ID: 1102539057

View in Genome Browser
Species Human (GRCh38)
Location 12:113605327-113605349
Sequence CTTTTTGCAGAGATGGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102539051_1102539057 -3 Left 1102539051 12:113605307-113605329 CCTGGCTAATTTTTGTTTATCTT No data
Right 1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG No data
1102539050_1102539057 2 Left 1102539050 12:113605302-113605324 CCATGCCTGGCTAATTTTTGTTT 0: 279
1: 24580
2: 61880
3: 129800
4: 170754
Right 1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102539057 Original CRISPR CTTTTTGCAGAGATGGGGCG GGG Intergenic
No off target data available for this crispr