ID: 1102536177

View in Genome Browser
Species Human (GRCh38)
Location 12:113583186-113583208
Sequence CACAGCTCTGCAGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102536171_1102536177 -7 Left 1102536171 12:113583170-113583192 CCTTGGCCCAAGGACACACAGCT No data
Right 1102536177 12:113583186-113583208 CACAGCTCTGCAGTGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102536177 Original CRISPR CACAGCTCTGCAGTGGTGGA GGG Intergenic
No off target data available for this crispr