ID: 1102514516

View in Genome Browser
Species Human (GRCh38)
Location 12:113437329-113437351
Sequence TTCCTGGCATAGGGCATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102514508_1102514516 -3 Left 1102514508 12:113437309-113437331 CCTGACGTGTCCCTAGGGCCTTC 0: 1
1: 0
2: 1
3: 5
4: 69
Right 1102514516 12:113437329-113437351 TTCCTGGCATAGGGCATGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 273
1102514502_1102514516 24 Left 1102514502 12:113437282-113437304 CCCCATGAGGGCTGGTGTGTCTT 0: 1
1: 0
2: 0
3: 19
4: 140
Right 1102514516 12:113437329-113437351 TTCCTGGCATAGGGCATGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 273
1102514503_1102514516 23 Left 1102514503 12:113437283-113437305 CCCATGAGGGCTGGTGTGTCTTA 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1102514516 12:113437329-113437351 TTCCTGGCATAGGGCATGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 273
1102514504_1102514516 22 Left 1102514504 12:113437284-113437306 CCATGAGGGCTGGTGTGTCTTAG 0: 1
1: 0
2: 0
3: 15
4: 125
Right 1102514516 12:113437329-113437351 TTCCTGGCATAGGGCATGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 273
1102514507_1102514516 -2 Left 1102514507 12:113437308-113437330 CCCTGACGTGTCCCTAGGGCCTT 0: 1
1: 0
2: 2
3: 5
4: 79
Right 1102514516 12:113437329-113437351 TTCCTGGCATAGGGCATGGCAGG 0: 1
1: 0
2: 2
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102514516 Original CRISPR TTCCTGGCATAGGGCATGGC AGG Intronic
900363667 1:2301744-2301766 TTCCTGGCTGAGGGCAAGGGCGG + Intronic
900782347 1:4626312-4626334 TTCCTCCCAGAGGGCAGGGCAGG - Intergenic
901427766 1:9193559-9193581 TGGCTTGCATAGGGCAAGGCAGG + Intergenic
902059640 1:13631294-13631316 GGCCTGACAAAGGGCATGGCAGG + Intergenic
902165861 1:14571088-14571110 TTTTTGTCATAGGGCATGGGCGG - Intergenic
902290961 1:15434498-15434520 TGCCTGGCATATGGCAAGGACGG - Intergenic
902367914 1:15989500-15989522 TGCATGGCATAGTGCAGGGCAGG - Intergenic
905272815 1:36797934-36797956 TCCAGGGCCTAGGGCATGGCAGG + Exonic
905391431 1:37638343-37638365 TTCCAGGCAGAGGGAATGGCAGG + Intergenic
907373190 1:54016131-54016153 TTCCAGGCAGAGGGCGTGGCAGG + Intronic
910124325 1:83823797-83823819 TTCAGGGCATAGGGAATGGAGGG + Intergenic
915314652 1:155021508-155021530 ATCCTGGCAGAGGGCATGGCAGG - Intronic
915515589 1:156410641-156410663 TGCCAGGTGTAGGGCATGGCTGG - Intronic
916513596 1:165495364-165495386 TTCCTGGCTGAGGGAATGTCAGG - Intergenic
917057928 1:171004117-171004139 TTCCAAGCAGAGGGCAAGGCAGG + Intronic
919937114 1:202260856-202260878 TTCCTGGCACACTGCATGTCAGG - Intronic
920135814 1:203768490-203768512 TTCCTGGGAGAGGGAGTGGCAGG + Intronic
920341589 1:205278564-205278586 ATGCTGCCATAGGGCCTGGCGGG + Intergenic
920397824 1:205659581-205659603 CTCCAGGCTTAGGGCCTGGCAGG + Exonic
