ID: 1102511755

View in Genome Browser
Species Human (GRCh38)
Location 12:113420815-113420837
Sequence ATGTGTGTCTAAAGCGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102511749_1102511755 4 Left 1102511749 12:113420788-113420810 CCAGGACAAGGCACCCAACAAGG 0: 1
1: 0
2: 1
3: 4
4: 117
Right 1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 118
1102511744_1102511755 17 Left 1102511744 12:113420775-113420797 CCCAGTACCCAGTCCAGGACAAG 0: 1
1: 0
2: 0
3: 13
4: 190
Right 1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 118
1102511745_1102511755 16 Left 1102511745 12:113420776-113420798 CCAGTACCCAGTCCAGGACAAGG 0: 1
1: 0
2: 0
3: 13
4: 198
Right 1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 118
1102511753_1102511755 -10 Left 1102511753 12:113420802-113420824 CCAACAAGGATGGATGTGTGTCT 0: 1
1: 0
2: 1
3: 18
4: 171
Right 1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 118
1102511747_1102511755 10 Left 1102511747 12:113420782-113420804 CCCAGTCCAGGACAAGGCACCCA 0: 1
1: 0
2: 2
3: 28
4: 215
Right 1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 118
1102511748_1102511755 9 Left 1102511748 12:113420783-113420805 CCAGTCCAGGACAAGGCACCCAA 0: 1
1: 0
2: 0
3: 4
4: 127
Right 1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 118
1102511743_1102511755 18 Left 1102511743 12:113420774-113420796 CCCCAGTACCCAGTCCAGGACAA 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 118
1102511741_1102511755 27 Left 1102511741 12:113420765-113420787 CCTCTGTGTCCCCAGTACCCAGT 0: 1
1: 0
2: 10
3: 97
4: 593
Right 1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 118
1102511752_1102511755 -9 Left 1102511752 12:113420801-113420823 CCCAACAAGGATGGATGTGTGTC 0: 1
1: 0
2: 3
3: 12
4: 112
Right 1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG 0: 1
1: 0
2: 1
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102511755 Original CRISPR ATGTGTGTCTAAAGCGAGGA TGG Intronic
901163301 1:7197218-7197240 GTGTGTGTCAAATGTGAGGATGG + Intronic
902624145 1:17666973-17666995 ATCTGGGTCTCAAGCCAGGAAGG + Intronic
904656885 1:32055483-32055505 ATGTGGGTCTCAAGAGAAGAGGG - Intronic
905814241 1:40936185-40936207 TTGTGTTTCTACAGAGAGGAGGG - Intergenic
908139987 1:61174242-61174264 ATGTGTTTCAAAATCAAGGAAGG - Intronic
911223406 1:95276970-95276992 AGGTCTGTCTAAAGCAAGGAGGG - Intergenic
911480565 1:98434837-98434859 AGCTGTGTCTAAAGTTAGGATGG - Intergenic
911502037 1:98699052-98699074 CTGTGTGTCTAAATAGATGAAGG + Intronic
912427662 1:109608998-109609020 GGGTGTGTCTAAAGCGGGGCAGG + Exonic
916840205 1:168592642-168592664 ATGTGGGGGTAAAGGGAGGAAGG + Intergenic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
924024966 1:239822325-239822347 TTGTGTTTCTAAAACAAGGATGG + Intronic
1063538597 10:6909817-6909839 TGGTGTGTCTATAGCCAGGATGG + Intergenic
1066235247 10:33479504-33479526 AGGTGTGTTTAAAGGGAGGGAGG - Intergenic
1068003099 10:51359753-51359775 AGGTGTGTAAAAAGCAAGGAGGG + Intronic
1072531847 10:96327016-96327038 ATGTGTGTCTGAAGCAAGGCAGG - Intronic
1074281374 10:112054880-112054902 ACTTGTGTCTGAAGAGAGGAAGG - Intergenic
1075998377 10:126896005-126896027 ATGAATGTCTAAAGAAAGGAAGG - Intergenic
1080305999 11:30837043-30837065 ATGTGTGTTTGAGGGGAGGATGG + Intronic
1083355369 11:62062343-62062365 ACTGGTGTCTAAAGCGAGGGGGG - Intergenic
1085306941 11:75491907-75491929 ATGTCTGTCTAATGGGGGGAGGG - Intronic
1088458683 11:110059990-110060012 ATGTGAGTCTAGAGTGGGGAAGG - Intergenic
1089407280 11:118208525-118208547 ATGAGTGTCATAAGAGAGGAAGG + Intronic
1092667033 12:10813240-10813262 AAGTGGGTCTAAAGCTGGGATGG + Intergenic
1094704144 12:32898048-32898070 GTGTGTGTCTAAAGGCAGAAGGG - Intergenic
