ID: 1102542278

View in Genome Browser
Species Human (GRCh38)
Location 12:113630067-113630089
Sequence CACTGATGATACCTTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 412}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102542278_1102542282 4 Left 1102542278 12:113630067-113630089 CCAGAATCAAGGTATCATCAGTG 0: 1
1: 0
2: 5
3: 51
4: 412
Right 1102542282 12:113630094-113630116 ATTCCTTCCTGGAGGCTCTAGGG 0: 3
1: 28
2: 125
3: 331
4: 748
1102542278_1102542280 -4 Left 1102542278 12:113630067-113630089 CCAGAATCAAGGTATCATCAGTG 0: 1
1: 0
2: 5
3: 51
4: 412
Right 1102542280 12:113630086-113630108 AGTGCTACATTCCTTCCTGGAGG 0: 1
1: 0
2: 11
3: 84
4: 357
1102542278_1102542286 7 Left 1102542278 12:113630067-113630089 CCAGAATCAAGGTATCATCAGTG 0: 1
1: 0
2: 5
3: 51
4: 412
Right 1102542286 12:113630097-113630119 CCTTCCTGGAGGCTCTAGGGGGG 0: 3
1: 3
2: 6
3: 64
4: 343
1102542278_1102542283 5 Left 1102542278 12:113630067-113630089 CCAGAATCAAGGTATCATCAGTG 0: 1
1: 0
2: 5
3: 51
4: 412
Right 1102542283 12:113630095-113630117 TTCCTTCCTGGAGGCTCTAGGGG 0: 2
1: 41
2: 144
3: 357
4: 880
1102542278_1102542279 -7 Left 1102542278 12:113630067-113630089 CCAGAATCAAGGTATCATCAGTG 0: 1
1: 0
2: 5
3: 51
4: 412
Right 1102542279 12:113630083-113630105 ATCAGTGCTACATTCCTTCCTGG 0: 1
1: 0
2: 3
3: 24
4: 183
1102542278_1102542281 3 Left 1102542278 12:113630067-113630089 CCAGAATCAAGGTATCATCAGTG 0: 1
1: 0
2: 5
3: 51
4: 412
Right 1102542281 12:113630093-113630115 CATTCCTTCCTGGAGGCTCTAGG 0: 3
1: 27
2: 130
3: 310
4: 990
1102542278_1102542288 26 Left 1102542278 12:113630067-113630089 CCAGAATCAAGGTATCATCAGTG 0: 1
1: 0
2: 5
3: 51
4: 412
Right 1102542288 12:113630116-113630138 GGGGAGTCCATTAATGTAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 63
1102542278_1102542284 6 Left 1102542278 12:113630067-113630089 CCAGAATCAAGGTATCATCAGTG 0: 1
1: 0
2: 5
3: 51
4: 412
Right 1102542284 12:113630096-113630118 TCCTTCCTGGAGGCTCTAGGGGG 0: 1
1: 4
2: 21
3: 72
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102542278 Original CRISPR CACTGATGATACCTTGATTC TGG (reversed) Intergenic
900779421 1:4608053-4608075 CCCTGCCGATGCCTTGATTCTGG - Intergenic
900793811 1:4695621-4695643 CCCTGCAGACACCTTGATTCTGG - Intronic
902086500 1:13866987-13867009 CCCTGCTGATACCTTGACTTAGG - Intergenic
905498200 1:38413262-38413284 CCCTGCTGATACCTTGATTTTGG - Intergenic
905836405 1:41125878-41125900 CAATGACGACACCTTGATTTTGG - Intronic
907108479 1:51905485-51905507 CCCTGTTGACACCTTGATTTTGG - Intergenic
907792128 1:57677193-57677215 TCCTGATGATACCTTGATCTTGG + Intronic
907820078 1:57958688-57958710 CCCTGCTGAAACCTTGATTGTGG - Intronic
908367277 1:63438558-63438580 CCTAGATGATACCTTGAATCAGG - Exonic
908746371 1:67380688-67380710 CCCTGCTGACACCTTGATTTTGG - Intronic
909461263 1:75917129-75917151 CCCTGGTGACACCTTGATTTTGG + Intergenic
910211388 1:84797337-84797359 CCCTGCTGACACCTTGATTTCGG - Intergenic
910310978 1:85824301-85824323 CCCTGTTGATCCCTTGATTTTGG + Intronic
910691569 1:89970747-89970769 CGCTGCTAATACCTTGATCCAGG + Intergenic
910791950 1:91060562-91060584 CACTGCCAATACCTTGATTTAGG + Intergenic
911018600 1:93363437-93363459 CCCTGCTGATACTTTGATTTAGG - Exonic
911059732 1:93737573-93737595 CCCTGCTGACATCTTGATTCTGG + Intronic
912143200 1:106757019-106757041 CCCTGCTGATACCTTGACTTTGG + Intergenic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
916971669 1:170026198-170026220 GCCTGATGATACCTTGACTTTGG + Intronic
917131433 1:171746176-171746198 CCCTGATGACTCCTTGATCCTGG + Intergenic
917505394 1:175622746-175622768 CCCTGCTAATACCTTGATTTAGG - Intronic
917767126 1:178233038-178233060 CTCTGATGATACTTTGCTTCAGG + Intronic
918527086 1:185476735-185476757 CTCTCATGACACTTTGATTCTGG - Intergenic