922804723 1:228379353-228379375 CTCCTGGCAAGGGGCAGGGCGGG - Intergenic
1066341608 10:34539818-34539840 TTCCTGAAATAGGCCAGGGCGGG + Intronic
1067902627 10:50258074-50258096 TTCCTGGCATTGGGAAGGTCTGG - Intergenic
1069614614 10:69799041-69799063 TTCCTGGCAGAGGGTCTAGCAGG + Intergenic
1069621688 10:69841151-69841173 TTCCTGGCAGAGGGAAGAGCAGG - Intronic
1070709843 10:78672793-78672815 GGCCTGGCAGGGGGCATGGCAGG + Intergenic
1070959875 10:80491213-80491235 TCCCTGGAATAGGGCATTGCTGG + Intronic
1071335709 10:84598825-84598847 GTCTTGGAATGGGGCATGGCTGG + Intergenic
1071559315 10:86632805-86632827 CTCCTGGAACTGGGCATGGCTGG - Intergenic
1073403984 10:103280828-103280850 TTTCTGACATAGGGCAATGCTGG + Intronic
1076884910 10:133257865-133257887 TTGCTGGCCGAGGGCAAGGCCGG + Intergenic
1077109241 11:854787-854809 TGTCTGGCAGATGGCATGGCCGG + Intronic
1078018063 11:7632383-7632405 GACCTGGCACAGGGCCTGGCAGG + Intronic
1078141852 11:8699017-8699039 GGCCTGGCAGAGGGCATTGCGGG - Intronic
1078288548 11:9983196-9983218 TTCCAGGCAGAGGGCAAGACGGG - Intronic
1078355272 11:10627984-10628006 CTCCAGGCAGAGGGGATGGCGGG + Exonic
1079385056 11:19971483-19971505 TTCCTGGCTCAGGGCATGGGTGG + Intronic
1080672593 11:34394960-34394982 TTCCAGGCAGAGGGCAAGACAGG + Intergenic
1080855535 11:36108662-36108684 TTCCAGGCAGAGAGAATGGCAGG + Intronic
1080874961 11:36266608-36266630 TTCCAGAGAGAGGGCATGGCGGG + Intergenic
1081393889 11:42562208-42562230 TTCTTGGCATAGTGCCTAGCAGG + Intergenic
1081583553 11:44369031-44369053 TTCTTGGCAGAGGGAATTGCAGG + Intergenic
1081763036 11:45590516-45590538 TGCCAGGGAGAGGGCATGGCAGG - Intergenic
1083442905 11:62688559-62688581 GTCCAGGCAGAGGGCATGGCAGG - Intronic
1083940757 11:65894203-65894225 ACCCTGGCAGAGGTCATGGCAGG + Intronic
1084384006 11:68830677-68830699 TTAGTGGCATAGGTCAAGGCTGG - Intronic
1084729046 11:71061603-71061625 TTCCAGGGAAAGGGCATTGCTGG - Intronic
1084792442 11:71483028-71483050 TCCCTGGTATTGGGCATGGCAGG + Intronic
1085162405 11:74360651-74360673 TTCCTGGCAAAGGGAAGGGGTGG + Intronic
1085303620 11:75473015-75473037 TTCCAAGCAGAGGGAATGGCAGG + Intronic
1085416661 11:76322880-76322902 TTCCTTGCCTAGGGGATGGGCGG - Intergenic
1089107344 11:116023898-116023920 TTCCAGGCAGAGGGCATGATGGG - Intergenic
1089339292 11:117746689-117746711 TCCCTGGGTCAGGGCATGGCAGG - Intronic
1089446510 11:118557043-118557065 CTCCTGTGATAGGGCAGGGCAGG + Exonic
1089753743 11:120670557-120670579 TTCCAGGCAGAGGGCACAGCAGG - Intronic
1089806829 11:121097992-121098014 TTCCTGGCATTAGCCTTGGCTGG + Intergenic
1090989643 11:131804511-131804533 ATCCAGGCAGAGGGGATGGCAGG - Intronic
1091582891 12:1799581-1799603 TTCCTGGGACAGGTCATGGAGGG + Intronic
1095326658 12:40903191-40903213 TACCTGGCATAAGGCCTGGCTGG + Intronic
1095341677 12:41096993-41097015 TTCCAGGGTTAGGGCAGGGCAGG + Intergenic
1097574494 12:61374218-61374240 TACCTGGCATGGCACATGGCAGG + Intergenic