1095214929 12:39537140-39537162 GTGTGTGTCTAGAGTGCGGAGGG - Intergenic
1098652901 12:72995976-72995998 AAGTGTGTCAAAAGCCTGGAAGG - Intergenic
1100132187 12:91509472-91509494 ATGTGTGTCTCCACTGAGGATGG + Intergenic
1100856863 12:98764935-98764957 ATGTGTGTCTAATGCATGGCAGG + Intronic
1101130773 12:101689129-101689151 ATGTGTGTATCATGCTAGGATGG + Intergenic
1102511755 12:113420815-113420837 ATGTGTGTCTAAAGCGAGGATGG + Intronic
1103349860 12:120276652-120276674 CTGGGTGTGGAAAGCGAGGACGG - Intergenic
1106378374 13:29211763-29211785 ATGAGTGTCTAAAGTGTGAAAGG - Intronic
1106392369 13:29346978-29347000 ATGAGTGTCTAAAGTGTGAAAGG - Intronic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1107337520 13:39371011-39371033 ATATGTGTCTAAAGAGATGTGGG + Intronic
1108823740 13:54386515-54386537 ATTTGTGTCTAAAGCGTAAATGG - Intergenic
1109259548 13:60127706-60127728 GTGTTTGTCAAAAGCCAGGATGG + Intronic
1112193492 13:97201225-97201247 ATGTGTTTCTAAAGGTAAGATGG - Intergenic
1115088493 14:29546117-29546139 ATGTGTGTGTAAAGCCTGAAAGG + Intergenic
1115523000 14:34252001-34252023 ATGTGTGGTTAAAGCGTGGTAGG - Intronic
1119746649 14:77049403-77049425 ATGTGTGTCTGCAGTGATGATGG + Intergenic
1120212240 14:81644591-81644613 ATGTGTGTCTATAGTGATGATGG + Intergenic
1122681957 14:103471686-103471708 ATGTGGGTCTCAAACGAGGAAGG - Intronic
1128204357 15:65837674-65837696 AGGGGTGCCTAAAGGGAGGAAGG - Intronic
1128885263 15:71280748-71280770 AGGTGTGTCTAAACCGAGCCAGG + Intronic
1139562944 16:67755282-67755304 AGGTGGGTCTAGAGAGAGGATGG + Intronic
1144417673 17:15067234-15067256 ATGTGTGTCTGAAGATAGCAAGG - Intergenic
1145177126 17:20710674-20710696 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1146853254 17:36241538-36241560 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1146869162 17:36365428-36365450 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147058623 17:37855370-37855392 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1147072036 17:37966059-37966081 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1147083562 17:38045591-38045613 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147099508 17:38169558-38169580 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1150082521 17:62252848-62252870 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1162555781 19:11384476-11384498 ACGTGTGTCTGAAGCCAGAACGG - Intronic
1163263664 19:16205867-16205889 TTGTGTTTCCAAAGCCAGGAAGG + Intronic
1165183536 19:33995184-33995206 ATGAATGTCAAAAGAGAGGATGG + Intergenic
927375814 2:22412343-22412365 ATGTGTATCTATAGGGTGGAAGG - Intergenic
927455461 2:23245326-23245348 AAGTGTGTCTAAAGCTGAGAGGG - Intergenic
928432087 2:31228510-31228532 ATTTGTGTCTTAACTGAGGATGG - Intronic
929168899 2:38911490-38911512 ATGTGTGTATATGGGGAGGAGGG + Intronic
931794240 2:65694069-65694091 TTGTGTGTCAAAATAGAGGAGGG + Intergenic
933264398 2:80166704-80166726 ATCTGTGTCTGAAGCTGGGAGGG + Intronic
933606565 2:84389993-84390015 ATGGGTGTCCAAAGCCTGGAGGG + Intergenic
933767171 2:85718134-85718156 TCGGGTGTCTAAAGCGGGGAAGG - Intergenic
935156285 2:100486401-100486423 ATGTGTGTTCAATGCAAGGAGGG + Intergenic
938313275 2:130308759-130308781 ATGTGTGTTTAAAGAAAGAAGGG + Intergenic
939630163 2:144519821-144519843 ATGTGAGTCTGAAGTGAGAAGGG - Intronic
941606168 2:167599691-167599713 ATGTTTATCTAAAGTTAGGAAGG - Intergenic
944087857 2:195870112-195870134 ATGAGTGCATAAAGAGAGGAAGG - Intronic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
945213811 2:207412324-207412346 TTGAGTGTATAAAGAGAGGAGGG - Intergenic
1170837275 20:19895086-19895108 AAGTGGGTCTAAAGCCTGGAAGG - Intronic
1171217936 20:23365722-23365744 ATGTGCGTCTTGAGCGCGGACGG - Exonic
1172828083 20:37807329-37807351 ATGTGTGACTAAAGCCAGGGTGG - Intronic