918587992 1:186209810-186209832 CCCTGCTGACACCTTGATTTTGG + Intergenic
920718135 1:208360640-208360662 CCCTGCTGATACCTTGATTTTGG + Intergenic
921401653 1:214730349-214730371 AACTGATTACACCTTGATTTTGG + Intergenic
921464660 1:215472920-215472942 CAGTGATGTTATCTTGCTTCTGG + Intergenic
922901448 1:229139987-229140009 CTCTGCTGATGCCTTGATTTTGG - Intergenic
923720832 1:236465261-236465283 CCCTGAGGATACCCTGCTTCAGG + Intronic
924698934 1:246430298-246430320 CTCTGATGTTATCTTGATGCTGG - Intronic
924797593 1:247303272-247303294 CTCTGCTGAAGCCTTGATTCTGG + Intronic
1062950073 10:1492505-1492527 TCCTGCTGACACCTTGATTCTGG + Intronic
1063284513 10:4670909-4670931 CCCTGATGACACCTTGATTTTGG - Intergenic
1064232690 10:13543367-13543389 CACTGAGGCTACCTTAATCCTGG - Intergenic
1064545188 10:16443165-16443187 CACTGCTGACACCTTGATCTGGG - Intronic
1064703675 10:18048188-18048210 CCCTGATGAGACCTGGATTTTGG + Intergenic
1067550835 10:47234815-47234837 CCCTGCTGATGCCTTGATTTTGG + Intergenic
1068350660 10:55840157-55840179 CCCTGATGAAACCTTGATCCTGG + Intergenic
1068635011 10:59338965-59338987 CCCTGCTGAAACCTTGATTTTGG - Intronic
1068961345 10:62869619-62869641 CCCTGATGACACCTTGACTTTGG + Intronic
1069062343 10:63907058-63907080 GCCTGCTGATACCTTGATTTGGG + Intergenic
1069781343 10:70957803-70957825 CCCTGATGACACCTTGATTTCGG + Intergenic
1070089155 10:73267734-73267756 CATAGATGACACCTTGATTTTGG - Intronic
1071017652 10:81017407-81017429 CCCTGCTGACACCTTGATCCTGG - Intergenic
1072786302 10:98285375-98285397 CTCTGCTGACACCTTGATTTTGG + Intergenic
1075995110 10:126870862-126870884 CACTCATGATACCTTGGTAAAGG + Intergenic
1076635330 10:131878671-131878693 CCCTGCTGACACCTTGATTTTGG - Intergenic
1078375526 11:10790355-10790377 CCCTGCTGACACCTTGATTTTGG - Intergenic
1078928457 11:15894900-15894922 CCCTGCTGACACCTTGATTTTGG - Intergenic
1079142460 11:17821179-17821201 CCCTGCTGACACCTTGATTTTGG + Intronic
1079328430 11:19513959-19513981 CGCTGCTCACACCTTGATTCTGG + Intronic
1079332720 11:19546954-19546976 CACTATTGATACCTGGATTCTGG + Intronic
1080603102 11:33840060-33840082 CCCTGATGATGCTTTGATGCTGG + Intergenic
1080980852 11:37403765-37403787 AACTGATAAAACATTGATTCAGG + Intergenic
1081592273 11:44432595-44432617 CCCTGCTGATACCTTGATCTTGG - Intergenic
1082209966 11:49487630-49487652 TAGTGGTGATAACTTGATTCTGG - Intergenic
1085376093 11:76062027-76062049 CCCTGATGACACTTTGATTTTGG - Intronic
1087191291 11:95257264-95257286 CCCTGCTGATACCTTGATTTTGG + Intergenic
1088332337 11:108666569-108666591 CCCTGCTGACACCTTGATTTTGG - Intronic
1088576727 11:111279420-111279442 CCCTGCTGACACCTTGATTTTGG - Intronic
1088710743 11:112506283-112506305 GCCTGCTGACACCTTGATTCTGG - Intergenic
1089047445 11:115515303-115515325 CTCTGCTGACACCTTGATTTTGG + Intergenic
1089893703 11:121906413-121906435 CCCTGATGACACCTTGATCTTGG + Intergenic
1090546879 11:127775285-127775307 CACTGTTGAGACATTTATTCAGG + Intergenic
1090618791 11:128542486-128542508 CACTGAAGCTAGTTTGATTCAGG + Intronic
1091495590 12:969907-969929 TACTGGTGATAACTTAATTCAGG + Intronic
1091885878 12:4016765-4016787 CACTTATGAAAACTTTATTCAGG + Intergenic
1092907208 12:13112218-13112240 TTCTGCTGATACCTTGATTTTGG + Intronic
1093146768 12:15575746-15575768 CCCTGCTGACACCTTGATTTTGG - Intronic
1094264652 12:28542997-28543019 CCCTGATGACATCTTGATTTGGG - Intronic
1094356301 12:29581677-29581699 CACTGTTAGTACCTTTATTCAGG + Intronic
1094568155 12:31618422-31618444 CACTGATGAAACCCTGACCCAGG + Intergenic
1095544352 12:43347245-43347267 CATTGGTGATGCCTAGATTCAGG - Intergenic
1095872452 12:47044984-47045006 CCCTGCTGACACCTTGATTTTGG - Intergenic
1096655724 12:53090340-53090362 CCCTGCTGACACCTTGATTTTGG + Intergenic
1097408120 12:59216332-59216354 CACTGAGCATACATTGTTTCAGG + Intergenic
