ID: 1102534809

View in Genome Browser
Species Human (GRCh38)
Location 12:113573531-113573553
Sequence CTGTCACAACATTGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102534809_1102534819 29 Left 1102534809 12:113573531-113573553 CCCTAGAGCCAATGTTGTGACAG No data
Right 1102534819 12:113573583-113573605 CCAGTGGCTTCCATGAGCTCAGG No data
1102534809_1102534816 13 Left 1102534809 12:113573531-113573553 CCCTAGAGCCAATGTTGTGACAG No data
Right 1102534816 12:113573567-113573589 TGGATGGTGAATCAGCCCAGTGG No data
1102534809_1102534813 -3 Left 1102534809 12:113573531-113573553 CCCTAGAGCCAATGTTGTGACAG No data
Right 1102534813 12:113573551-113573573 CAGCCATGCACTCACCTGGATGG No data
1102534809_1102534812 -7 Left 1102534809 12:113573531-113573553 CCCTAGAGCCAATGTTGTGACAG No data
Right 1102534812 12:113573547-113573569 GTGACAGCCATGCACTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102534809 Original CRISPR CTGTCACAACATTGGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr