ID: 1102520423

View in Genome Browser
Species Human (GRCh38)
Location 12:113474698-113474720
Sequence CTGGAAACACACACCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 322}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102520423_1102520432 10 Left 1102520423 12:113474698-113474720 CCCTGTCTGGTGTGTGTTTCCAG 0: 1
1: 1
2: 1
3: 40
4: 322
Right 1102520432 12:113474731-113474753 GCCCACCCATTGGTGGTGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 129
1102520423_1102520428 0 Left 1102520423 12:113474698-113474720 CCCTGTCTGGTGTGTGTTTCCAG 0: 1
1: 1
2: 1
3: 40
4: 322
Right 1102520428 12:113474721-113474743 CCCAGGCTTTGCCCACCCATTGG 0: 1
1: 0
2: 0
3: 15
4: 224
1102520423_1102520436 12 Left 1102520423 12:113474698-113474720 CCCTGTCTGGTGTGTGTTTCCAG 0: 1
1: 1
2: 1
3: 40
4: 322
Right 1102520436 12:113474733-113474755 CCACCCATTGGTGGTGGCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 224
1102520423_1102520434 11 Left 1102520423 12:113474698-113474720 CCCTGTCTGGTGTGTGTTTCCAG 0: 1
1: 1
2: 1
3: 40
4: 322
Right 1102520434 12:113474732-113474754 CCCACCCATTGGTGGTGGCTGGG 0: 1
1: 0
2: 2
3: 12
4: 115
1102520423_1102520430 3 Left 1102520423 12:113474698-113474720 CCCTGTCTGGTGTGTGTTTCCAG 0: 1
1: 1
2: 1
3: 40
4: 322
Right 1102520430 12:113474724-113474746 AGGCTTTGCCCACCCATTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 102
1102520423_1102520437 13 Left 1102520423 12:113474698-113474720 CCCTGTCTGGTGTGTGTTTCCAG 0: 1
1: 1
2: 1
3: 40
4: 322
Right 1102520437 12:113474734-113474756 CACCCATTGGTGGTGGCTGGGGG 0: 1
1: 0
2: 2
3: 20
4: 239
1102520423_1102520431 6 Left 1102520423 12:113474698-113474720 CCCTGTCTGGTGTGTGTTTCCAG 0: 1
1: 1
2: 1
3: 40
4: 322
Right 1102520431 12:113474727-113474749 CTTTGCCCACCCATTGGTGGTGG 0: 1
1: 0
2: 1
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102520423 Original CRISPR CTGGAAACACACACCAGACA GGG (reversed) Intergenic
900355011 1:2256879-2256901 CTGGCAACAAAAACCTGACAAGG - Intronic
900711192 1:4115502-4115524 CTGGGAACACACAAGAGGCAAGG - Intergenic
900946073 1:5832103-5832125 CTGGAACCAGACACAAGACCAGG - Intergenic
901763099 1:11483246-11483268 TTGGAAACGGGCACCAGACATGG + Intronic
902785307 1:18729312-18729334 TTGGAACCACACCCAAGACAGGG + Intronic
903335832 1:22623907-22623929 GGGGAAAGACACACCAGGCAGGG + Intergenic
903551139 1:24157966-24157988 CTAGAAACAGACCTCAGACAAGG + Intronic
903655728 1:24947882-24947904 GTGGAAGCACACAGCAGAGAGGG - Intronic
905508996 1:38503498-38503520 CTGGCCACACACAACAGCCAGGG + Intergenic
905963218 1:42063301-42063323 TTGGAAACAGGCACAAGACAGGG + Intergenic
907378821 1:54067689-54067711 CTGGAAGCAGACACCAGCCAAGG + Intronic
910665695 1:89723946-89723968 CTAGAATCAAACACCAGACATGG - Intronic
910675180 1:89809012-89809034 CTGACAACACACAGCAGGCAAGG + Intronic
914934999 1:151970889-151970911 GATGAAACACTCACCAGACAAGG + Intergenic
915087240 1:153397140-153397162 CTGGAGAAACACCCCAGCCAGGG + Intergenic
916008359 1:160681857-160681879 TTGGAAAGACAGACCAGCCAAGG - Intronic
916384206 1:164249462-164249484 CTGGAAACCCACACCCTAAATGG + Intergenic
916497646 1:165359648-165359670 CTGGAAACTCACAGCAGGCCTGG - Intergenic
917821391 1:178767731-178767753 CTGGAAACACTCAGATGACAGGG - Intronic
918148799 1:181780855-181780877 CTGCACACACACACCAGAGGGGG + Intronic
918746972 1:188214992-188215014 CCTGAAACCCAAACCAGACAAGG - Intergenic
920125482 1:203690935-203690957 CATGAAACTCAAACCAGACAGGG - Intronic
