ID: 1102538937

View in Genome Browser
Species Human (GRCh38)
Location 12:113604220-113604242
Sequence CACTCAAGGCCTTTAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102538937_1102538942 -5 Left 1102538937 12:113604220-113604242 CCCTTTGCTAAAGGCCTTGAGTG No data
Right 1102538942 12:113604238-113604260 GAGTGGCAGCAGAGTTGGTGAGG No data
1102538937_1102538940 -10 Left 1102538937 12:113604220-113604242 CCCTTTGCTAAAGGCCTTGAGTG No data
Right 1102538940 12:113604233-113604255 GCCTTGAGTGGCAGCAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102538937 Original CRISPR CACTCAAGGCCTTTAGCAAA GGG (reversed) Intergenic
No off target data available for this crispr