1098960966 12:76739364-76739386 TTCCAGGCAGAGGGCAAGACGGG + Intergenic
1101290967 12:103368699-103368721 GGACTGGCTTAGGGCATGGCTGG - Intronic
1102514516 12:113437329-113437351 TTCCTGGCATAGGGCATGGCAGG + Intronic
1104065336 12:125300757-125300779 CAGCTGGCAAAGGGCATGGCTGG + Intronic
1104077344 12:125401553-125401575 TTCCAGGCAGGGGGAATGGCAGG + Intronic
1104411365 12:128560720-128560742 TTCCTGGCACAGGGAAGGGATGG + Intronic
1104426351 12:128681489-128681511 TTCCTGGCTTCTGGGATGGCTGG + Intronic
1104968590 12:132521008-132521030 TCCCTGGCTCAGGGCAGGGCAGG - Intronic
1107679114 13:42829577-42829599 TTCAAGGCAGAGGGCATGGGAGG - Intergenic
1113608589 13:111627521-111627543 TTCCTGGGATAGGGCTGGGGCGG - Intronic
1114612400 14:24051643-24051665 ATGCTGGGAGAGGGCATGGCTGG - Intergenic
1114729062 14:24971643-24971665 TTCCAGGCAGAGGGAATGGCAGG - Intronic
1118595638 14:67433110-67433132 TTCCTGGGTTGGGACATGGCTGG - Intergenic
1118839585 14:69500622-69500644 TTCATGGCATAGGGCATGCTAGG - Exonic
1120429891 14:84400546-84400568 TTCCTGGAATAGGAAATGGGTGG + Intergenic
1120684736 14:87525145-87525167 TTCCTGGCAGAGACCAAGGCAGG + Intergenic
1120766048 14:88326993-88327015 TTCCTGGGACAGCGAATGGCAGG + Intergenic
1121204074 14:92146903-92146925 TTCCTGGCTTTGCGCATGGCTGG + Intronic
1121843908 14:97156601-97156623 TTCCAGGCAGAGGGAAGGGCAGG + Intergenic
1122089769 14:99330556-99330578 TTCCTTGCAAAGTCCATGGCGGG - Intergenic
1122362227 14:101174286-101174308 TGCCTGGCTCAGGACATGGCTGG + Intergenic
1122543962 14:102512204-102512226 TTTCTGGCAGAGGGCAAAGCAGG + Intergenic
1122609156 14:102969491-102969513 TCCCTGGCAGCGGGCTTGGCTGG - Intronic
1122969092 14:105145217-105145239 CTCCTGGTATAGGGCACAGCCGG - Intronic
1123042190 14:105494831-105494853 TTCAGGGGATAGGGCAGGGCTGG + Intronic
1124354319 15:28983954-28983976 TTCCTGGGGCAGGGCAGGGCAGG - Intronic
1125610137 15:40964139-40964161 TGCCTGGCATAGGACACGACTGG - Intergenic
1128004411 15:64225397-64225419 TTCCTGACATAGGGGAGGGGAGG - Intronic
1128314204 15:66650070-66650092 TCCCTGGCAGAGGGCACTGCAGG - Intronic
1128414974 15:67436665-67436687 TTCCAGGCAGAGGGCAAGACGGG - Intronic
1128639839 15:69328230-69328252 TTCTTTGCATAGAGCGTGGCTGG - Intronic
1129328131 15:74812772-74812794 ATCCTGGGATAGGGCCAGGCAGG - Exonic
1130059940 15:80562212-80562234 TTACAGGCATGGGGCCTGGCTGG + Intronic
1132618245 16:852744-852766 TTCCGGGCAGGGGGCATGGAGGG + Intergenic
1132981561 16:2740822-2740844 TTGCTGGCATAGGGAAGGGTGGG - Intergenic
1133246320 16:4451170-4451192 CTCCTGGCTCAGGGCAGGGCAGG + Intronic
1134019731 16:10913141-10913163 TTCCAGGCAGAGGGCACAGCCGG - Intronic
1134023063 16:10934728-10934750 CTCCTGGCAAGGGGCTTGGCTGG - Intronic
1134301298 16:12993881-12993903 ATCCAGGCAGAGGGAATGGCTGG + Intronic
