ID: 1102513827

View in Genome Browser
Species Human (GRCh38)
Location 12:113433693-113433715
Sequence GCTGCTTGAACTCAACTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102513822_1102513827 1 Left 1102513822 12:113433669-113433691 CCGGCCCTATGTGCCATCTCTCT 0: 1
1: 0
2: 3
3: 21
4: 242
Right 1102513827 12:113433693-113433715 GCTGCTTGAACTCAACTAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 71
1102513821_1102513827 16 Left 1102513821 12:113433654-113433676 CCATCATGGTCAGGGCCGGCCCT 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1102513827 12:113433693-113433715 GCTGCTTGAACTCAACTAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 71
1102513824_1102513827 -3 Left 1102513824 12:113433673-113433695 CCCTATGTGCCATCTCTCTGGCT 0: 1
1: 0
2: 3
3: 22
4: 240
Right 1102513827 12:113433693-113433715 GCTGCTTGAACTCAACTAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 71
1102513818_1102513827 24 Left 1102513818 12:113433646-113433668 CCTTGGGTCCATCATGGTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1102513827 12:113433693-113433715 GCTGCTTGAACTCAACTAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 71
1102513825_1102513827 -4 Left 1102513825 12:113433674-113433696 CCTATGTGCCATCTCTCTGGCTG 0: 1
1: 0
2: 3
3: 15
4: 220
Right 1102513827 12:113433693-113433715 GCTGCTTGAACTCAACTAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102513827 Original CRISPR GCTGCTTGAACTCAACTAGC AGG Intronic
902746032 1:18475138-18475160 GGAGTTTGAAGTCAACTAGCAGG + Intergenic
904314308 1:29650500-29650522 GCTGCTTGATCTAAAATAGGAGG + Intergenic
906045635 1:42828864-42828886 GCTGCCTGAAATCAAATAGAAGG - Intronic
908644869 1:66266386-66266408 GCAGCTTGACCTCAGCTTGCTGG + Intronic
909061309 1:70882140-70882162 TCTGCCTGAACTCAGCTAGCAGG - Intronic
913278650 1:117164033-117164055 GCTGCTTGAACCCCAACAGCTGG + Intronic
915493859 1:156267277-156267299 GTTGCTTGTACTCAATTACCAGG + Intronic
917371462 1:174298293-174298315 GCTGCTTGCACTCATGAAGCAGG + Intronic
920125040 1:203687531-203687553 GGTGCTTGAATTCTGCTAGCTGG + Intronic
1064237103 10:13586745-13586767 GCTTTTGGAACTCAACTAGCAGG + Intergenic
1064383089 10:14863790-14863812 GGTGCTTGAACTCACTTAGAAGG + Intronic
1065280514 10:24132999-24133021 GCTGGTTGAAATCAGCCAGCAGG + Intronic
1068055296 10:52005538-52005560 TCTGTTTGAACTCAACTGGTGGG + Intronic
1072957467 10:99899965-99899987 GCTGCTTGAAATCTACGAGAAGG - Exonic
1080697060 11:34611853-34611875 GCTTGTTGAACTGAACAAGCAGG - Intergenic
1080838239 11:35960681-35960703 ACTGCTTGAACCCAACAGGCGGG - Intronic
1092389707 12:8065220-8065242 ACTGCATGAACTGAAGTAGCAGG + Intronic
1093866944 12:24238693-24238715 GCTGCTTGAACCCCACTGCCTGG + Intergenic
1095985588 12:47997523-47997545 GCTGCTTGCACTTACCTGGCTGG - Intronic
1097835173 12:64265601-64265623 CTTGCTTGAAGTCAAATAGCTGG + Intronic
1098857367 12:75668188-75668210 GCTGCTTGAACTATAATACCAGG - Intergenic
1098958976 12:76718737-76718759 GGTGCTTAAACTCAACTATAAGG - Intergenic
1102513827 12:113433693-113433715 GCTGCTTGAACTCAACTAGCAGG + Intronic
1107660942 13:42638536-42638558 TTTGTTTGAACTCATCTAGCTGG - Intergenic
1118610006 14:67532892-67532914 TCTGCTTGACCCCAAATAGCGGG - Intronic
1119222489 14:72920361-72920383 ACTGGTTGAACTCAACTAGAAGG + Intergenic
1119701382 14:76757755-76757777 ATTGCTTGAACTCAAGTGGCAGG - Intergenic
1119778996 14:77265822-77265844 GCTGCAGGAACCCAGCTAGCTGG - Exonic
1125115815 15:36090270-36090292 GCTGGTTGAAATGAACTAGTGGG + Intergenic