1097514982 12:60593998-60594020 CCCTGTTGACACCTTGATTTTGG + Intergenic
1098084778 12:66830546-66830568 CTGTGCTGATACCTTGATTTTGG + Intergenic
1098363536 12:69678768-69678790 CTCTGATTCTACCTTCATTCCGG + Exonic
1098515667 12:71373869-71373891 TCCTGCTGATACCTCGATTCTGG + Intronic
1098626912 12:72682812-72682834 CCCTGTTGACACCTTGATTTTGG + Intergenic
1098718128 12:73858595-73858617 TACTTATGATACCATTATTCTGG - Intergenic
1099298815 12:80865987-80866009 CACTGCTGAATCCTTGATTAAGG - Intronic
1100780398 12:98019578-98019600 CCCTGATGACATCTTGATTTTGG - Intergenic
1100812823 12:98356556-98356578 CACTGATCATTTCTTCATTCTGG - Intergenic
1101016116 12:100502349-100502371 CCCTGCTGACACCTTGATTTTGG - Intronic
1101259853 12:103018078-103018100 CGCTGCTGACACCTTGATTTTGG - Intergenic
1101425596 12:104585761-104585783 CCCTGCTGACACCTTGATTTTGG - Intronic
1101637236 12:106554554-106554576 CCCTGCTGATATCTTGATTTTGG - Intronic
1101702869 12:107191829-107191851 CTCTGCTGACACCTTGATTTTGG - Intergenic
1102348582 12:112175407-112175429 CACTGCTGACACCTTGATCTGGG + Intronic
1102542278 12:113630067-113630089 CACTGATGATACCTTGATTCTGG - Intergenic
1102559276 12:113750549-113750571 CCCTGCTGACACCTTGATTTTGG - Intergenic
1102794461 12:115676406-115676428 CCCTGCTGAAACCTTGATTTTGG - Intergenic
1102879019 12:116470060-116470082 CCCTGAGGACACCTTGATTTTGG + Intergenic
1103300654 12:119924171-119924193 CCCTGCTGACACCTTGATTTGGG - Intergenic
1103601031 12:122054715-122054737 TACTGAAAATACCTTGAATCGGG - Intronic
1103887034 12:124210266-124210288 CCCTGCTGACACCTTGATTTTGG - Intronic
1104011088 12:124930698-124930720 CACTGCTGACCCCTTGATTTTGG - Intergenic
1106389503 13:29321229-29321251 CACTGGGGATACCTTGGTCCAGG + Intronic
1106545606 13:30728264-30728286 CCCTGCTGACACCTTGATTTTGG + Intronic
1106728011 13:32506105-32506127 CACTGCTGACACCTTGATCTTGG - Intronic
1107526355 13:41235712-41235734 CTCTGCTGACACCTTGATTTTGG + Intronic
1107687627 13:42919914-42919936 CCCTGAAGACACCTTGATTTTGG - Intronic
1108014628 13:46061630-46061652 CTCTGCTGGTACCTTGATTTTGG + Intronic
1108207304 13:48103272-48103294 CTCTGTTGACACCTTGATTTTGG + Intergenic
1108458669 13:50643030-50643052 CCCTGCTGACACCTTGATTTTGG + Intronic
1108522362 13:51257979-51258001 CCCTGCTGATGCCTTGATTTTGG - Intronic
1108927035 13:55763294-55763316 CTTTGATGATACTTGGATTCAGG + Intergenic
1109085523 13:57966407-57966429 ATCTGCTGATACCTTGATTTTGG + Intergenic
1109180121 13:59203486-59203508 CCCTGCTGATACATTGATTTTGG + Intergenic
1109957983 13:69593237-69593259 CCCTGCTGAAACCTTGATTCTGG - Intergenic
1110939885 13:81336618-81336640 CCCTGCTGATAGCTTGATTTGGG + Intergenic
1112366157 13:98757216-98757238 TGCTGCTGATACCTTGATTTTGG - Intergenic
1113017210 13:105841061-105841083 CCCTGTTGATACCTTAATTTTGG - Intergenic
1114293864 14:21311820-21311842 CACTCAGGATTCCCTGATTCTGG - Exonic
1114478829 14:23018214-23018236 CACTGCTGATACTTTGATCTTGG + Intronic
1115790272 14:36870329-36870351 CACTGATGACACCTTGATTTTGG - Intronic
1116717255 14:48443185-48443207 CACTGATGATTCCATCATACTGG - Intergenic
1116778645 14:49211539-49211561 CTCTGCTGACACCTTGATTTTGG - Intergenic
1117265642 14:54083650-54083672 CCCTGATGACAACTTGATTTTGG + Intergenic
1118767495 14:68919823-68919845 CACTGATGATACATTAACACCGG + Intronic
1118921242 14:70151722-70151744 TCCTGCTGATACCTTGATTTTGG - Intronic
1121211570 14:92211348-92211370 CCCTGCTGACACCTTGATTTTGG + Intergenic
1121425689 14:93850117-93850139 CCCTGCTGACACCTTGATTTTGG - Intergenic
1122120429 14:99550428-99550450 CCCTGCTGATGCCTTGATTTTGG + Intronic
1122424618 14:101598649-101598671 CACTGAGGACACCGTGATGCAGG - Intergenic
1122703694 14:103607168-103607190 CCCTGCTGACACTTTGATTCCGG + Intronic
1125446161 15:39759671-39759693 CCCTGCTGACATCTTGATTCTGG - Intronic