920462290 1:206150402-206150424 CTGGAAACATGCAACAGTCATGG - Intergenic
922917808 1:229272423-229272445 CTGCAGAAACACAGCAGACACGG + Intronic
923460704 1:234206984-234207006 TTGGAAACAGACACCAGCCAAGG + Intronic
923606263 1:235445881-235445903 GTGGAACCACACAGCACACAAGG + Intronic
924670626 1:246120757-246120779 CTGGAAACACACAGGAGGGATGG - Intronic
1066144322 10:32541132-32541154 CTGGAAACACCCAGAAGGCAGGG - Intronic
1066255862 10:33678070-33678092 ATAGAAACACACACAAAACAAGG - Intergenic
1066507401 10:36059775-36059797 CTGGAAACAGAATCCAGGCAAGG + Intergenic
1066754397 10:38696317-38696339 GTGGAAACACACAGGAGACAGGG + Intergenic
1067077165 10:43194510-43194532 CTGTACACACACAGCAGGCAAGG + Intergenic
1067096016 10:43300653-43300675 CTGGAAACCCACCCCTGAAACGG + Intergenic
1067539905 10:47143827-47143849 CTGTAGTCACACACCAGCCAAGG + Intergenic
1068124038 10:52815982-52816004 CTGGACACACATACCATATAGGG + Intergenic
1069263114 10:66423902-66423924 CTGGCCAAAGACACCAGACATGG - Intronic
1070825083 10:79386179-79386201 TTGTCAACACACACAAGACAAGG + Exonic
1071052541 10:81468787-81468809 TTGAAAACCCACACAAGACAAGG - Intergenic
1073851246 10:107621127-107621149 CTGGAAACCCACACCCCACCTGG + Intergenic
1074135080 10:110618953-110618975 CCCTAAACACACACCAGACACGG - Intergenic
1076725493 10:132411031-132411053 CAGGAAACTCACAGAAGACAAGG - Intronic
1076982268 11:210918-210940 CTGGAAACCCAGACCAGCCTAGG - Intronic
1077023352 11:429462-429484 CGGGACACACACCTCAGACACGG + Intronic
1082871767 11:57949615-57949637 CTGGAAACCGGCACAAGACAAGG - Intergenic
1082875909 11:57988514-57988536 CTGGAAACCGGCACAAGACAAGG - Intergenic
1083532226 11:63434364-63434386 CTGAAAACTGACACAAGACAAGG + Intergenic
1084314281 11:68335379-68335401 TTAGAAACACACATAAGACAAGG - Intronic
1084402216 11:68951204-68951226 CTGGAGCCACACACCACACCTGG - Intergenic
1085175051 11:74478571-74478593 ATGGAAACACACATAAAACAAGG - Intergenic
1085258983 11:75193554-75193576 CGGGCATCACACACCAGACCAGG + Exonic
1085409772 11:76284187-76284209 ATGAAACCACAGACCAGACAGGG - Intergenic
1086914743 11:92516565-92516587 TTGAAAACCCACACAAGACAAGG + Intronic
1086995085 11:93347107-93347129 TTGAAAACAGACACAAGACAAGG - Intronic
1087168428 11:95026553-95026575 CTGGAAACACAGGCAAGACTTGG + Exonic
1088384074 11:109232998-109233020 GAGGAAACACAGAGCAGACAGGG - Intergenic
1088713985 11:112532666-112532688 ACAGAAACACACACAAGACAAGG - Intergenic
1090220801 11:125022555-125022577 TTGGAAAAACACACAAGAGATGG - Intronic
1091164399 11:133460608-133460630 CTAGAAACACACACCTTACCAGG + Intronic
1091731198 12:2882041-2882063 CTGGAAAGACACAACAGAGCAGG - Intronic
1094816850 12:34195655-34195677 CTTGAAACCCACACAAGACAAGG + Intergenic
1095100189 12:38173516-38173538 CTGGAAACCCACACAAGACAAGG - Intergenic
1096962475 12:55593872-55593894 TTGAAAACTCACACAAGACAGGG + Intergenic
1097181111 12:57172536-57172558 CTGGAGGCACACTCCAGGCAAGG - Intronic
1100072046 12:90733736-90733758 CTGAAAACACAAACCTGAAAAGG - Intergenic
1101485958 12:105160140-105160162 CTGGAAATACTCACCAGAGGGGG - Exonic
1102302839 12:111783394-111783416 CAGGGAACACACATCTGACACGG + Intronic
1102520423 12:113474698-113474720 CTGGAAACACACACCAGACAGGG - Intergenic
1102590002 12:113949813-113949835 AGGGAAACACACAGCAGGCACGG - Intronic
1103587968 12:121970271-121970293 TTGGAAACAGATGCCAGACAAGG - Intronic
1104711484 12:130989942-130989964 CTGGAAACACACTCAACACGTGG + Intronic
