ID: 1102514143

View in Genome Browser
Species Human (GRCh38)
Location 12:113435288-113435310
Sequence AGGGAGAAGCAGAGTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2628
Summary {0: 1, 1: 0, 2: 23, 3: 276, 4: 2328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102514143_1102514149 1 Left 1102514143 12:113435288-113435310 CCTCCCTCACTCTGCTTCTCCCT 0: 1
1: 0
2: 23
3: 276
4: 2328
Right 1102514149 12:113435312-113435334 TCACCCCCCCTCCCCAGGAAAGG 0: 1
1: 0
2: 2
3: 39
4: 487
1102514143_1102514160 21 Left 1102514143 12:113435288-113435310 CCTCCCTCACTCTGCTTCTCCCT 0: 1
1: 0
2: 23
3: 276
4: 2328
Right 1102514160 12:113435332-113435354 AGGCCACGCCAGCCTGGTGCAGG 0: 1
1: 0
2: 1
3: 23
4: 229
1102514143_1102514147 -4 Left 1102514143 12:113435288-113435310 CCTCCCTCACTCTGCTTCTCCCT 0: 1
1: 0
2: 23
3: 276
4: 2328
Right 1102514147 12:113435307-113435329 CCCTCTCACCCCCCCTCCCCAGG 0: 1
1: 0
2: 8
3: 149
4: 1173
1102514143_1102514159 15 Left 1102514143 12:113435288-113435310 CCTCCCTCACTCTGCTTCTCCCT 0: 1
1: 0
2: 23
3: 276
4: 2328
Right 1102514159 12:113435326-113435348 CAGGAAAGGCCACGCCAGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102514143 Original CRISPR AGGGAGAAGCAGAGTGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr