAGAAGG + Intronic
924673938 1:246156543-246156565 AGGCTTTTAATGTTTATTGAAGG - Intronic
1064338663 10:14467318-14467340 AGGCTATAAGTGAATATAGAAGG + Intergenic
1072701537 10:97645309-97645331 AGGCTATAAGAGTTGGTAGATGG + Intronic
1073779142 10:106817939-106817961 AGGCTTTAAGAGTTTAGAGAGGG - Intronic
1074423143 10:113327121-113327143 ATGCTCAAAGAGTTTACAGATGG + Intergenic
1074911057 10:117909433-117909455 AGGCTTTAAGAGTCTATAAATGG + Intergenic
1079521968 11:21338935-21338957 TGGCTCTTAATGTTTATAGGTGG - Intronic
1080038511 11:27734311-27734333 ATGATCTCAGTGTTTATAGGAGG + Intergenic
1083088481 11:60175384-60175406 TGGCTGTAAGTATTTTTAGATGG - Exonic
1085126376 11:74005321-74005343 AGGCTCTAGGTGTGTGGAGACGG - Intronic
1085802485 11:79603253-79603275 AGGTTCTGAGTGTTCACAGAAGG - Intergenic
1086199847 11:84188865-84188887 AGGCTCTGGGTGATTATTGAGGG - Intronic
1086839099 11:91663113-91663135 TGAATCTAAATGTTTATAGATGG + Intergenic
1089639466 11:119838169-119838191 AGGATCTAACTGTTTATAGGAGG + Intergenic
1091535733 12:1407238-1407260 AGACTCGAATTGTTTATTGATGG + Intronic
1093744435 12:22723623-22723645 AGTGTCTAAGTGGGTATAGAAGG - Intergenic
1097651967 12:62310013-62310035 AGACTGTCAGTGTTTTTAGAAGG + Intronic
1098459473 12:70716169-70716191 AGCTTCTAAGTGTTTATAACAGG + Intronic
1099225261 12:79961425-79961447 GAGCTTTAAGTGTTTTTAGATGG + Intergenic
1102498828 12:113337393-113337415 AGGCTCTAAGTGTTTATAGAAGG - Intronic
1107008627 13:35644480-35644502 AGCCTTTAAATGTTTATTGAAGG - Intronic
1107307118 13:39034656-39034678 AGGCTCTCAGTATTTCTATAGGG + Intronic
1109738513 13:66519485-66519507 AAGCTCTAAGTGTTTACCCAAGG - Intronic
1111084692 13:83359777-83359799 AGACTCAAAATGTTTATGGAAGG + Intergenic
1111696219 13:91627560-91627582 AGACTCTAAATCTCTATAGATGG + Intronic
1112264424 13:97909949-97909971 AGACTCTAGATTTTTATAGATGG - Intergenic
1117014667 14:51506416-51506438 AGGCTCCAAGAGATTACAGAAGG + Intronic
1120412297 14:84173073-84173095 AGGCAGTAAGTGATTTTAGATGG - Intergenic
1122037909 14:98961809-98961831 AGGCTCTCAGTGATTCTAGGAGG + Intergenic
1124138763 15:27058675-27058697 AATCTCTAATTGTTTAAAGATGG - Intronic
1126619670 15:50624610-50624632 ATGCTCTCAGTGTTTAGGGAAGG + Intronic
1130241554 15:82198052-82198074 AGCCTGTAACTGTTTATAAAGGG - Intronic
1131390720 15:92045982-92046004 AAGCTCTAAGTGTTAATGAAGGG + Intronic
1134394304 16:13848961-13848983 AGGGTCTCAGTGTCTCTAGAGGG + Intergenic
1134901171 16:17939376-17939398 AGGCTCTGAGTTTGAATAGAGGG - Intergenic
1139656701 16:68391830-68391852 AGGCTCTAAGGAAGTATAGATGG + Intronic
1140611742 16:76608067-76608089 ATGCTTGAAGTGTTTCTAGAGGG - Intronic
1142050975 16:87958012-87958034 ACACCCTAAGTGTTTTTAGAAGG + Intronic
1144483571 17:15646877-15646899 AGGCTGTAAGTATTTTGAGAGGG - Intronic
1144915114 17:18718148-18718170 AGGCTGTAAGTATTTTGAGAGGG + Intronic
1149169310 17:53791431-53791453 AGGCTCTGAGTTATTTTAGAAGG + Intergenic