1127321139 15:57847561-57847583 CCCTGATGATAGTATGATTCTGG + Intergenic
1127912206 15:63426644-63426666 CCCTGCTGACACCTTGATTTGGG - Intergenic
1127978369 15:64015877-64015899 CCCTGCTGACACCTTGATTTTGG + Intronic
1128616191 15:69111861-69111883 CCCTGCTGATACCTTGATCTTGG + Intergenic
1128892470 15:71343452-71343474 CCCTGATGACACCTTGACTTTGG - Intronic
1129189334 15:73928077-73928099 CACTGATGATGCCTGGGTGCGGG - Intronic
1130035274 15:80354710-80354732 CCTTGCTGACACCTTGATTCTGG + Intronic
1130195716 15:81778611-81778633 CACTGCTGACACTTTGATTTCGG - Intergenic
1130200268 15:81819562-81819584 CCCTGTTGACACCTTGATTTTGG - Intergenic
1130671584 15:85917632-85917654 CCCTGCTGATGCCTTGATTTTGG - Intergenic
1130977285 15:88787185-88787207 CCCTGCTGACACCTTGATTTTGG - Intergenic
1132354995 15:101164649-101164671 CCCTGCTGACACCTTGATTTTGG + Intergenic
1132384273 15:101389136-101389158 CCCTGCTGACACCTTGATCCAGG + Intronic
1133299177 16:4771692-4771714 CTCTGTAGACACCTTGATTCTGG + Intergenic
1133741910 16:8658285-8658307 CCCTGCTGACACCTTGATTGCGG + Intergenic
1138239141 16:55412364-55412386 AACTGCTGATACCTTGATTTTGG + Intronic
1138646677 16:58430651-58430673 CCCTGCTGACACCTTGATTTTGG - Intergenic
1139674734 16:68515662-68515684 CTCTGCTGATACCATGATTGTGG - Intergenic
1140141158 16:72259230-72259252 CTCTGCTGACACCTTGATTTTGG + Intergenic
1140715765 16:77724079-77724101 CCCTGCCGATACCTTGATTTTGG - Intronic
1141162854 16:81640586-81640608 CCCTGCTGACACCTTGATTTTGG - Intronic
1141315920 16:82962360-82962382 CCCTGCTGACACCTTGATTTAGG + Intronic
1141794347 16:86260053-86260075 CACAGATGCCACCTTTATTCAGG + Intergenic
1142884078 17:2902028-2902050 CCCTGCTGACACCTTGATTTTGG - Intronic
1145054991 17:19696638-19696660 CCCTGCTGACACCTTGATTTAGG + Intronic
1145275984 17:21430759-21430781 CCCTGCTGACACCTTGATTCCGG + Intergenic
1146874024 17:36393419-36393441 CCCTGATGACACCTTGATCTTGG - Intronic
1146881377 17:36444331-36444353 CCCTGATGACACCTTGATCTTGG - Intergenic
1147065363 17:37919454-37919476 CCCTGATGACACCTTGATCTTGG + Intergenic
1149115260 17:53086390-53086412 CACTGATGACACCTTGATCTTGG + Intergenic
1149314810 17:55428958-55428980 CATTGATGTTGCCTTGGTTCTGG - Intergenic
1150334039 17:64317380-64317402 CATTGCTGACACCTTGATTTTGG + Intergenic
1150375652 17:64679336-64679358 CCCTGCTGACACCTTGATTTTGG + Intergenic
1150684424 17:67309158-67309180 CACTGCTGACACCTTGATTTTGG + Intergenic
1150699884 17:67437467-67437489 CCCTGCTGATACCTTGATTTTGG + Intronic
1152366063 17:79857154-79857176 CCCTGATGACACCTTGATTTAGG + Intergenic
1152987836 18:335652-335674 CACTGCTGACACCTTGATCTTGG + Intronic
1155623885 18:27812692-27812714 CCCTGCTGACACCTTGATTTTGG + Intergenic
1156644147 18:39139686-39139708 CCCTGATGACACCTTGATCTTGG + Intergenic
1156861047 18:41836650-41836672 CACTGCTGATAACTTAGTTCAGG + Intergenic
1157410791 18:47461408-47461430 CCCTGCTGATACCTTAATTTGGG - Intergenic
1158283616 18:55854437-55854459 CTCTGCTGACACCTTGATTTTGG - Intergenic
1158500592 18:57997251-57997273 CCCTGCTGACACCTTGATTTTGG - Intergenic
1158710703 18:59835225-59835247 CATATCTGATACCTTGATTCTGG + Intergenic
1158719914 18:59915617-59915639 CCCTGCTGACACCTTGATTTTGG - Intergenic
1158765052 18:60440802-60440824 CACTGATGGCATCTTGATTCTGG - Intergenic
1159117730 18:64135033-64135055 TACTGCTGATGCCTTGATTTCGG - Intergenic
1159678698 18:71319809-71319831 TGCTGATGATACGTTGATTTTGG + Intergenic
1159703947 18:71663642-71663664 CCCTGCTGACACCTTGATTTTGG + Intergenic
1159823508 18:73176471-73176493 CCCTGCTGACACCTTGATTTTGG + Intronic
1159917848 18:74202138-74202160 CCCTGAGGACACCTTGATTTTGG + Intergenic
1162856603 19:13473444-13473466 CACTGCTGATGCCTTGATTTTGG + Intronic
1163281333 19:16319845-16319867 CCCTGCTGATGCCTTGATTTTGG - Intergenic
1163724863 19:18917007-18917029 CCCTGCTGACACCTTGATTTGGG - Intronic
