ID: 1102519810

View in Genome Browser
Species Human (GRCh38)
Location 12:113471266-113471288
Sequence CGCCCCAGTGGAGCGCGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102519798_1102519810 19 Left 1102519798 12:113471224-113471246 CCGGGGAGGCTGGGATGGGGATG 0: 1
1: 2
2: 10
3: 81
4: 770
Right 1102519810 12:113471266-113471288 CGCCCCAGTGGAGCGCGCGCAGG 0: 1
1: 0
2: 1
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102519810 Original CRISPR CGCCCCAGTGGAGCGCGCGC AGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
901079225 1:6574473-6574495 TGCCCCAGTGGAGCCTTCGCAGG + Intronic
903822296 1:26111796-26111818 CGCACCACGGGGGCGCGCGCCGG + Intronic
907442589 1:54488351-54488373 CGCCCGAGCGGAGCGCGCGGTGG + Intergenic
907489607 1:54800650-54800672 CAGCCCAGAGGAGCGTGCGCGGG - Exonic
909957692 1:81800727-81800749 CGCGCCGGCGGAGCGCGCGGAGG + Intronic
910679091 1:89843996-89844018 CGCCCTAGTGGAGTCCTCGCAGG - Intronic
912401507 1:109397572-109397594 CGCACCAGGTGAGCGGGCGCCGG - Exonic
921390124 1:214607637-214607659 AGCCCCAGTGGATGGCGAGCAGG + Intronic
1064022792 10:11823319-11823341 GGCGGCAGTAGAGCGCGCGCGGG + Intronic
1067110678 10:43397358-43397380 CGGCCCCGTGGCCCGCGCGCTGG + Intronic
1073297621 10:102450700-102450722 GGGCCGCGTGGAGCGCGCGCGGG - Exonic
1074182914 10:111078866-111078888 CGCCCCTGGCGAGCCCGCGCCGG + Exonic
1077551794 11:3203681-3203703 AGCCCCAGGCGAGCGCACGCAGG - Intergenic
1082810491 11:57476542-57476564 CGGCCTCGCGGAGCGCGCGCAGG - Exonic
1092247911 12:6873525-6873547 CGCCCCCGTGGAGCCCACCCCGG + Intronic
1101037098 12:100717019-100717041 AGCTCCACTGGAGAGCGCGCCGG - Intergenic
1102519810 12:113471266-113471288 CGCCCCAGTGGAGCGCGCGCAGG + Intronic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1115768535 14:36647508-36647530 GGCCCCAGTCGAGGGCGCGCAGG - Intergenic
1117478351 14:56118901-56118923 CGCCCCATCGGCGCGCGCTCGGG + Intronic
1119326085 14:73760249-73760271 CGCCGCGGTGCCGCGCGCGCCGG - Exonic
1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG + Intergenic
1123030484 14:105449066-105449088 AGCCCCAGTGGAGTGGGGGCAGG + Intronic
1127972829 15:63975137-63975159 AGCCCCAGTGGAGCACATGCTGG - Intronic
1132719728 16:1309766-1309788 CGCCCGAGGTGAGCGCGTGCGGG + Intronic
1132843541 16:1989953-1989975 CGCCTCCCGGGAGCGCGCGCCGG - Exonic
1132851606 16:2027257-2027279 CGCCCCAGGGGGACGCGCTCGGG - Intronic
1138044150 16:53703728-53703750 CTCCCCACTGCAGCGCGGGCCGG - Intronic
1138558922 16:57788523-57788545 CTCCCCAGTGAAGCCAGCGCAGG - Intronic
1142347983 16:89566042-89566064 CGCCCCCGGGGAGCACGGGCTGG + Exonic
1143410687 17:6706658-6706680 CCACCCAGAGGAGCGTGCGCAGG + Exonic
1145191000 17:20842180-20842202 AGCCCCAGTGGATGGCGAGCAGG - Intronic
1149554111 17:57560913-57560935 CGCCCCAGTGGAACTGGGGCAGG + Intronic
1153688389 18:7567912-7567934 CGCCCCCGAGGCGCGCGGGCCGG + Intronic
1159045755 18:63367281-63367303 CGCCTGGGTGGCGCGCGCGCCGG - Exonic
1160499335 18:79394502-79394524 CGCCCCAGAGCACCGGGCGCCGG - Intergenic
1160832257 19:1109463-1109485 CCCCCCAGAGGAGGGCCCGCGGG - Intronic
1160919661 19:1513596-1513618 CGGCCCCGTGGGCCGCGCGCGGG + Intronic
1164677446 19:30111374-30111396 CGCCCTAGTGGAGGGGGCTCTGG - Intergenic
1165431389 19:35775488-35775510 CGCCCCCGTGGGGCGCGCGCCGG + Intronic
