ID: 1102536510

View in Genome Browser
Species Human (GRCh38)
Location 12:113585553-113585575
Sequence TGTGCGGAAGACTCAGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102536505_1102536510 15 Left 1102536505 12:113585515-113585537 CCAAGATAGGAGAGTGAAATTAA No data
Right 1102536510 12:113585553-113585575 TGTGCGGAAGACTCAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102536510 Original CRISPR TGTGCGGAAGACTCAGCTGT TGG Intergenic
No off target data available for this crispr