1126533007 15:49731655-49731677 TCTGCCTGAACTCAGCCAGCAGG + Intergenic
1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG + Intergenic
1137035090 16:35563327-35563349 TGTATTTGAACTCAACTAGCAGG - Intergenic
1140424725 16:74851269-74851291 GCTCCTGGAAGTCAACTTGCTGG - Intergenic
1141249302 16:82340283-82340305 ACTGCCTGAACTCAACTAAGAGG - Intergenic
1142839495 17:2616173-2616195 ACTGCTTGAACTCTACTCCCTGG - Intronic
1157469231 18:47975739-47975761 GCTGCAGCAACTCAACTAGCTGG - Intergenic
1158873105 18:61707992-61708014 GCTTCTTGATCACACCTAGCTGG - Intergenic
1159530790 18:69652738-69652760 GCTGCTTGAACCCTAAAAGCTGG - Intronic
926570494 2:14524558-14524580 GCTCCTTCAACTCACATAGCAGG + Intergenic
926862743 2:17326075-17326097 CCTGCTTCAACCCAAGTAGCTGG - Intergenic
929961712 2:46502189-46502211 GTTGCTTGATGTAAACTAGCAGG + Intronic
934457147 2:94179859-94179881 GATGCGTGTACTCAACTAACAGG + Intergenic
935210556 2:100936319-100936341 GTTGCATGCACTCAACTAGATGG - Intronic
938050039 2:128161077-128161099 GCTGCCTGCACTCAGCAAGCTGG - Intronic
938535570 2:132239341-132239363 GATGCTTGAATTCAACTCACAGG + Intronic
941565600 2:167102154-167102176 GCTGCTTGATTTGAATTAGCTGG + Intronic
945581810 2:211603907-211603929 GCTGGTGGAACCCAAATAGCAGG - Intronic
945587982 2:211691004-211691026 CCTGCTTTAACTAAACTAGAGGG + Intronic
945829680 2:214768475-214768497 GCTGGTTGGACTCTACTGGCTGG - Intronic
947974677 2:234355416-234355438 AATGCTTGACCTCAGCTAGCTGG + Intergenic
1170520519 20:17180143-17180165 TCTACCTGAACTCAACTGGCAGG + Intergenic
1179502445 21:41818654-41818676 GCTGCATGAACTGCACTCGCCGG - Intronic
1184806454 22:46797571-46797593 GCTGCTTGAACTTGTCGAGCCGG - Exonic
1184841440 22:47054684-47054706 GCTGATTGAAGTCAAGTAGCAGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
959901671 3:111668727-111668749 GATAGTTGATCTCAACTAGCAGG - Intergenic
971945866 4:33276479-33276501 ACTCCATGAACTCAACTTGCAGG + Intergenic
984466252 4:180102196-180102218 GCTGCTTGTACTCAGCCATCTGG + Intergenic
992128907 5:73671464-73671486 GCTGCTAAAACTGAACTGGCGGG - Intronic
993262189 5:85672529-85672551 GCTGCTTGAACTCAATGATGTGG - Intergenic
1009312257 6:62169948-62169970 TCTGCTTGAACTCAGCTAGCAGG + Intronic
1014049570 6:116936263-116936285 GCTGCTTTAACTATACTACCAGG + Intergenic
1021804068 7:24337740-24337762 ACTTCTTGAATTCAATTAGCTGG - Intergenic
1023126787 7:36962211-36962233 GCTGCTTGAACTGAAATCACAGG + Intronic
1024397671 7:48887959-48887981 GCTGTTTGGCCTCACCTAGCTGG + Intergenic
1032620275 7:133523228-133523250 TCTGCTTTAACAGAACTAGCTGG - Intronic
1033716981 7:144012329-144012351 TCTGCCTGCAGTCAACTAGCAGG + Intergenic
1039609697 8:38909720-38909742 GCTGCTTCTAGTCAACTGGCAGG + Intronic
1041876586 8:62694674-62694696 GATTCTTGAACTAAACTACCTGG + Intronic
1041889698 8:62855531-62855553 GCTCCTTAAACTCAACCACCAGG + Intronic
1044289048 8:90446396-90446418 GCTGCTTGGGCTCAAGTAGTTGG - Intergenic
1048359808 8:133688169-133688191 GCTGCTTGAACTAAATTTGAAGG + Intergenic
1053167662 9:35855961-35855983 GATGCTTGAACCCAAATAGCTGG + Intergenic
1053715220 9:40881145-40881167 GATGTGTGTACTCAACTAGCAGG + Intergenic
1055758882 9:79585310-79585332 CTTGCTTGAAATCAGCTAGCCGG + Intronic
1057180265 9:93026016-93026038 GCTGCTTGAAATGACCCAGCAGG - Intronic
1190126479 X:47709964-47709986 GCAGCTTGCACACAACTTGCAGG - Intergenic
1194475029 X:94347916-94347938 GCAACTTGAAATCAAGTAGCTGG - Intergenic
1197890732 X:131267933-131267955 TCTGCTTGAACTCTTCTAGAGGG - Intergenic