1165774377 19:38396067-38396089 CGACCCAGTGGCACGCGCGCAGG - Exonic
1166852779 19:45768454-45768476 CGACCCGGTGTTGCGCGCGCGGG - Exonic
925068853 2:950856-950878 CGCCCCGGTGGAGCCCGAGCCGG + Exonic
927492869 2:23532109-23532131 GGCCCCAGTGGAGCGGGTTCTGG - Intronic
931517200 2:63056878-63056900 CGCCCCAGCGGAGTGCGCTGGGG + Exonic
933684843 2:85134204-85134226 AGCCCCCGTGGGGCGCGCGTGGG + Intronic
935046792 2:99489994-99490016 AGCCACCGCGGAGCGCGCGCGGG - Exonic
938764334 2:134450351-134450373 CGGCCCAGTGGAGCCTCCGCTGG + Exonic
942278033 2:174336685-174336707 CGCCCGAGTGCAGCGAGCTCTGG - Exonic
948115948 2:235494405-235494427 CGCCCCCATGGAGCGCGCCGCGG - Exonic
948473820 2:238203733-238203755 CGCCCCAGAGGGCTGCGCGCGGG + Intergenic
948874476 2:240819599-240819621 GGCCCGAGGGGAGAGCGCGCAGG - Intronic
1169118567 20:3082605-3082627 CGCGCCGGTGGGGCGAGCGCGGG + Exonic
1170629947 20:18057520-18057542 CATCCCAGGTGAGCGCGCGCGGG - Exonic
1172962099 20:38806519-38806541 CGGCCCAGAGGAGCGCCCCCGGG + Intronic
1173663589 20:44750627-44750649 CGCCCCCGGGGGGCGCGGGCTGG - Exonic
1176237886 20:64062789-64062811 AGGCCAAGTGGGGCGCGCGCAGG + Intronic
1181121273 22:20669783-20669805 AGCCCCAGTGGATGGCGAGCAGG + Intergenic
1181334229 22:22116808-22116830 AGCCCCAGTGGATGGCGAGCAGG + Intergenic
950153910 3:10708238-10708260 AGCCCCACTGGTGCGCGCGGAGG - Intergenic
951184965 3:19702676-19702698 CGGCCCTGTGGAGGGTGCGCCGG + Intergenic
954861431 3:53694218-53694240 AGCCCCAGTGGAGCCCCCACGGG - Intronic
967684897 3:192408268-192408290 CGCCCCGGCGGAGCGCAAGCCGG - Exonic
968662165 4:1803167-1803189 GCCCCGAGTGGAGCGCGAGCCGG - Intronic
969574598 4:8029714-8029736 CGACCCAGTGGAGCTTGGGCTGG + Exonic
981784300 4:148460629-148460651 TGCCCCAGAGGAGCGCGAGAAGG - Intergenic
996404287 5:123090621-123090643 CGCCCCGGGAGAGAGCGCGCGGG - Intronic
997625300 5:135327129-135327151 CGTCCCAGAGAAGCCCGCGCGGG + Intronic
997654238 5:135543856-135543878 CGCCCGCGTGGAGCGAGAGCCGG + Intergenic
998411424 5:141914362-141914384 CGCCGCAGTGCAGTGGGCGCGGG - Intergenic
1006304525 6:33211306-33211328 CGACCCCGTGGAGGGGGCGCAGG + Exonic
1018676095 6:166223389-166223411 CTCCCCTGTGGAGAGCGTGCAGG - Intergenic
1019118953 6:169788020-169788042 AGCCCCAGAGGAGCGAGCACGGG - Intergenic
1020555366 7:9663842-9663864 CACCCCAGTGGAGTCCGGGCTGG + Intergenic
1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG + Exonic
1027978435 7:85186779-85186801 CGGCTCAGAGGAACGCGCGCCGG - Intronic
1029485653 7:100838398-100838420 GGCCCTAGTGGGGCACGCGCAGG + Intronic
1039875038 8:41578110-41578132 CGCTCCCGTCGGGCGCGCGCGGG - Intronic
1044821980 8:96160993-96161015 CGCCCCCGCGGGACGCGCGCGGG + Intergenic
1049762225 8:144336757-144336779 CGCGCCGGTTGAGCGCGCCCGGG - Intergenic
1051774487 9:20620465-20620487 AGCCGAAGTGGCGCGCGCGCGGG + Intronic
1057631103 9:96719814-96719836 CGCCCCAGGGGAGAGCGCGGGGG + Intergenic
1059405841 9:114098100-114098122 CTCCCCAGGTGAGCGAGCGCCGG - Exonic
1062548997 9:137077430-137077452 CCCCCCAGTGGGGCGGGCCCCGG - Intergenic
1062575486 9:137205415-137205437 CGCGCCCGTTGAGCGCGGGCCGG + Exonic
1198005588 X:132489701-132489723 CGGGCCAGCGGAGCGCGGGCGGG + Intronic
1200047671 X:153411364-153411386 CGCCCCTGTGGGGCGGGCGCGGG + Intergenic
1200215147 X:154365006-154365028 CGCCACAGTGGGGCCCACGCTGG - Intronic