ID: 1102517985

View in Genome Browser
Species Human (GRCh38)
Location 12:113463100-113463122
Sequence AACGCCCGACGCAGACGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 13}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102517985_1102517996 14 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517996 12:113463137-113463159 CTGCTTCGGGGCGGGGCCCCCGG 0: 1
1: 0
2: 3
3: 39
4: 338
1102517985_1102517997 15 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517997 12:113463138-113463160 TGCTTCGGGGCGGGGCCCCCGGG 0: 1
1: 0
2: 0
3: 16
4: 179
1102517985_1102517990 0 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517990 12:113463123-113463145 TTGGTTTCAGGAGGCTGCTTCGG 0: 1
1: 0
2: 1
3: 21
4: 194
1102517985_1102518004 30 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102518004 12:113463153-113463175 CCCCCGGGGGCCGAGCGCGGGGG 0: 1
1: 0
2: 4
3: 62
4: 667
1102517985_1102517991 1 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517991 12:113463124-113463146 TGGTTTCAGGAGGCTGCTTCGGG 0: 1
1: 0
2: 1
3: 10
4: 227
1102517985_1102518002 29 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102518002 12:113463152-113463174 GCCCCCGGGGGCCGAGCGCGGGG 0: 1
1: 0
2: 3
3: 21
4: 306
1102517985_1102517995 7 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517995 12:113463130-113463152 CAGGAGGCTGCTTCGGGGCGGGG 0: 1
1: 0
2: 3
3: 25
4: 247
1102517985_1102517992 2 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517992 12:113463125-113463147 GGTTTCAGGAGGCTGCTTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 131
1102517985_1102517993 5 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517993 12:113463128-113463150 TTCAGGAGGCTGCTTCGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 224
1102517985_1102517998 16 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517998 12:113463139-113463161 GCTTCGGGGCGGGGCCCCCGGGG 0: 1
1: 0
2: 2
3: 25
4: 232
1102517985_1102517994 6 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517994 12:113463129-113463151 TCAGGAGGCTGCTTCGGGGCGGG 0: 1
1: 0
2: 2
3: 36
4: 272
1102517985_1102517999 17 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517999 12:113463140-113463162 CTTCGGGGCGGGGCCCCCGGGGG 0: 1
1: 0
2: 3
3: 10
4: 222
1102517985_1102518000 27 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102518000 12:113463150-113463172 GGGCCCCCGGGGGCCGAGCGCGG 0: 1
1: 0
2: 2
3: 34
4: 463
1102517985_1102517989 -9 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102517989 12:113463114-113463136 TCGGGCGTTTTGGTTTCAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 32
1102517985_1102518001 28 Left 1102517985 12:113463100-113463122 CCACCGCGTCTGCGTCGGGCGTT 0: 1
1: 0
2: 1
3: 0
4: 13
Right 1102518001 12:113463151-113463173 GGCCCCCGGGGGCCGAGCGCGGG 0: 1
1: 0
2: 3
3: 34
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102517985 Original CRISPR AACGCCCGACGCAGACGCGG TGG (reversed) Exonic
1102517985 12:113463100-113463122 AACGCCCGACGCAGACGCGGTGG - Exonic
1103557751 12:121776252-121776274 AGAGCACGAGGCAGACGCGGTGG - Exonic
1113774953 13:112938796-112938818 AACCACCGAGGCAGACGCTGTGG + Intronic
1122543600 14:102510568-102510590 AACCCCCGACGGAGACGGTGGGG - Intergenic
1142188386 16:88705865-88705887 AGCGCCCGCCGCAGCCGCCGGGG + Intronic
1162461695 19:10817520-10817542 AACCCCCCAGGCAGACGCTGGGG + Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
953562034 3:43999148-43999170 AACTCCCGCCGCAGTGGCGGGGG - Intergenic
968866653 4:3217258-3217280 AACTCCCAAGGCAGACGCTGTGG - Intronic
1017052813 6:150409078-150409100 GCCGCCCGAGGCAGAGGCGGAGG + Intergenic
1024965368 7:55019079-55019101 AGCGCCCGACGCGGCCGAGGCGG + Exonic
1044950623 8:97432301-97432323 ATGGCCGGACGCAGACGTGGTGG - Intergenic
1053000623 9:34575448-34575470 AAGGCCCGAAGCGGACGCCGGGG + Intronic
1062656063 9:137605195-137605217 GCCCCCCGACGGAGACGCGGCGG + Intergenic
1192274572 X:69616249-69616271 AACGGCTGAGGCAGACGCAGCGG + Exonic