1166553068 19:43679643-43679665 CCCTGATGACACCTTGATCTTGG + Intergenic
1166584423 19:43933034-43933056 AACTGGTGACACCTTGATTTTGG + Intronic
1167408694 19:49332075-49332097 CCCTGGTGACACCTTGATTTTGG - Intergenic
1167725171 19:51207046-51207068 CTCAGAAGATACCTTGATTCTGG + Intergenic
1167735232 19:51290491-51290513 CACTGCTGACACCTTGATCATGG - Intergenic
925248425 2:2406807-2406829 CCCTGCTGATGCCTTGATTTTGG + Intergenic
926167816 2:10532468-10532490 CCCTGCTGACACCTTGATTTTGG + Intergenic
926357597 2:12055870-12055892 CACTGCTGGCACCTTGATTTTGG - Intergenic
926512821 2:13803526-13803548 CACCGATGACACCCTGATTTTGG + Intergenic
927065387 2:19465543-19465565 CCCTGCTGACACCTTGATTGTGG - Intergenic
927909060 2:26883835-26883857 ACCTGATGAAACCTAGATTCAGG - Intronic
929373052 2:41250078-41250100 CACTGCTGACATCTTGATTTTGG + Intergenic
930217151 2:48708698-48708720 CCCTGCTGACACCTTGATTTTGG + Intronic
930442688 2:51428874-51428896 CCCTGCTGAAACCTTGATTTAGG + Intergenic
931258621 2:60597396-60597418 CCCTGCTGATACCTTGATCTTGG + Intergenic
933296434 2:80496138-80496160 TTCTGATGATAGCTTGATTGTGG + Intronic
933871225 2:86567408-86567430 CCCTGCTGACACCTTGATTTTGG - Intronic
935656730 2:105429598-105429620 CCCTGCTGATACCTTGATTCTGG + Intronic
936025915 2:109031218-109031240 CACTGCTGACACCTTGATGGTGG - Intergenic
937509587 2:122578996-122579018 CCCTGATGATAACTTGATCTTGG + Intergenic
937529036 2:122806651-122806673 CTCTGATGACACTTTGATTTTGG - Intergenic
937565663 2:123284072-123284094 GATTGATCAGACCTTGATTCAGG - Intergenic
937688332 2:124723646-124723668 CCCTGCTGACACCTTGATCCTGG - Intronic
938971532 2:136437584-136437606 CACTGACACTACCTTGATACAGG + Intergenic
939225139 2:139354650-139354672 CACTGCTGACACCTTGATTTTGG + Intergenic
939236249 2:139497727-139497749 CCCTGCTGACACCTTGATTTTGG - Intergenic
939346420 2:140971376-140971398 CCCTGTTGACACCTTGATTTTGG + Intronic
940458991 2:153938654-153938676 CACTGCTGACATCTTGATTTTGG - Intronic
940546735 2:155099053-155099075 CATTGATGACACCTTGATTTTGG - Intergenic
940595824 2:155791445-155791467 CCCTTTTGATACCTTGATTTTGG - Intergenic
940605161 2:155913980-155914002 CCCTGATGACACCTTGATCTTGG - Intergenic
941198271 2:162477276-162477298 CACTGGTGATGCATTCATTCAGG - Intronic
943615863 2:190091889-190091911 CACTCATAATTCCTTTATTCAGG + Intronic
943768185 2:191685619-191685641 AACTGGTGTTCCCTTGATTCAGG - Exonic
944348682 2:198701056-198701078 CTCTGCTGACACCTTGATTTTGG + Intergenic
945469634 2:210212496-210212518 CCCTCCTGATACCTTGATTTGGG + Intronic
945556046 2:211277781-211277803 CCATGTTGATACCTTGATTTTGG - Intergenic
945792808 2:214326369-214326391 CCCTGCTGACACCTTGATTTTGG + Intronic
945892781 2:215447830-215447852 CACTGCTGACATCTTGATTTTGG + Intergenic
946095935 2:217274153-217274175 CCCTGCTGATACCTTGATCCTGG - Intergenic
947112455 2:226733471-226733493 CTTTGATGATATCTTCATTCTGG - Exonic
947356966 2:229306847-229306869 GACTGCTGATACCTTGATTTGGG - Intergenic
947583138 2:231334292-231334314 CCCTAAGGATACCTTGATTTTGG - Intronic
1169243435 20:4004724-4004746 CCCTGCTGACACCTTGATTTTGG + Intronic
1169297935 20:4415907-4415929 CCCTGCTGATACCTTGATTTTGG - Intergenic
1169697837 20:8410984-8411006 CACTGATGACACTTTAATTGTGG + Intronic
1172174446 20:32963597-32963619 CCCTGTTGACACCTTGATTTTGG - Intergenic
1172302258 20:33858453-33858475 CTCTGCTGATACCTAGATTTTGG - Intergenic
1172865966 20:38097616-38097638 CCCTGAAAACACCTTGATTCTGG - Intronic
1173647214 20:44640953-44640975 CTCTGATGATATCTTGATGTTGG + Intronic
1173929450 20:46806632-46806654 CCCTGCTGAAACCTTGATTTTGG - Intergenic
1174202986 20:48820060-48820082 GACAGACGATCCCTTGATTCTGG - Intronic
1174506187 20:51019153-51019175 CCCTGCTGATACCTTGATTTTGG + Intronic
1174633570 20:51979472-51979494 CCTTGCTGATACCTTGATTTCGG + Intergenic