1105329061 13:19397839-19397861 CTGGAAACTTACACCAGAACTGG + Intergenic
1105459220 13:20567618-20567640 CTGGAATCGCACAGCAGAGATGG + Intronic
1105862800 13:24431446-24431468 CTGGAAACTTACACCAGAACTGG - Exonic
1107794058 13:44031728-44031750 CTGCTCACACACACCATACAGGG + Intergenic
1108262370 13:48671341-48671363 TTGAAAATACACACAAGACAAGG - Intronic
1109419279 13:62089364-62089386 TTGGGAACACACGCCAGAAAGGG - Intergenic
1110117218 13:71834342-71834364 AGGGAAGCACACACCAGAAATGG + Intronic
1111596106 13:90413079-90413101 CTGGAAAAACACAGCACACCAGG + Intergenic
1112138183 13:96607314-96607336 AGGGAAAAACACACGAGACATGG + Intronic
1112360268 13:98710984-98711006 CTGGAAACACACTCCTCACCTGG - Intronic
1113634519 13:111910456-111910478 CTAGGACCACACACCAGAGAGGG + Intergenic
1114334986 14:21679692-21679714 CTGTAAAGACAGAACAGACAAGG - Intergenic
1114616632 14:24071946-24071968 CTGGAAACGGACACACGACATGG + Intronic
1114700574 14:24674056-24674078 CTGTAATCACACACCCCACATGG - Intergenic
1116274157 14:42808654-42808676 CAGGAATGACAAACCAGACAAGG - Intergenic
1117996814 14:61485479-61485501 CTGGATACAAACACAAGAGAGGG - Intronic
1118097171 14:62550077-62550099 CTGGATACCAAAACCAGACAAGG + Intergenic
1118451324 14:65905107-65905129 CTAGAAACACACACTTGACCTGG - Intergenic
1118464544 14:66019084-66019106 CTGAAAACATAACCCAGACAGGG + Intergenic
1118633334 14:67725672-67725694 GTGGTAACACAAGCCAGACATGG - Intronic
1119529588 14:75350408-75350430 CTGTAGAGACACACCAGCCAAGG + Intergenic
1121405161 14:93715409-93715431 CTGGAAACATCCGCCAGAGAGGG + Intergenic
1122915856 14:104858519-104858541 CTGGACACACACATCAGAGCAGG - Intergenic
1124595099 15:31085809-31085831 CTGGACACAGACAGCAGCCAGGG + Intronic
1125350130 15:38758001-38758023 CTGGAAACTTACATCTGACAGGG - Intergenic
1127010084 15:54615714-54615736 CTGGAAACACACAGCAGTTGGGG - Intronic
1127053555 15:55109685-55109707 ATGGAAACAAACAACAAACAAGG - Intergenic
1127189187 15:56511591-56511613 CTGGAAACTGGCACAAGACAGGG - Intergenic
1127873486 15:63092425-63092447 CTGGGCTCACACACCAGGCAGGG - Intergenic
1129191316 15:73939267-73939289 CTGGAAAAACATACCAGCTATGG + Intronic
1129952766 15:79606788-79606810 TTGGAAACACACACCTTCCATGG - Intergenic
1131024609 15:89129494-89129516 CAGGAAACAAACACCAGAGAAGG + Intronic
1131050571 15:89345004-89345026 ATGGAAACACACATAACACAAGG - Intergenic
1132622793 16:875703-875725 CTGGACACACAGCCCAGGCAGGG - Intronic
1132691015 16:1182006-1182028 CCGGAAGCACACAGCAGCCAGGG - Intronic
1132867763 16:2102380-2102402 CAGGAAACACAAAGCGGACATGG + Exonic
1133692037 16:8225193-8225215 CTGAAAACTGACACCACACAGGG - Intergenic
1134112881 16:11526882-11526904 CTGGAAACTCAGACAAGGCAGGG - Intergenic
1136728284 16:32380526-32380548 GTGGAAACACACAGGAGACAGGG - Intergenic
1138189599 16:55003656-55003678 CTGAAAACACAGCCCAGAAATGG + Intergenic
1138339290 16:56278305-56278327 CAGGAAGCTCACACCAGACAAGG - Intronic
1138373808 16:56548616-56548638 CTTGTAACACACACTATACATGG + Intergenic
1139058113 16:63212449-63212471 GTGGAAAGACAACCCAGACATGG + Intergenic
1139573943 16:67829678-67829700 CCGGAAACACAACCCAGACAAGG + Intronic
1140167473 16:72568409-72568431 CTAGAAATACACAGCAGAAACGG + Intergenic
1140210564 16:72966650-72966672 CTGAACACACACACCATTCACGG + Intronic
1140723766 16:77793601-77793623 TTTGAACCACAAACCAGACAAGG - Intronic
1141735044 16:85846751-85846773 CTGGAAACCATCACCAGACCAGG - Intergenic
1142441414 16:90100767-90100789 CTGGAAACACACACCAGCTGTGG - Intergenic
