ID: 1102529995

View in Genome Browser
Species Human (GRCh38)
Location 12:113539280-113539302
Sequence TAGCAATCACACCTCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102529995_1102530001 27 Left 1102529995 12:113539280-113539302 CCAGAGAAGAGGTGTGATTGCTA No data
Right 1102530001 12:113539330-113539352 CTGCCTTGGGTTGGTCTCCCTGG No data
1102529995_1102530002 28 Left 1102529995 12:113539280-113539302 CCAGAGAAGAGGTGTGATTGCTA No data
Right 1102530002 12:113539331-113539353 TGCCTTGGGTTGGTCTCCCTGGG No data
1102529995_1102529998 13 Left 1102529995 12:113539280-113539302 CCAGAGAAGAGGTGTGATTGCTA No data
Right 1102529998 12:113539316-113539338 AGGCACTGCTGCTTCTGCCTTGG No data
1102529995_1102530000 18 Left 1102529995 12:113539280-113539302 CCAGAGAAGAGGTGTGATTGCTA No data
Right 1102530000 12:113539321-113539343 CTGCTGCTTCTGCCTTGGGTTGG No data
1102529995_1102529997 -7 Left 1102529995 12:113539280-113539302 CCAGAGAAGAGGTGTGATTGCTA No data
Right 1102529997 12:113539296-113539318 ATTGCTAGTTAGGTCAAAAAAGG No data
1102529995_1102530005 30 Left 1102529995 12:113539280-113539302 CCAGAGAAGAGGTGTGATTGCTA No data
Right 1102530005 12:113539333-113539355 CCTTGGGTTGGTCTCCCTGGGGG No data
1102529995_1102530003 29 Left 1102529995 12:113539280-113539302 CCAGAGAAGAGGTGTGATTGCTA No data
Right 1102530003 12:113539332-113539354 GCCTTGGGTTGGTCTCCCTGGGG No data
1102529995_1102529999 14 Left 1102529995 12:113539280-113539302 CCAGAGAAGAGGTGTGATTGCTA No data
Right 1102529999 12:113539317-113539339 GGCACTGCTGCTTCTGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102529995 Original CRISPR TAGCAATCACACCTCTTCTC TGG (reversed) Intergenic