1174954357 20:55080254-55080276 CTCTGCTGATACCTTGATTTTGG + Intergenic
1175089170 20:56487740-56487762 CCCTGATGACACCTTGATTTTGG - Intronic
1176430375 21:6571707-6571729 CCCTGCAGATACCTTGATTTCGG - Intergenic
1177217909 21:18153204-18153226 CTCTGCTGACACCTTGATTTTGG - Intronic
1177483113 21:21719694-21719716 CCCTGATGACACCTTGATCTCGG + Intergenic
1178506493 21:33167152-33167174 CCCTGCTGACACCTTGATTTTGG + Intronic
1178633419 21:34281884-34281906 CGCTGCTGACACCTTGATCCGGG + Intergenic
1179241623 21:39597913-39597935 CACTGATGACATCTTGATTTTGG + Exonic
1179705769 21:43179169-43179191 CCCTGCAGATACCTTGATTTCGG - Intergenic
1181925369 22:26354427-26354449 CCCTGCTGACACCTTGATTTTGG + Intronic
1182234428 22:28864390-28864412 CCCTGGTGACACCTTGATTTAGG + Intergenic
1182789216 22:32935021-32935043 CTCTGCTGAAACCTTGATTTGGG + Intronic
1182962707 22:34490532-34490554 CCCTGCTGACACCTTGATTTTGG + Intergenic
1184605089 22:45568339-45568361 CCCTGCTGACACCTTGATTTTGG - Intronic
1184668550 22:46001148-46001170 AAGTGAGGAAACCTTGATTCTGG - Intergenic
1184743844 22:46444743-46444765 CCCTGCTGATACCTTGATTTTGG - Intronic
1185093666 22:48792799-48792821 CCCTGCTGACAACTTGATTCAGG - Intronic
949316058 3:2756843-2756865 CACTGCTGACAACTTGATTTCGG + Intronic
952180568 3:30912416-30912438 CCCTGCTGATAACTTGATTTTGG - Intergenic
953364232 3:42328513-42328535 CCCTGCTGACACCTTGATTTAGG - Intergenic
953936002 3:47043441-47043463 CACTGCTGACACCTTGATCTTGG + Intronic
955970143 3:64430783-64430805 CCCTAATGACACCTTGATTTTGG + Intronic
956839135 3:73120921-73120943 CACTGCTGACACCCTGATTTGGG + Intergenic
956932736 3:74063913-74063935 CACTGCTGACACCTTGATCTTGG - Intergenic
956979804 3:74622650-74622672 GCCTGCTGATACCTTGATTTTGG + Intergenic
957440198 3:80236449-80236471 CACTATTGACACCTTGATCCTGG - Intergenic
957643571 3:82888873-82888895 CATGGCTGATACCTTGATTTCGG + Intergenic
958476846 3:94595059-94595081 CCCTGCTGATACCTTGATTTTGG - Intergenic
959019866 3:101177342-101177364 CCCTGCTGACACCTTAATTCTGG - Intergenic
959312683 3:104759954-104759976 CCCTGATGACACCTTGATCTTGG + Intergenic
959873467 3:111354641-111354663 CCCGGCTGATACCTTGATTTTGG + Intronic
960252045 3:115466202-115466224 CACTGCTGACACCTTGATCTTGG + Intergenic
960370481 3:116831328-116831350 CCCTCCTGATTCCTTGATTCTGG + Intronic
961342132 3:126233419-126233441 CACTGATGATACCTGGATATTGG - Intergenic
961353949 3:126322282-126322304 CACCGATGGCACCTTCATTCTGG - Intergenic
961927272 3:130494427-130494449 CTCTGCTGACACCTTGATTTTGG + Intergenic
962392877 3:134987863-134987885 CCCTGCTGATACCTTGATCTTGG + Intronic
962686822 3:137855988-137856010 CCCTGCTGACACCTTGATTTCGG - Intergenic
966308289 3:178562868-178562890 CACTGATGAAACCTTGAAGCTGG + Intronic
966660180 3:182405774-182405796 CACTGCTGACACCTTTATTTTGG + Intergenic
966666115 3:182472817-182472839 CTCTGCTGACACCTTGATTTTGG - Intergenic
966796625 3:183720772-183720794 CCCTGTTGACACCTTGATTTTGG - Intronic
967393820 3:188983930-188983952 CCCTGATGATACCTTGGTTTGGG + Intronic
967934964 3:194719762-194719784 CCCTGCTGACACCTTGATTTTGG + Intergenic
969079337 4:4606425-4606447 CTCTGCTGACACCTTGATTCTGG - Intergenic
969978781 4:11132753-11132775 CCCTGCTGACACCTTGATTTTGG - Intergenic
971797068 4:31241937-31241959 CACTGCTGACACCTTGATTTTGG + Intergenic
971853977 4:32020259-32020281 CACTGTTGACACCTTGATCTTGG - Intergenic
971871150 4:32240728-32240750 AACTGAAGATACGTAGATTCTGG - Intergenic
973659933 4:53094329-53094351 CCCTGTTGATACCTTGATCTTGG - Intronic
973955061 4:56055313-56055335 CGCTGATTATTCCTTGAATCCGG - Intergenic
974101187 4:57418935-57418957 CCCTAATGACACCTTGATTTTGG + Intergenic
974493086 4:62591618-62591640 CACTGATAACACTTTGATTTTGG + Intergenic
975187044 4:71415810-71415832 CACTGATGCTTTCTTGATTCAGG + Intronic