1202998154 16_KI270728v1_random:137228-137250 GTGGAAACACACAGGAGACAGGG + Intergenic
1143805996 17:9427317-9427339 CTGGCATCACACAGCAGACTCGG - Intronic
1144704321 17:17357158-17357180 CTGCAAACAGACACCAGGGAAGG + Intergenic
1144851159 17:18244699-18244721 CCGGACACACACACCTGACTAGG - Exonic
1145056272 17:19706006-19706028 CTGGAAAGACAGACCACACAGGG - Intronic
1145908900 17:28531503-28531525 GTGGACAAACACATCAGACAGGG + Intronic
1148997873 17:51727297-51727319 CTGAAAACACTCATCAGAGATGG - Intronic
1149389223 17:56172850-56172872 CTGGAACCAGCCAGCAGACAGGG + Intronic
1150283653 17:63943706-63943728 CTGGCAGCACACACAGGACAGGG + Intronic
1150346786 17:64410899-64410921 CTGGCCACACAGACAAGACATGG - Intronic
1150635325 17:66909070-66909092 CTGGAAACACAGACCCTAAAGGG + Intergenic
1152110317 17:78354043-78354065 ATGGAAAGACACACCAGGCGCGG + Intergenic
1152224847 17:79087962-79087984 CTGGGACCACACAAGAGACATGG - Intronic
1153245247 18:3066893-3066915 CTGTAACAACACACGAGACACGG + Exonic
1153424754 18:4950110-4950132 CTGAAAACCAACACAAGACAAGG + Intergenic
1154500948 18:14997761-14997783 CAGGAAACCCACACGAGCCATGG + Intergenic
1155574442 18:27229457-27229479 CTGGCAAGACACAGCATACATGG - Intergenic
1158747920 18:60223186-60223208 CTTGAAACTAAAACCAGACAAGG - Intergenic
1161517466 19:4704305-4704327 CTGGAAACATACAGGGGACAGGG + Intronic
1161557763 19:4954253-4954275 CTGGAAACCCAGACCTGGCAAGG + Intronic
1161597384 19:5157538-5157560 TTAGACACACACAGCAGACATGG - Intergenic
1162311656 19:9911502-9911524 CAGAAAACACACAGCACACAGGG + Intronic
1163287602 19:16358174-16358196 TTGGAAACACAGACCCGTCAAGG - Intronic
1163410002 19:17148242-17148264 CTGGACACCCAGACAAGACAAGG - Intronic
1165367432 19:35376978-35377000 AGGGAAACAAAGACCAGACAAGG + Intergenic
1166160304 19:40947820-40947842 CTGAAAACTCACACTTGACATGG + Intergenic
1166169189 19:41015454-41015476 CTGAAAACTCACACTTGACATGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
1168712942 19:58512132-58512154 CTGGACCCACACACAAGACCAGG - Intronic
925750531 2:7086676-7086698 CTGGAAACACACAGCTTACTAGG - Intergenic
926275232 2:11398531-11398553 CTGGAAACCGACTCCAGTCAGGG + Intergenic
926433324 2:12813341-12813363 CAGGGAAAACACACCACACATGG - Intergenic
926460482 2:13123904-13123926 CTGGAAACTGGCACAAGACAAGG - Intergenic
926644269 2:15272126-15272148 CTGGTAAAACATACCAGAGAAGG - Intronic
927014984 2:18950347-18950369 CTGGAAACAGCCTCCAGCCAAGG + Intergenic
928865814 2:35916512-35916534 CAGGAACCACACACTGGACAGGG + Intergenic
929567864 2:43000828-43000850 CTGGAAGCCCCCACCAGACTGGG - Intergenic
930017599 2:46981679-46981701 CTGGAGACCCACTCCATACAAGG - Intronic
931558836 2:63534787-63534809 TTGAAAACTCACACAAGACAGGG + Intronic
932290352 2:70571893-70571915 CTGGAAAAACACAAGAGAAAAGG - Intergenic
932294357 2:70611694-70611716 CCATAAACACAAACCAGACATGG + Intronic
934317690 2:91940561-91940583 GTGGAAACACACAGGAGACAGGG + Intergenic
935263478 2:101375138-101375160 GAGGAATCACACACCAGAGAGGG - Intronic
935303532 2:101715203-101715225 CTGGACACAGACACCAGGGAGGG - Intronic
936436560 2:112511948-112511970 ATGGAAACATACTCCAAACATGG - Intronic
938500118 2:131827951-131827973 CAGGAAACCCACACCAGCCATGG + Intergenic
940209454 2:151241597-151241619 ACAGAAACACACACCAAACAAGG - Intergenic
941196187 2:162455002-162455024 TTGGAAACTGACACAAGACAAGG - Intronic
943167360 2:184346737-184346759 TTGGAAACCAGCACCAGACAAGG - Intergenic
