ID: 1102530568

View in Genome Browser
Species Human (GRCh38)
Location 12:113543491-113543513
Sequence ATCCCCCGATTTCAGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102530568_1102530576 3 Left 1102530568 12:113543491-113543513 CCAGCTCTCTGAAATCGGGGGAT No data
Right 1102530576 12:113543517-113543539 GGGTGGGGTTATCTAAAAGGCGG No data
1102530568_1102530575 0 Left 1102530568 12:113543491-113543513 CCAGCTCTCTGAAATCGGGGGAT No data
Right 1102530575 12:113543514-113543536 GTGGGGTGGGGTTATCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102530568 Original CRISPR ATCCCCCGATTTCAGAGAGC TGG (reversed) Intergenic
No off target data available for this crispr