976291479 4:83422652-83422674 CATTGCTAATACCTTGATTTTGG + Intronic
976834985 4:89361916-89361938 CCCTGTTGAAACCTTGATTTTGG - Intergenic
977648886 4:99446437-99446459 TCCTGATGATACTTTGATTTTGG + Intergenic
977734097 4:100391082-100391104 CCCTGCTGATGCCTTGATTTTGG - Intergenic
978143210 4:105341424-105341446 CTCTGCTGAAACCTTGATTTTGG - Intergenic
978442417 4:108747615-108747637 CAGTGGTGATATCTGGATTCTGG + Intronic
978446138 4:108781841-108781863 CACTAAGAAAACCTTGATTCAGG + Intergenic
978692509 4:111532197-111532219 CACTGATGGTTCACTGATTCAGG - Intergenic
979199457 4:117959431-117959453 CCCTGAGAACACCTTGATTCTGG + Intergenic
979289109 4:118960159-118960181 CCCTGCTGACACCTTGATTTTGG + Intronic
980083129 4:128365260-128365282 CCCTGCTGACACCTTGATTTTGG - Intergenic
982006704 4:151070488-151070510 CACTGATTTTCCCTAGATTCCGG - Intergenic
984356742 4:178669772-178669794 CCCTGCTGACACCTTGATTGTGG - Intergenic
985986793 5:3522731-3522753 CACTGCTGACACCTTGGTTTTGG + Intergenic
986048245 5:4061898-4061920 CTCTGATGATACATTGATCTTGG + Intergenic
986224708 5:5801834-5801856 CCCTGCTGACACCTTGATTTTGG - Intergenic
986670205 5:10136830-10136852 CCCTGATGACACCTTGATTTTGG - Intergenic
986673873 5:10167108-10167130 CCCTGCTGACACCTTGAATCTGG + Intergenic
987002777 5:13677236-13677258 CTCTGCTGACACCTTGATTTTGG + Intergenic
987263656 5:16229095-16229117 CCCTGCTGATACCTTGATTTTGG - Intergenic
987778720 5:22403593-22403615 CATTGGTGATACTTTGGTTCTGG - Intronic
988173181 5:27685413-27685435 CACTGATGATTCCTTGATTTTGG - Intergenic
988195225 5:27996720-27996742 CACTGATGATATTGTGATTGAGG + Intergenic
988224140 5:28390423-28390445 TGCTGCTGATACCTTGATTTAGG - Intergenic
989729681 5:44633713-44633735 CCCTGCTGACACCTTGATTTTGG + Intergenic
989734274 5:44684436-44684458 CAGTGATGATACCTTAAATAGGG + Intergenic
990161575 5:52946175-52946197 CACTGATCTTATCTAGATTCCGG + Intronic
990341493 5:54827486-54827508 CACTGCTGACACCTTGATGTTGG + Intergenic
990391267 5:55324149-55324171 AACTGATTGTACCTTGACTCTGG - Exonic
990440666 5:55841872-55841894 CACTGCTGACATCTTGATTTTGG - Intergenic
990604335 5:57393950-57393972 CTCTGCTGATACCTTGATTTTGG + Intergenic
991394976 5:66195742-66195764 AACTGATGACAACTTGATGCTGG + Intergenic
991400458 5:66245886-66245908 CACTGCTGACACCTTGATCTTGG - Intergenic
991605623 5:68397678-68397700 CTCTGCTAATACCTTGATTTTGG + Intergenic
992464225 5:76987915-76987937 CCCTGCTGACACCTTGGTTCTGG + Intergenic
992887043 5:81169372-81169394 CCCTGATGACACCTTGGTTTTGG - Intronic
993364709 5:87021209-87021231 CACTGCTGACACCTTTATTTTGG - Intergenic
995541796 5:113192979-113193001 CCCTGATAACACCTTGATTTAGG - Intronic
996019840 5:118578980-118579002 CCCTGATGACACCTTGATCTTGG - Intergenic
996020526 5:118586419-118586441 CCCTGATGACATCTTGATTTTGG + Intergenic
996294781 5:121898725-121898747 CACTGTAGACACCTTTATTCAGG - Intergenic
996810875 5:127515245-127515267 CCCTGCTGACACCTTGATTTTGG + Intergenic
996976022 5:129435752-129435774 CTCTGATGAAACCTTGATTTTGG - Intergenic
997300445 5:132799842-132799864 CCCTGCTGATACCTTGATGTTGG - Intronic
1000122128 5:158207546-158207568 CCCTGTTGTTACCTTGCTTCTGG - Intergenic
1000353053 5:160367619-160367641 CACTGCAGATACCTTGATGATGG + Intronic
1000627578 5:163556842-163556864 CCCTGCTGACACCTTGATTTTGG + Intergenic
1000799032 5:165701320-165701342 CTCTGTTGACACCTTGATTTCGG + Intergenic
1002533496 5:179863408-179863430 CACTGATGACACCTTGGGCCAGG + Exonic
1003050271 6:2774359-2774381 CCTTGTTGATACCTTGATTCTGG - Intronic
1004379836 6:15123279-15123301 CACTGAAGAAACATTGATTAAGG - Intergenic
1004467954 6:15903318-15903340 CCCCAATGACACCTTGATTCTGG + Intergenic
1004690840 6:17990745-17990767 CTCTGCTGACACCTTGATTTGGG + Intergenic
1004775367 6:18838124-18838146 CCCTGCTGACACCTTGATTTTGG + Intergenic