943335225 2:186605321-186605343 CAGGAAACACAGCCCAGGCAAGG - Intronic
943770738 2:191713683-191713705 ATGGGAATACACACCAAACATGG - Intergenic
948087274 2:235262026-235262048 ACGGAAACACACACAAAACAAGG - Intergenic
948654400 2:239467585-239467607 CCAAAAACACACACCACACATGG - Intergenic
1168981625 20:2008868-2008890 CTGAAAACACAAGACAGACAGGG - Intergenic
1169607675 20:7340600-7340622 CTGGGTACAAAAACCAGACAAGG + Intergenic
1170707422 20:18757336-18757358 TTGAAAACTCACACAAGACAGGG - Intronic
1171001247 20:21417912-21417934 TTGAAAACCCACACAAGACAAGG + Intergenic
1171165412 20:22966156-22966178 CTTCTAACACAGACCAGACAAGG + Intergenic
1171216263 20:23354773-23354795 CTGGTCAAACACATCAGACAGGG - Exonic
1171778782 20:29398131-29398153 CTTGAAACCCGCACAAGACAAGG + Intergenic
1171820564 20:29833435-29833457 CTTGAAACCCACACAAGACAAGG + Intergenic
1171822847 20:29870583-29870605 CTTGAAACCCGCACAAGACAAGG + Intergenic
1171897270 20:30819735-30819757 CTTGAAACCCACACAAGACAAGG - Intergenic
1172393195 20:34580563-34580585 CTGGACACCCACAGCAGGCAAGG + Intronic
1173056259 20:39616228-39616250 CTGGAAATAAACAGCAAACAGGG - Intergenic
1173683528 20:44905849-44905871 CTGGAAACAGCTAACAGACAGGG + Intronic
1175072712 20:56347757-56347779 CTGGAAACACACACCGCAAGCGG + Intergenic
1175269423 20:57723417-57723439 CTGGAAGCAGAGACCAGGCAGGG + Intergenic
1175405507 20:58723407-58723429 CTGGAAACTCTCCCCAGGCAGGG - Intergenic
1175810929 20:61856905-61856927 CTGGAAACACATCTCAGCCAGGG - Intronic
1177003973 21:15648081-15648103 CAGGAAGCCCTCACCAGACATGG + Intergenic
1178438568 21:32580725-32580747 CAGGAAACAGAACCCAGACAAGG + Intronic
1179680643 21:43018763-43018785 CTGATAACACACACCAAAGACGG - Intronic
1180305859 22:11124230-11124252 GTGGAAACACACAGGAGACAGGG + Intergenic
1180324596 22:11358384-11358406 CTTGAAACCCACACAAGACAAGG + Intergenic
1180544378 22:16486413-16486435 GTGGAAACACACAGGAGACAGGG + Intergenic
1181090488 22:20469212-20469234 ATGGAAACACAGAACAGAGATGG + Intronic
1181715405 22:24723610-24723632 CTGGAAACACACAAAAGTCTAGG + Intronic
1183844902 22:40534764-40534786 CTAGATAAACACACCAAACATGG - Intronic
1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG + Intergenic
949834687 3:8255068-8255090 CTGCCAACACACAGCAGCCAGGG - Intergenic
950667975 3:14508718-14508740 CAGAAAACTCACACCAGATACGG + Intronic
951188622 3:19743332-19743354 CTGGAATAAGAAACCAGACAAGG + Intergenic
951316431 3:21193390-21193412 CTGGAAACAGAGACTAGAGAGGG + Intergenic
953722377 3:45367767-45367789 TTGGAAACACACAAAAGACAAGG - Intergenic
954116362 3:48468964-48468986 CAGGACACACACAGCACACATGG + Exonic
954116369 3:48469004-48469026 CTGGACACACACAGCACACATGG + Exonic
954157431 3:48694241-48694263 CTGGAAAAAAACAACAGAGAAGG + Intronic
954374771 3:50188486-50188508 CTGACAACACACATCAGAAAAGG - Exonic
955645508 3:61133288-61133310 CAGGAACCACAAAACAGACATGG - Intronic
955676656 3:61456083-61456105 ATGGATACACACACCACAAACGG - Intergenic
956244161 3:67162385-67162407 CTGGAAAGATGCACTAGACAGGG - Intergenic
956385189 3:68709753-68709775 CTTGACACCCAAACCAGACAAGG - Intergenic
957086360 3:75682423-75682445 CTTGAAACCCGCACAAGACAAGG - Intergenic
957305693 3:78456063-78456085 GTGGAAGCACAAACCAGTCAGGG - Intergenic
959132343 3:102372554-102372576 GTGGAATTACACACCAGATAAGG - Intronic
959980823 3:112515029-112515051 AAGCAAACACACACCATACATGG - Intergenic
962130165 3:132664083-132664105 CAGGAAAAACAAACCAAACAAGG + Intronic