1135540330 16:23324936-23324958 CTCCTGGCATGGGGCCTGGTGGG + Intronic
1136044731 16:27606595-27606617 GTGCTGGCTTCGGGCATGGCTGG + Intronic
1136109028 16:28053074-28053096 TTTCTGGAAGAGGGCATGGGAGG - Intronic
1136317579 16:29463444-29463466 TTCCTGGAAAAGTTCATGGCTGG + Exonic
1136432154 16:30202789-30202811 TTCCTGGAAAAGTTCATGGCTGG + Exonic
1137444726 16:48524728-48524750 TTCCGGGCAGAGGGAATTGCCGG - Intergenic
1138448336 16:57078350-57078372 ATCCTGGCAGAGGGCTTCGCAGG + Intronic
1139550885 16:67672444-67672466 TTCCAGGCAGAGGACATGCCAGG + Intergenic
1139707931 16:68754747-68754769 TGCCTAGCAGAGGGCTTGGCAGG - Intronic
1141263533 16:82475332-82475354 TTCCTGGCAGAGGGAAATGCTGG - Intergenic
1141476658 16:84278583-84278605 ATCCAGGCAGGGGGCATGGCAGG - Intergenic
1142154302 16:88526217-88526239 TCCCTGCCACAGGGCGTGGCAGG - Intronic
1142744672 17:1949919-1949941 TTCCAGGCAGAGGGCACAGCAGG + Intronic
1145773212 17:27508334-27508356 TTCCCAGCATAGGGCTTGGCAGG - Intronic
1146443091 17:32914071-32914093 TTCCAGGCAGAGGGCATTCCAGG + Intergenic
1148153216 17:45408677-45408699 TTCCAGGCTGAGGGAATGGCTGG - Intronic
1148160456 17:45447068-45447090 CTCCTGGCATAGGGCCTGGCAGG + Intronic
1148334511 17:46832452-46832474 TTCCTGGCAACAGGCCTGGCAGG - Intronic
1148605878 17:48928527-48928549 TTCATAGCAGAGGGCAGGGCAGG - Exonic
1150660962 17:67078385-67078407 GCGCTGGCATAGGACATGGCGGG + Exonic
1150788821 17:68183996-68184018 CTCCTGGCACAGGGCCTGGCAGG + Intergenic
1151808393 17:76421049-76421071 TTCCTGGTAAAAGGCATGGATGG + Intronic
1151816257 17:76472912-76472934 TTCCTGGGCCAGGGCATGGCCGG - Intronic
1151987866 17:77555759-77555781 TGCCTGGGAGAGGGCCTGGCTGG - Intergenic
1152868309 17:82737025-82737047 TTCCTGGCCTGGTGCATGGGGGG + Intronic
1153409997 18:4782660-4782682 ATCCTGGGGTAGGGCATAGCTGG - Intergenic
1153812818 18:8766738-8766760 TTCCTGGGAGAGGGCTGGGCAGG + Intronic
1156401040 18:36740932-36740954 TTCTTGGCATAGGGTACGGAGGG + Intronic
1156424312 18:36992751-36992773 TTCCTGGCAGAGGGTGTAGCAGG + Intronic
1157402332 18:47398905-47398927 TTGCAGGCATGGGACATGGCAGG + Intergenic
1157754981 18:50209850-50209872 TTCCTGGCCAATGGCATGTCTGG - Intergenic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1159078231 18:63705542-63705564 TTCTTGGCATAAGCCATGACTGG - Intronic
1160211339 18:76882787-76882809 TTCCTGGTATCTGGCAGGGCAGG + Intronic
1162652666 19:12102570-12102592 TTGTTGGCATAGGCAATGGCAGG - Intronic
1163943430 19:20515338-20515360 TCCCTGGCTTAGGGACTGGCAGG + Intergenic
1165988116 19:39788108-39788130 TTTCTGGGATAGGGGATGTCAGG - Intergenic
1166213494 19:41321715-41321737 TTCCTGGCAGAGGCCATAGTAGG + Intronic
1166700691 19:44879836-44879858 TGCCTGGCACAGGGCTTGGTGGG - Intronic
1166910118 19:46148509-46148531 TTCTGGGCATTGGGCTTGGCAGG - Intronic
1168087246 19:54057197-54057219 TTCCTGTCGTGGGACATGGCTGG - Intronic