1174577279 20:51545515-51545537 ATGTGTGGATAAATGGAGGATGG + Intronic
1175982446 20:62745890-62745912 ATTTGTCTCTAAAGAGAGCAGGG - Intronic
1177234618 21:18372132-18372154 GTGTGTGTCTACAGTGAGGGAGG + Intronic
1181379120 22:22485778-22485800 ATGTATGTCTACAGCCAAGATGG + Exonic
1182400934 22:30077193-30077215 AAATGTGTCTAAAGAGAGAAAGG + Intergenic
1184823216 22:46928398-46928420 GTGTGTGTCTACAGAGAGGCAGG - Intronic
949281880 3:2355685-2355707 ATGTTAGTCTAGAGCTAGGATGG - Intronic
951655882 3:25007880-25007902 CTGTGGGTATAAAGCGAGCATGG - Intergenic
954366724 3:50150390-50150412 ATGTGAGTCCAGAGCGAGAAAGG - Intergenic
955369000 3:58334391-58334413 ATTTGTGCCTAAAGGGAGTATGG + Intronic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
955857774 3:63292081-63292103 TTGTGTATCTAAACAGAGGAAGG + Intronic
958505811 3:94975451-94975473 ATGTATGTCAAAAGCAAGCAGGG + Intergenic
960051347 3:113241858-113241880 GTGTTTATCTAAAGCAAGGAGGG + Intronic
960998439 3:123354630-123354652 ATCTGTGTGAAAAGAGAGGAAGG + Intronic
961530136 3:127535659-127535681 ATGTTTGACCAAAGGGAGGAAGG - Intergenic
965632695 3:170749536-170749558 TTGTGTGTTTAAAGAGATGATGG - Intronic
972181326 4:36470353-36470375 TTGTTTGTATAAAGAGAGGAAGG - Intergenic
973588250 4:52413721-52413743 GTGTGTGACGAAAGGGAGGATGG - Intergenic
976119531 4:81764199-81764221 ATGTATGTATAAAGAGAGCAGGG + Intronic
977663254 4:99615581-99615603 ATGTGTCTCTGAAGCTAGGATGG - Intronic
981855117 4:149280084-149280106 ATGTCTGTCTAAAGTTAGGAGGG + Intergenic
981890232 4:149727721-149727743 ATGAATGTCTCAAGCCAGGAAGG + Intergenic
984363861 4:178772932-178772954 ATGTGTGTCTAAGGCCAAGCTGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
986918242 5:12652012-12652034 ATTTCTGTCTAAGGGGAGGATGG + Intergenic
990758017 5:59097464-59097486 ATGTGTGTTTAGAGAGTGGAGGG - Intronic
992401633 5:76417147-76417169 GTGTGTGTCTACAGTGGGGAGGG + Intronic
993031536 5:82712306-82712328 ATGTGTTTGGAAAGAGAGGAGGG + Intergenic
993918823 5:93774365-93774387 ATGCGTGTCAAAAGCCAAGATGG + Intronic
994243220 5:97448316-97448338 GTGTGTGTATAAAGAGAGAAGGG + Intergenic
996660969 5:126002412-126002434 ATGTGAGTCTCAAACCAGGAGGG + Intergenic
997875554 5:137543651-137543673 CTGTGTGTGTAAGGAGAGGAGGG + Intronic
998250431 5:140548681-140548703 ATGTGGGTATAAAGCAAGGGGGG - Intronic
998902131 5:146867624-146867646 AGGTGTGTCTAGAGCCAGGTGGG + Intronic
999684107 5:154087066-154087088 ATGGGTGACTAAAGTGAGGATGG + Intronic
1009850071 6:69184981-69185003 ATGTGTGTCTAATGCACGGATGG - Intronic
1022119672 7:27295787-27295809 GTGTGTGTTTAAAGAGAGGAAGG + Intergenic
1023165764 7:37342371-37342393 ATTTGTGTCTGAAGCTAGGAAGG - Intronic
1024710463 7:52009663-52009685 GTGTGTGTGTGAAGCCAGGAAGG + Intergenic
1024969078 7:55052268-55052290 ATGTGTGTCTCATGCAAGGCAGG - Intronic
1030430611 7:109442708-109442730 ATGTGTGTTTAAAGCGTGGAAGG + Intergenic
1034009505 7:147513707-147513729 CTATGTCTCTAAAGTGAGGAAGG - Intronic
1035703487 8:1655602-1655624 ACATGTGTTTAAAGCGATGATGG + Intronic
1036616932 8:10395381-10395403 ATGTGTGTAGAAAGAGAGTAGGG + Intronic
1038321594 8:26532052-26532074 ATGTTTGTGTAGAGAGAGGAAGG + Intronic
1042946830 8:74163672-74163694 ATGCCTGTCTAAAGCAAGGGTGG - Intergenic
1049194132 8:141306375-141306397 ATGTGTTTCTAGAGAGAGGCTGG - Intronic
1052102583 9:24467627-24467649 TTTTGTGTCTTAAGCGAGGTAGG - Intergenic
1053148582 9:35728580-35728602 ATGTGTGTATAGAGAGAGTAAGG - Intronic
1055926293 9:81513670-81513692 ATGTGTGTATAAAATAAGGAAGG + Intergenic
1059010991 9:110459284-110459306 ATGTGTTACTAAAGATAGGAAGG - Intronic
1193815478 X:86100423-86100445 ATGTGTGTAAAAAGAAAGGAAGG - Intergenic
1194203322 X:90981000-90981022 ATTTGTGTATAGAGTGAGGAGGG + Intergenic