963303525 3:143624692-143624714 CTGAAAACTGACACAAGACAGGG + Intronic
963307217 3:143666411-143666433 CTGAAAACTGACACAAGACAGGG + Intronic
963439406 3:145318241-145318263 CTTGAAACGCAAACCAGACAAGG - Intergenic
963792001 3:149592953-149592975 ATTGAAAAACACACCAGAGATGG + Intronic
965690740 3:171354294-171354316 TTGGAAACAGACACCAGCCACGG + Intronic
966365418 3:179181123-179181145 CTGTCACCACACACCAGATATGG + Intronic
968361675 3:198151743-198151765 CTGGAAACACACACCAGCTGTGG - Intergenic
970178483 4:13363214-13363236 CTGAATACACACACCACAGATGG + Intronic
970246668 4:14071429-14071451 CTGGAAACAGATACCAGCAAAGG + Intergenic
970509793 4:16770211-16770233 CATGTAAAACACACCAGACATGG - Intronic
972583580 4:40416647-40416669 CTGGAAAGACATGCCAGTCAAGG - Intergenic
972880082 4:43411675-43411697 CTGGACACTAAGACCAGACAAGG + Intergenic
973036690 4:45416126-45416148 CTGGAATAACACACCAAATAAGG - Intergenic
973131923 4:46658480-46658502 CAGGAAACACACAGCAGTCACGG + Intergenic
973148005 4:46853064-46853086 CTAGAAACACACATAAAACAAGG + Intronic
975010957 4:69350763-69350785 CTGTAATCCCACAACAGACAAGG - Intronic
975420291 4:74156847-74156869 CTGAAAACACCCACCAAAAAAGG - Intronic
976527494 4:86111291-86111313 CTGAAAACTGACACAAGACAAGG - Intronic
977632563 4:99259537-99259559 TTGAAAACCAACACCAGACAAGG - Intergenic
977856369 4:101899776-101899798 CTAGAATCACTCCCCAGACAAGG + Intronic
977950161 4:102961849-102961871 GTGGAAACACGCAGAAGACATGG + Intronic
977973699 4:103240146-103240168 TTGGAAACTGACACAAGACAGGG - Intergenic
978156414 4:105494160-105494182 TTGAAAACTCACACAAGACAAGG - Intergenic
980333277 4:131437121-131437143 CTGGAAACCAGCACAAGACAAGG - Intergenic
980414078 4:132461825-132461847 TTGGAAACTGACACAAGACAGGG + Intergenic
980525143 4:133980532-133980554 ATGCACACACACACGAGACAGGG + Intergenic
980772379 4:137393193-137393215 CTGAACACACACACCAGGCGGGG - Intergenic
981601371 4:146492408-146492430 CTGGCAACACACTCCAGCCTGGG - Intronic
982070381 4:151689064-151689086 CAGGTTACACACAGCAGACACGG - Intronic
984324557 4:178235610-178235632 CTGAAAACTAACACAAGACAAGG - Intergenic
985249414 4:188008329-188008351 CTGGAAAAATAAACCAAACATGG - Intergenic
985534335 5:455158-455180 CTGCTGACACACACCAGGCACGG - Intronic
985544042 5:500430-500452 CAGGAAACACACACCAAGCACGG + Intronic
987692365 5:21283456-21283478 CTGGAAACCCACCCCTGAAACGG + Intergenic
991775596 5:70081927-70081949 TTGAAAACACGCACAAGACAGGG - Intergenic
991799568 5:70346442-70346464 CTGGAAACCCACCCCTGAAACGG - Intergenic
991829029 5:70663596-70663618 CTGGAAACCCACCCCTGAAACGG + Intergenic
991854888 5:70957381-70957403 TTGAAAACACGCACAAGACAGGG - Intergenic
991891927 5:71345871-71345893 CTGGAAACCCACCCCTGAAACGG - Intergenic
992785216 5:80163842-80163864 CTGAAAACCAAAACCAGACAAGG - Intronic
994576659 5:101587382-101587404 TTGAAAACTCACACAAGACAGGG + Intergenic
995008123 5:107226331-107226353 ATGAAAACAGACACAAGACAAGG - Intergenic
995548587 5:113257227-113257249 CTGGACCCACACACCAGACTGGG - Intronic
995670945 5:114602057-114602079 TTGAAAACCCACACAAGACAAGG + Intergenic
996711179 5:126545224-126545246 CTGGAAAGACATACCATACATGG + Intronic
996874042 5:128222187-128222209 CTGGAAACCCACCCCTGAAATGG + Intergenic
997600764 5:135136881-135136903 GAGGAAACACACACAAAACATGG - Intronic
997851860 5:137340107-137340129 ATTAAAACACACACCAGAAAAGG + Intronic
998645607 5:144058285-144058307 TTGAAAACAGACACAAGACAAGG + Intergenic
998925526 5:147120188-147120210 CTGGAAACATACAACCGACCAGG - Intergenic