1168588911 19:57616655-57616677 TTCCTGCCAAAGGGCAGGGTAGG + Intronic
925134671 2:1517979-1518001 ATCCTGGCAGAGGGCAGGGCTGG - Intronic
925215294 2:2089373-2089395 TGCCTGGGGTAGGGAATGGCTGG + Intronic
925918816 2:8625618-8625640 TTCCTGGTAGAGGGAATGGCTGG + Intergenic
926093718 2:10066593-10066615 TTCCTGGCATCAGGCAAGCCTGG + Intronic
926384954 2:12326897-12326919 CTCCAGGCAGAGGGAATGGCAGG + Intergenic
927255075 2:21034112-21034134 TTCCTGGCATAGGTCACAGTAGG - Intronic
928119974 2:28576959-28576981 TCCCTGGCACAGGGCTTAGCAGG - Intronic
929761445 2:44810803-44810825 TTTCTGGCCCAGGGGATGGCTGG + Intergenic
931198464 2:60074922-60074944 TTCCTGCCATTGGGCAGGGTGGG + Intergenic
931272825 2:60717749-60717771 TCCCAGGCACAGGGCATGGTGGG - Intergenic
931525264 2:63145633-63145655 TTCCAGGCAGAGGGCATGATGGG + Intronic
932383367 2:71306704-71306726 TGTCTGGCTTTGGGCATGGCTGG + Intronic
932740840 2:74290113-74290135 TTCCAGACTTAGGGAATGGCAGG - Intronic
933242834 2:79942201-79942223 TTCCTGGCATAGGCACTTGCTGG - Intronic
937737620 2:125311817-125311839 TTCAGGGTATAGGGAATGGCAGG + Intergenic
938131391 2:128718495-128718517 TTCCTGGCAGAGTGCCCGGCGGG - Intergenic
938343150 2:130548740-130548762 TTCCAGGCACAGGGCACTGCTGG + Intronic
938346683 2:130571982-130572004 TTCCAGGCACAGGGCACTGCTGG - Intronic
939695804 2:145322655-145322677 TTCCTGAAGAAGGGCATGGCCGG - Intergenic
940172413 2:150843259-150843281 TTCCAGGCAGAGGGCAAGACGGG + Intergenic
941627394 2:167844860-167844882 TTCCAGGCAGAGGGCAAGCCAGG - Intergenic
944591233 2:201219603-201219625 TTCTTGGCAGAGGGGATGTCTGG + Exonic
944874090 2:203944018-203944040 TTCCAGGCAAAGGGCAAGACTGG + Intronic
946246939 2:218393215-218393237 TGCCTGGGACAGGGCCTGGCAGG - Intronic
946338659 2:219055079-219055101 TTCATGGCAGAGGAGATGGCAGG + Exonic
946590407 2:221240982-221241004 TTCCTGCCATAGAGTATGGATGG + Intergenic
946823056 2:223649499-223649521 CACCAGGCATAGTGCATGGCCGG - Intergenic
947107554 2:226683399-226683421 GTCCAGGCACAGGGCAAGGCAGG + Intergenic
947914365 2:233822069-233822091 TTCCTGGCATGTGCCCTGGCAGG - Intronic
947972082 2:234333032-234333054 TTCCTGGCTTAAGCCATGGAGGG - Intergenic
948323531 2:237091964-237091986 TCCCTGGCACACAGCATGGCTGG + Intronic
948488280 2:238295042-238295064 TTGCAGGCAGAGGGCAAGGCAGG - Intergenic
1170170020 20:13399932-13399954 TTCCAGGCATAGGGAATAGCAGG - Intronic
1171359738 20:24578665-24578687 ATCCTGGCTTAGGGGACGGCAGG + Intronic
1172072979 20:32272229-32272251 TTCTTGGCAAAGGGGATGTCTGG + Intergenic
1173283495 20:41649884-41649906 TTCCAGGCAGAGGGAATGGCAGG + Intergenic
1173454622 20:43192199-43192221 TTCCAGGCAGAGGGACTGGCCGG - Intergenic
1173456898 20:43210011-43210033 TTCCAGTCATAGGGAAGGGCTGG + Intergenic
1176678942 21:9807762-9807784 CTCCTGGCATCAGGTATGGCTGG + Intergenic
1177942287 21:27425610-27425632 TGCCTGGCATACGGCATGGGAGG + Intergenic
