ID: 1102526333

View in Genome Browser
Species Human (GRCh38)
Location 12:113514942-113514964
Sequence CTCAGGGACCAGCGCACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102526328_1102526333 -9 Left 1102526328 12:113514928-113514950 CCCACTGTGCCCGGCTCAGGGAC No data
Right 1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG No data
1102526321_1102526333 9 Left 1102526321 12:113514910-113514932 CCGTGCCCTCTGCATCCACCCAC No data
Right 1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG No data
1102526329_1102526333 -10 Left 1102526329 12:113514929-113514951 CCACTGTGCCCGGCTCAGGGACC No data
Right 1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG No data
1102526322_1102526333 4 Left 1102526322 12:113514915-113514937 CCCTCTGCATCCACCCACTGTGC No data
Right 1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG No data
1102526319_1102526333 11 Left 1102526319 12:113514908-113514930 CCCCGTGCCCTCTGCATCCACCC No data
Right 1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG No data
1102526323_1102526333 3 Left 1102526323 12:113514916-113514938 CCTCTGCATCCACCCACTGTGCC No data
Right 1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG No data
1102526318_1102526333 26 Left 1102526318 12:113514893-113514915 CCAGGCTGAATAATTCCCCGTGC No data
Right 1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG No data
1102526320_1102526333 10 Left 1102526320 12:113514909-113514931 CCCGTGCCCTCTGCATCCACCCA No data
Right 1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG No data
1102526325_1102526333 -6 Left 1102526325 12:113514925-113514947 CCACCCACTGTGCCCGGCTCAGG No data
Right 1102526333 12:113514942-113514964 CTCAGGGACCAGCGCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102526333 Original CRISPR CTCAGGGACCAGCGCACAGA GGG Intergenic
No off target data available for this crispr