1000339547 5:160266581-160266603 CTGGAAACCCACACCTCATAGGG + Intronic
1001415658 5:171543389-171543411 CTGGAACCCCAAACCAAACATGG + Intergenic
1002063262 5:176639210-176639232 CAGGAAATACACAGCAGCCAAGG + Intronic
1003022440 6:2522507-2522529 CTGAAAACACAAACCAACCAAGG + Intergenic
1006015600 6:31078391-31078413 CTGGAGAAACTGACCAGACAAGG + Intergenic
1008129964 6:47710081-47710103 ATAGAAACACACATCAAACAAGG + Intronic
1008541161 6:52547432-52547454 CTTGATACACACACCAGCTATGG + Intronic
1010649470 6:78434517-78434539 GTGTAAACATTCACCAGACATGG - Intergenic
1012960616 6:105617835-105617857 CTGGAGCCACTCTCCAGACACGG + Intergenic
1014864370 6:126509601-126509623 TTGAAAACCCACACAAGACAAGG + Intergenic
1016790014 6:148058596-148058618 TTGAAAACCCACACAAGACAAGG - Intergenic
1016805699 6:148210235-148210257 CTGCAAAAACAGACCAGGCATGG + Intergenic
1017923018 6:158887599-158887621 CTGGAAACAGACACTAGAGAGGG + Intronic
1018139296 6:160811977-160811999 CCAGAAACACACACAAAACAAGG - Intergenic
1019047944 6:169162515-169162537 CTGGAGACACACTCCTGAGAGGG - Intergenic
1019078801 6:169413184-169413206 CTGCAATCACACTTCAGACAAGG + Intergenic
1019254009 7:36979-37001 CTGGAAACACACACCAGCTGTGG + Intergenic
1021668457 7:23012375-23012397 CTGGATACAGACACCCGATAAGG - Intronic
1022780360 7:33575982-33576004 TTGAAAACACGCACAAGACAAGG + Intronic
1023857308 7:44192577-44192599 CTTGAAACAAAAACCAGACACGG + Intronic
1024571321 7:50725004-50725026 CTGGAAAAACACTCCCGGCAAGG + Intronic
1026931533 7:74225454-74225476 CTGGAAACAGACAGGAGGCAGGG + Intronic
1028779159 7:94716176-94716198 TTGGAAACAGGCACAAGACAAGG - Intergenic
1030705259 7:112686115-112686137 TTGAAAACCCACACAAGACATGG - Intergenic
1030806358 7:113924657-113924679 CTGGAATCACACACAAGTCAAGG - Intronic
1032376608 7:131425900-131425922 CCAGAAACAGACACCAGAAAAGG - Intronic
1032580632 7:133100055-133100077 CTGGCAGCACCCACCAGACCTGG + Intergenic
1033158739 7:138979039-138979061 CTGGAAACACAGAGCAGTGAAGG - Intronic
1034255440 7:149722351-149722373 CTGGAAAATCACACCAGATCTGG - Intronic
1034732806 7:153402794-153402816 CGGGAGACACACAACACACATGG - Intergenic
1035093788 7:156335388-156335410 ACAGAAACACACACCAAACATGG - Intergenic
1035487385 7:159236742-159236764 CTGGAAACACAAATCAGATGTGG + Intergenic
1036042609 8:5102545-5102567 CTGGAAATACACTTCAGATAAGG + Intergenic
1036766271 8:11551092-11551114 CTGAAAAAACAGACAAGACATGG - Intronic
1037436539 8:18869560-18869582 CAGGAAGCACACACTAGTCAGGG + Intronic
1038821371 8:30955137-30955159 CAGAACACACTCACCAGACATGG - Intergenic
1038886277 8:31666300-31666322 CAGGAAACACAAATCAGAGAGGG - Intronic
1039633687 8:39140239-39140261 TTGAAAACCCACACAAGACAAGG - Intronic
1040087971 8:43365418-43365440 ATGTAAACACACACCAGCAAAGG - Intergenic
1040618595 8:49064331-49064353 CAGGAAACACAGGCCAGAGAGGG + Intronic
1040648824 8:49428075-49428097 CTGGAAAAGCACAAGAGACAGGG - Intergenic
1041847838 8:62352039-62352061 CTGGCAACACTAACCAGGCAGGG + Intronic
1041866796 8:62582964-62582986 CGGGACACAAACACCAGGCAAGG - Intronic
1042384114 8:68152707-68152729 CTGGAAACACTGACCAGCAAGGG + Intronic
1045242129 8:100411843-100411865 CTGGAAACAAAAACCAGAGCTGG - Intergenic
1045673129 8:104579007-104579029 CTGAAAACCGACACAAGACAAGG + Intronic
1046399485 8:113686219-113686241 ATGAAAACACACACAATACAAGG + Intergenic
1047201649 8:122772391-122772413 CTGGCATCCCCCACCAGACAAGG - Intergenic