1179049668 21:37878539-37878561 TTCTTGCCATAGGGCTGGGCTGG - Intronic
1179471386 21:41613002-41613024 TTCCCGGCAGAGGGCAGGGAAGG - Intergenic
1181646409 22:24233591-24233613 TCCCTGGAGTAGGGCAGGGCAGG + Exonic
1182073956 22:27482183-27482205 TTCCTGGCATATGGTTTGGGCGG - Intergenic
1182077673 22:27505996-27506018 TTCGTGGCTTAAGGCAAGGCAGG + Intergenic
1183068267 22:35378694-35378716 TTCCTGGAATAGTGCCTGGTAGG - Intergenic
1183279506 22:36924403-36924425 ATCCTGGGAGAGGGCATGGTGGG - Intronic
1183324680 22:37184797-37184819 CTCCTGGCAAAGGGCACAGCTGG - Intronic
1184469892 22:44690429-44690451 AACCTGACAGAGGGCATGGCAGG + Intronic
1184594684 22:45506628-45506650 TTCCTGGCAGGGGAAATGGCAGG + Intronic
950575155 3:13827870-13827892 TTCCTGGAGTAGGGCAGCGCAGG - Intronic
950879366 3:16310653-16310675 TTCCTGGCTCAGGGCTTTGCTGG + Intronic
951003987 3:17596060-17596082 TTCATGGTATAGAGAATGGCAGG + Intronic
951845675 3:27081709-27081731 TTACTGGCAGAGGACATAGCAGG - Intergenic
952409714 3:33036298-33036320 TTTCAGGGATAGGGGATGGCAGG + Intronic
952722081 3:36544173-36544195 TTACTGGCATGGGCAATGGCAGG + Intronic
953145277 3:40269322-40269344 TTCCTGGCAGAGTTCCTGGCAGG + Intergenic
954608993 3:51934333-51934355 CTCCTAGCACAGGGCCTGGCAGG - Intronic
954634998 3:52066402-52066424 TGCCTGGCAAAGGGCCTGCCAGG - Intergenic
955348215 3:58176320-58176342 TGCCTGCCAGAGGTCATGGCAGG - Intergenic
955505759 3:59631715-59631737 TACCTGGCACAAGGCAAGGCTGG + Intergenic
956130483 3:66048718-66048740 CCCCTGGCATAGGGCATTGTAGG - Intergenic
956716695 3:72085891-72085913 TTCCTGGCATACTGCATCGAAGG + Intergenic
958486671 3:94720576-94720598 TTGCTAGGATAGTGCATGGCTGG + Intergenic
960519589 3:118639575-118639597 TTCCTGGCAGAGGCTGTGGCAGG + Intergenic
962176178 3:133157998-133158020 TACCTGGCATATGGCAATGCAGG - Intronic
962184744 3:133246343-133246365 TTCCTGGCATAAGGCCTGCCTGG - Intronic
962987561 3:140549446-140549468 TTCCATTCCTAGGGCATGGCTGG + Intronic
962987722 3:140550901-140550923 TTCCATTCCTAGGGCATGGCTGG + Intronic
964406923 3:156358739-156358761 TTTCTGGCATGGGGCAATGCAGG - Intronic
964738658 3:159942952-159942974 TTGCTTGCATAGTGCATGTCTGG + Intergenic
966117729 3:176485396-176485418 TTCCAGGCAGAGGGCAAGACTGG + Intergenic
966946445 3:184780194-184780216 GTCCTGGGAGAGGGCAGGGCTGG - Intergenic
967980249 3:195061211-195061233 GTCCTGGCACTGGGCATGGGCGG - Intergenic
968492831 4:899653-899675 TTGCTGTCCTGGGGCATGGCGGG - Intronic
968915970 4:3497223-3497245 TTCCTGGGAGGGGGCATGGCAGG + Intronic
969267662 4:6075421-6075443 ATCCTGGCATTGTGCAGGGCTGG - Intronic
969313285 4:6366756-6366778 TCCCTGGCATGGGGCAGGGTGGG - Intronic
969576131 4:8036749-8036771 TACCTGGCATGGGGTCTGGCAGG + Intronic
969671850 4:8594032-8594054 TTCCTGGGAAAGGGCAGGTCAGG - Intronic
971346310 4:25815056-25815078 TCCCTGGCCTAGGAGATGGCAGG - Intronic