1150739709 17:67769560-67769582 AGCCTCTTAGTGGCTATAGAAGG - Intergenic
1156475353 18:37402448-37402470 AGGCTCAAAGGGGTTAGAGAAGG - Intronic
1159349243 18:67250345-67250367 AGGCTCTCAGTGTTTATGGATGG + Intergenic
1159582285 18:70246979-70247001 AGACTCTAAATGTTTCTACAAGG + Intergenic
1161146164 19:2679629-2679651 AGGCTCTGGGAGTTTCTAGAAGG + Intronic
1162256481 19:9494256-9494278 AGAATCAAAGTGTGTATAGATGG + Intronic
927404140 2:22748514-22748536 AGGCTCTCAATGTTTAGAGCAGG - Intergenic
936916123 2:117640580-117640602 AGACTCTAAGTGTTCATAGCTGG - Intergenic
937399182 2:121566892-121566914 AGGCTCTGAGGGTTCATTGAAGG - Intronic
941770604 2:169341365-169341387 AGGCACTTAGTGTCTTTAGAGGG - Intronic
943705090 2:191026085-191026107 AGGCCCTATGGCTTTATAGAAGG + Intergenic
945730131 2:213523202-213523224 AGGATCTGATTGTTTATAAAGGG + Intronic
946453153 2:219798595-219798617 ATGCTGTAAGTATTAATAGAAGG + Intergenic
1169735799 20:8836248-8836270 AGACTTTAAGTGTTAATAGGAGG + Intronic
1170688909 20:18594374-18594396 TGGCTCTCTGAGTTTATAGATGG + Intronic
1174740909 20:53013269-53013291 AGGCTCTACTTGTTAATGGAAGG + Intronic
1175074672 20:56362567-56362589 TGGCTCACAGTGCTTATAGATGG + Intronic
1177069786 21:16490229-16490251 AGTCTCTGAGTGCTTATGGAAGG - Intergenic
1183000536 22:34855125-34855147 ATGCCCACAGTGTTTATAGAGGG + Intergenic
1183718290 22:39547114-39547136 GGGCTCTGAGTGTGTGTAGAGGG + Intergenic
952696671 3:36272731-36272753 AGACTCTACCTGTTGATAGAAGG + Intergenic
954185180 3:48911587-48911609 AGGCACCAAGTTGTTATAGATGG - Intergenic
955046877 3:55369226-55369248 ATGCTTTAAGTGTTTAGGGAGGG + Intergenic
956609513 3:71108093-71108115 AGGTTCAAATTCTTTATAGAGGG + Intronic
957897464 3:86442104-86442126 AGGCTCTATGTGTTTCCTGAGGG - Intergenic
959723463 3:109517463-109517485 GAGCTCTCAGTGTTTTTAGATGG - Intergenic
960039050 3:113130889-113130911 ATGCTCTAAGTGTTAAGAAAAGG + Intergenic
960283273 3:115799590-115799612 AGTCTCTAAGTTTTCAAAGATGG - Intergenic
963568131 3:146957706-146957728 AAGCACTAAGTATTTATAGATGG + Intergenic
964022583 3:152031875-152031897 AGGCTGTAACTGATTGTAGAGGG - Intergenic
970753297 4:19393076-19393098 AGGCTCTAATTGATTTTATATGG + Intergenic
971143591 4:23951317-23951339 ACCCTATAAGTGTTTATACAGGG + Intergenic
973547962 4:52001217-52001239 ATGTTATAAGTGTTTATAAAGGG + Intronic
977984691 4:103369056-103369078 GGGCTATATTTGTTTATAGATGG + Intergenic
978032878 4:103957544-103957566 AAGATCTAAGGTTTTATAGAGGG - Intergenic
978545110 4:109863035-109863057 TGACTCTAAATGTTTTTAGATGG + Intronic
979539833 4:121869413-121869435 AGGATCTAAGGGGTTAGAGAAGG - Intronic
981978166 4:150757677-150757699 AGGCACTAAATATTTATAAAAGG + Intronic
983156813 4:164358086-164358108 AAGCTCTAAGTTTTTGTGGAGGG - Intronic
985146460 4:186899045-186899067 AGACTCTCAGTGTTTACAGGAGG + Intergenic
985352044 4:189074486-189074508 AGAATCTAAGGGTTTATGGAGGG - Intergenic
988780712 5:34519247-34519269 TGTCTCTAAGCATTTATAGATGG + Intergenic