1048692148 8:136978364-136978386 CTGGAAACACACACAGGTTACGG + Intergenic
1049459757 8:142720709-142720731 CAGGAGAAACACTCCAGACAAGG + Intergenic
1049473342 8:142785915-142785937 CTTGCAACACACCCTAGACAGGG - Intronic
1049985937 9:951351-951373 CTGGAAACACAGACCAGACATGG + Intronic
1050011714 9:1191873-1191895 CTGGAAACTGGCACAAGACAGGG - Intergenic
1050327949 9:4515865-4515887 CTGGAAACACACAGGACAGAAGG - Intronic
1051078121 9:13264800-13264822 CTGTTAACTCACACCAAACATGG + Intronic
1051276601 9:15404907-15404929 TTGGAAGCAAACACCAGAAATGG - Intergenic
1051366667 9:16326113-16326135 CTGGCAGCACACAGCAGCCACGG + Intergenic
1051831259 9:21280319-21280341 CTGAAAACACACCCCTGACCAGG - Intergenic
1052678595 9:31658895-31658917 TTGAAAACTCACACAAGACAAGG - Intergenic
1053257120 9:36627015-36627037 CTGGGAACACAAAGAAGACAAGG + Intronic
1053462776 9:38283201-38283223 CGGGAAACAGACCCCAGAGAGGG - Intergenic
1053482680 9:38427573-38427595 CTGAAAACAAACACAACACAGGG + Intergenic
1053749836 9:41241554-41241576 CTTGAAACCCGCACAAGACAAGG - Intergenic
1054335969 9:63809717-63809739 CTTGAAACCCGCACAAGACAGGG + Intergenic
1055193855 9:73562639-73562661 TTGAAAACAGACACAAGACAAGG + Intergenic
1055560795 9:77519718-77519740 CTGAAAGCCCAGACCAGACATGG + Intronic
1056782081 9:89558050-89558072 ATAGAAACACACATCAAACAAGG + Intergenic
1059246497 9:112854203-112854225 CTGGAAGCACACACCAGGCTTGG + Intronic
1059320981 9:113469272-113469294 CTGGAAACACGTGCCAGCCAGGG - Intronic
1059725131 9:117001015-117001037 CTGGAAAAACACACTGGAAATGG + Intronic
1061365331 9:130169831-130169853 CTGGCAACAAACACCATGCAAGG - Intergenic
1062746389 9:138215564-138215586 CTGGAAACACACACCAGCTGTGG - Intergenic
1203372245 Un_KI270442v1:318944-318966 CTTGAAACCCACACAAGACAAGG + Intergenic
1203375897 Un_KI270442v1:377133-377155 CTTGAAACCCGCACAAGACAAGG + Intergenic
1185669839 X:1799038-1799060 CTGGATACTAACACCAGACTAGG + Intergenic
1186231288 X:7457217-7457239 TTGGAAAGACACACCAGCCATGG - Intergenic
1187359729 X:18614121-18614143 CTGGCAACAAACACCAGAGAGGG - Intronic
1187728675 X:22230842-22230864 TTGGAAACCAGCACCAGACAAGG - Intronic
1187844420 X:23522247-23522269 TTGAAAACTCACACAAGACAGGG + Intergenic
1190459117 X:50653630-50653652 TTGAAAACCCACACAAGACAAGG - Intronic
1191049313 X:56174160-56174182 TTGAAAACTCACACAAGACAGGG - Intergenic
1191132936 X:57034113-57034135 TTGAAAACCCACACAAGACAAGG - Intergenic
1191720275 X:64223283-64223305 CTGGAATCACACAGCAGAATTGG - Intergenic
1192296789 X:69858293-69858315 TTGAAAACACTCACAAGACAAGG - Intronic
1192741792 X:73900500-73900522 ATGGAAACACAGGCCAGGCATGG + Intergenic
1192920943 X:75705552-75705574 TTGAAAACCAACACCAGACAAGG + Intergenic
1195129697 X:101840256-101840278 CGGGAAACACACCCCAGAGCAGG + Intronic
1195176541 X:102319573-102319595 CGGGAAACACACCCCAGAGCAGG - Intronic
1195182323 X:102367520-102367542 CGGGAAACACACCCCAGAGCAGG + Intronic
1195202408 X:102564265-102564287 CGGGAAACACACACCAGAGCAGG - Intergenic
1195610741 X:106863758-106863780 CTGGAAACACCCAACAGGCAGGG - Intronic
1195989822 X:110671485-110671507 CTGGAAGCCCTCACCAGAAACGG - Intergenic
1197864972 X:131008026-131008048 CTGGAAAAAGACACGGGACAGGG + Intergenic
1200042986 X:153383343-153383365 ATGAAAACACACAACACACATGG + Intergenic
1200778451 Y:7192056-7192078 CTGAAAACTGACACAAGACAGGG - Intergenic
1201066130 Y:10096448-10096470 CTTGAAACCCGCACAAGACAAGG - Intergenic
1201986503 Y:19974572-19974594 CTGGAAGAAAACACCAGACCAGG - Intergenic