973772969 4:54223490-54223512 TGCCTGGCTGAGGCCATGGCTGG - Intronic
975074669 4:70190750-70190772 TTCCAGGCATAGGGAACAGCAGG + Intergenic
978631265 4:110748336-110748358 TCCATGGCTTAGGTCATGGCTGG - Intergenic
981261931 4:142730896-142730918 TTTCTGTCATAGGACATGGAAGG - Intronic
985396606 4:189551182-189551204 CTCCTGGCATCAGGTATGGCTGG - Intergenic
986623395 5:9700488-9700510 TTCCTGGCCAAGTGCATGGGTGG - Intronic
988484216 5:31654991-31655013 TTCCAGGCAGAGGGAATAGCAGG - Intronic
989416808 5:41187819-41187841 TTCCTTTCATAGGGCAGGCCAGG - Intronic
990109507 5:52306183-52306205 TTGTTGGCATAGGCAATGGCAGG + Intergenic
992150157 5:73894921-73894943 TTCCAGGCGTAGGGAATGGCCGG + Intronic
992435427 5:76751483-76751505 TTCCTAGCATGGGGCATGCCAGG - Intergenic
992748735 5:79842957-79842979 TTGCTGGCATAAGGAATGGGCGG - Intergenic
992842743 5:80712056-80712078 TGGCTGGAATTGGGCATGGCTGG + Intronic
993887686 5:93435623-93435645 TTCCAGGCAGAGGGTATGGTGGG - Intergenic
995064496 5:107844608-107844630 TGCCTGGGATAGGGCATGTGAGG + Intergenic
998461892 5:142315851-142315873 TGCCTGGCACAGTGCTTGGCAGG - Intronic
999813670 5:155153688-155153710 TTGGTGGCATAGGGCAAGTCTGG + Intergenic
1000030836 5:157399747-157399769 TTCCTGCCATGGGGCAGGGGTGG - Intronic
1000043552 5:157502978-157503000 TGCCTGGCAGAGGACAAGGCTGG + Exonic
1001118618 5:168960199-168960221 TACCTGGCGTACTGCATGGCAGG + Intronic
1001197001 5:169682349-169682371 TTCCAGGCAGAGGGCACAGCAGG + Intronic
1001759860 5:174198491-174198513 TGGTTGGCATAGGGCAGGGCTGG - Intronic
1002929631 6:1624365-1624387 TTCCGGGCTTTGGGCATCGCAGG + Intronic
1002941940 6:1724868-1724890 GTCCGGGCACAGGGCGTGGCCGG - Intronic
1007213444 6:40216731-40216753 GTCCTGGCAGAGGACAGGGCAGG + Intergenic
1007581247 6:42961347-42961369 CTCCTGGCACTGGGCTTGGCAGG - Intronic
1011734801 6:90299636-90299658 TACCTTGAATAAGGCATGGCAGG + Intergenic
1013023533 6:106244750-106244772 TGCATAGCACAGGGCATGGCAGG + Intronic
1013389144 6:109665797-109665819 TTACCAGCATAGGGAATGGCAGG - Intronic
1017513770 6:155137657-155137679 TTCCTGGCAAAGAGCACGGCTGG - Intronic
1018030145 6:159835330-159835352 TCCCTGGCATTGGGCAGGGAAGG - Intergenic
1018519921 6:164636672-164636694 TTTTTGGCATAGAGCATGTCAGG - Intergenic
1019558668 7:1645197-1645219 TCCCTGGCCCAGGGCTTGGCAGG + Intergenic
1020806940 7:12801632-12801654 TTCCTGGCAGAGGACAGGGCAGG - Intergenic
1027190146 7:75991870-75991892 TTCCTGGATTAGGGGATGGGTGG - Intronic
1028873212 7:95791892-95791914 TTCTTCCCATAGGGAATGGCGGG - Intronic
1032513950 7:132493280-132493302 CCCCAGGCCTAGGGCATGGCTGG - Intronic
1033607930 7:142941082-142941104 TTCCAGGCATAGAACATAGCAGG + Intergenic
1034396008 7:150825371-150825393 TACCTGGCAAAGGGAATTGCCGG + Intronic
1034790160 7:153960965-153960987 CTTCTGACATTGGGCATGGCAGG + Intronic