990527513 5:56642631-56642653 AGGCTCTACGTGAGTACAGAGGG - Intergenic
990639587 5:57766723-57766745 AGGCTCTAAGCATTTTTAAAAGG + Intergenic
991237197 5:64412432-64412454 AGGGTCTAAGTATTAATGGATGG - Intergenic
992221303 5:74576426-74576448 TGGGTCTTAGTGTTTACAGAAGG + Intergenic
994260269 5:97650133-97650155 AGGCTCTAAGTGTTTGCTGTAGG + Intergenic
994997261 5:107079369-107079391 AGGCTCTAAGTATTCAATGACGG - Intergenic
997279726 5:132632756-132632778 ATTTTCTAAGTGTTTTTAGAAGG - Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
1000740107 5:164958420-164958442 AGGCACTGAGTATTTATAAATGG - Intergenic
1004364707 6:15002114-15002136 AGTCTCTAACGATTTATAGATGG - Intergenic
1004819947 6:19356802-19356824 AGGCCCTCAGTGTTCCTAGAGGG + Intergenic
1014515539 6:122374129-122374151 AGCCTCTAAAAGCTTATAGAAGG - Intergenic
1014972793 6:127839306-127839328 ATATTCTAAGTGTTTATAAATGG + Intronic
1022437123 7:30399005-30399027 AGCCTCTGAGTGATTATAAAAGG - Intronic
1022553878 7:31272021-31272043 TCCCTCTAAGTATTTATAGAAGG - Intergenic
1028499510 7:91503137-91503159 AGGCTTTAAATGTTTATATATGG + Intergenic
1028841849 7:95437251-95437273 AGGCTATGACTGTTTAGAGAAGG + Intergenic
1030874543 7:114796575-114796597 AGGCTCTTAATCTTTTTAGAAGG - Intergenic
1032583079 7:133121319-133121341 AGGCTCTAATTTTTTATCCAAGG - Intergenic
1034343230 7:150371117-150371139 GGGCTCTAGGGGTTCATAGATGG + Intronic
1037108865 8:15142207-15142229 AGGGTCTAAGATTTTATTGAGGG + Intronic
1037653155 8:20858881-20858903 AGACTGGAAGAGTTTATAGATGG + Intergenic
1038589282 8:28821538-28821560 AGGCTTTCAGTGTTCAAAGATGG + Intronic
1042945981 8:74155036-74155058 ATTCTCTAACTGTTTCTAGAAGG + Intergenic
1043392012 8:79800951-79800973 AGGCTCTAGGTGTGCAGAGAGGG + Intergenic
1046282065 8:112046193-112046215 AGCCTATAAGTCTTTACAGAGGG + Intergenic
1049165153 8:141121098-141121120 ATGCAATAAGTGTTTATGGAGGG + Intronic
1050078230 9:1887723-1887745 AGGCTCAGAGTCTTTATAGCTGG + Intergenic
1050504277 9:6331200-6331222 AAAGTCTAAGTGTTTCTAGAGGG - Intronic
1058170486 9:101674652-101674674 AGGCTCTAAATTTTTATTAAAGG - Intronic
1058419818 9:104822802-104822824 AGGCTATAAATGTTTATTTAGGG + Intronic
1058469226 9:105260001-105260023 AGGCTCTAAGATATGATAGATGG + Intronic
1058503414 9:105645984-105646006 AGGCCAGAAGTGTTTATTGAAGG - Intergenic
1188698578 X:33230162-33230184 AGATTATAATTGTTTATAGAGGG + Intronic
1188922260 X:35991231-35991253 AGGCTCTGTGTATTTAAAGATGG + Intergenic
1189829629 X:44957706-44957728 ATCCTCTAATTGTTTATAGCTGG - Intronic
1196429870 X:115612618-115612640 AGGCTATTATTGTTAATAGATGG - Intronic
1197525150 X:127552373-127552395 AGACTGTAGGTGTATATAGAAGG + Intergenic
1198718143 X:139584520-139584542 AAGGTTAAAGTGTTTATAGAAGG - Intronic
1200727388 Y:6688098-6688120 TGGGACTGAGTGTTTATAGAAGG + Intergenic
1200728540 Y:6703873-6703895 TGGGACTGAGTGTTTATAGAAGG + Intergenic
1200775819 Y:7169438-7169460 AGCATCTAAGTGTATATACAGGG - Intergenic