1036067855 8:5403412-5403434 TTTGTGGAATAGGGCATGGAGGG - Intergenic
1038128496 8:24701593-24701615 TTACTGTCATTGGGGATGGCAGG + Intergenic
1038379964 8:27083727-27083749 TTCCAGGCAAGGGGTATGGCTGG + Intergenic
1039822787 8:41148388-41148410 TTCCAGGCAGAGGGAATAGCAGG - Intergenic
1043457223 8:80424724-80424746 TTCCAGGCAGAGGAAATGGCTGG - Intergenic
1044178490 8:89159462-89159484 TTCCTTGCATAGTTCATGGGTGG - Intergenic
1044217075 8:89624707-89624729 TTACAGGCATGGGGGATGGCAGG - Intergenic
1044442467 8:92238247-92238269 CTCCTAGCACAGGCCATGGCAGG + Intergenic
1047209095 8:122826321-122826343 TGCCAGGCTGAGGGCATGGCAGG - Intronic
1048304672 8:133275585-133275607 GTGATGGGATAGGGCATGGCTGG - Intronic
1048316717 8:133368476-133368498 TTCTTGGCAAAGGGAATAGCAGG + Intergenic
1049004152 8:139844308-139844330 TTCTTGGCAGAGTGCCTGGCAGG + Intronic
1049456801 8:142696354-142696376 TTCCTGGCATGAGGAGTGGCGGG - Intergenic
1050163972 9:2745478-2745500 TTCCTAGAACAGGGCCTGGCTGG + Intronic
1050603300 9:7274232-7274254 TTCCTGGATTGGGGAATGGCTGG + Intergenic
1053453019 9:38209188-38209210 TTCCAGGCAGAGGGCATACCAGG - Intergenic
1057049950 9:91915972-91915994 TTCCTGGCTTAGGCTCTGGCAGG + Intronic
1057853521 9:98583897-98583919 TTCCTGGCTCAGGCCAGGGCTGG - Intronic
1059333051 9:113548597-113548619 TTCCTCACATCGGGCCTGGCAGG - Intronic
1059359988 9:113734662-113734684 TTCCTGGAAGAGGGAAGGGCAGG - Intergenic
1059458750 9:114416175-114416197 TTCCAGGCATATGACAGGGCTGG + Intronic
1060269619 9:122131476-122131498 TTCTTGGCAGAGGGAAAGGCAGG - Intergenic
1060274545 9:122172486-122172508 TTCCAGGCAGAGAGAATGGCAGG - Intronic
1060510461 9:124228564-124228586 GCCCTGGCCTTGGGCATGGCAGG + Intergenic
1060873048 9:127058099-127058121 TTCCAGGCAGAGGAGATGGCTGG + Intronic
1060994330 9:127867660-127867682 TTCCTCGCACAGGGCATGCCTGG - Exonic
1061083981 9:128388694-128388716 TGCCTGGCATAAGGCAGGGTAGG - Intronic
1061514817 9:131082878-131082900 TTCCGGGCAGTGGGCAGGGCTGG - Intronic
1061847325 9:133395039-133395061 TTCCTTGTTTTGGGCATGGCAGG - Intronic
1062017012 9:134296076-134296098 TCCCAGGCAGAGGGAATGGCCGG - Intergenic
1062167446 9:135114970-135114992 TTCCTGCCATAGAGCAGGGGTGG - Intronic
1062207597 9:135345936-135345958 TCCCTGGCAGTGGGCAGGGCTGG - Exonic
1203664114 Un_KI270754v1:10298-10320 CTCCTGGCATCAGGTATGGCTGG + Intergenic
1186482555 X:9907123-9907145 TTCCTGCTTTAGGGCAGGGCAGG - Intronic
1189245332 X:39558904-39558926 TTCCAGGCAGAGGTAATGGCAGG - Intergenic
1190296716 X:49031877-49031899 TTCAAGGCAGAGGGCACGGCTGG - Intronic
1190768807 X:53498191-53498213 TTCCTGGCAAGGGGCATAGTCGG - Intergenic
1194052974 X:89095141-89095163 TTCCTGGCATGCTTCATGGCAGG + Intergenic
1199658355 X:150021450-150021472 TCCCTCGCATTGGGCATGGCAGG + Intergenic
1199855163 X:151753713-151753735 CTGCAGGCACAGGGCATGGCAGG + Intergenic