1004884072 6:20035284-20035306 CCCTGATGACACCTTGATCCTGG + Intergenic
1006339146 6:33436880-33436902 CCCTGCTGATACCTTGCTTTTGG - Intronic
1007020798 6:38518965-38518987 CACTGATGATTTCTTTACTCTGG - Intronic
1007496801 6:42265739-42265761 CACTCATCCTACCTTGACTCAGG + Exonic
1008642170 6:53475235-53475257 CCCTGCTGACACCTTGATTTTGG - Intergenic
1008833458 6:55797993-55798015 CCCTGCTGACACCTTGATTTTGG - Intronic
1010273332 6:73939756-73939778 CACTGCTGACACCTTGATCTTGG + Intergenic
1010762838 6:79744509-79744531 CACTGATGATAACTAAAATCTGG + Intergenic
1011198207 6:84804552-84804574 CCTTGCTGATACCTTGATTTTGG - Intergenic
1012837736 6:104291742-104291764 CATTACTGATACCTTGATTTTGG - Intergenic
1013015411 6:106156444-106156466 CACTGCTGAGACCTTGAATTTGG + Intergenic
1013931515 6:115539915-115539937 CACTGCTGATACCTTGATTATGG + Intergenic
1013994687 6:116294679-116294701 CACTGGTAATGCCATGATTCAGG - Intronic
1014095190 6:117452412-117452434 CACTGATGACACTTTGATGGAGG - Intronic
1014239007 6:118993991-118994013 CCCTGATGACACCTTTATTCTGG - Intronic
1015414672 6:132934712-132934734 CCCTGCTGACACCTTGATTTAGG + Intergenic
1016390401 6:143568800-143568822 CTCTGCTCATACCTTCATTCAGG - Intronic
1016859336 6:148701128-148701150 CAATGATGCTGCCTTGATTCTGG + Intergenic
1017479808 6:154841248-154841270 CCCTGCTGACACCTTGATTTTGG - Intronic
1018380650 6:163255356-163255378 CATTGAAGGTACCTGGATTCAGG - Intronic
1018435334 6:163753887-163753909 CCCTGCTGACACCTTGATCCTGG - Intergenic
1019852846 7:3576779-3576801 TCCTGATGCTTCCTTGATTCAGG + Intronic
1020558524 7:9699530-9699552 CCCTGCTGACACCTTAATTCTGG + Intergenic
1020827255 7:13044672-13044694 TCCTGCTGATACCTTGATTTTGG + Intergenic
1020875200 7:13684842-13684864 CCCTGCTGATACCTTTGTTCTGG + Intergenic
1021498884 7:21307510-21307532 CACTACTGACACCTTGATTTTGG - Intergenic
1021828712 7:24581070-24581092 CCCTGTTGACACCTTGATTTTGG - Intronic
1021969786 7:25954223-25954245 CCCTGTTGACACCTTGATTTTGG - Intergenic
1022684187 7:32579814-32579836 CATAGATCATACCTTGATCCTGG - Intronic
1022758009 7:33315178-33315200 CCCTGTTGACACCTTGATTTTGG - Intronic
1023113137 7:36834389-36834411 CCCTGCTGACACCTTGATTTTGG + Intergenic
1023411016 7:39889238-39889260 CCCTGCTGATGCCTTGATTTTGG + Intergenic
1024583761 7:50823419-50823441 CCCTTCTGATACCTTGATTTTGG - Intergenic
1025007933 7:55369134-55369156 CCCTGTTGATACGTTGATTTTGG + Intronic
1025733744 7:64128842-64128864 CCCTGCTGACACCTTGATCCTGG + Intronic
1026434986 7:70388384-70388406 CACTGAAGAAACATTTATTCAGG - Intronic
1026442071 7:70453581-70453603 CCCTGCTGATGCCTTGATTTTGG - Intronic
1027669269 7:81075743-81075765 CACTGCTGATACATGGATTTGGG - Intergenic
1027842591 7:83331727-83331749 CCCTGAGGATACCTTGATATCGG + Intergenic
1031144845 7:117986293-117986315 CCCTGCTGACACCTTGATTTGGG - Intergenic
1031615297 7:123872535-123872557 TACTTCTGAAACCTTGATTCAGG + Intronic
1031724745 7:125223773-125223795 CCCTGCTGACACCTTGATTTTGG + Intergenic
1032687609 7:134251427-134251449 CCCTGCTGACACCTTGATTTTGG + Intronic
1032998684 7:137478614-137478636 CATTAAGGATTCCTTGATTCAGG + Intronic
1033235763 7:139636693-139636715 CCCTGTTGACACCTTGATTTTGG + Intronic
1033474255 7:141675311-141675333 CACTGCTGAGACCTTGACTTTGG + Intronic
1033565132 7:142570636-142570658 CACTGATGATACCTCCAGTATGG + Intergenic
1033716457 7:144008059-144008081 CCCTGATGACAGCTTGATTTTGG + Intergenic
1034151718 7:148922056-148922078 CTCTGCTGACACCTTGATTTCGG + Intergenic
1034224338 7:149471182-149471204 CCCTCATGATACCTTGATTTTGG + Intergenic
1037209760 8:16372312-16372334 CCCTGCAGATACCTTGATTTTGG - Intronic
1037597161 8:20363865-20363887 CCCTCCTGATACCTTGATTTTGG + Intergenic
1038417236 8:27406022-27406044 CCCTGCTGACACCTTGATTTAGG - Intronic
1038501989 8:28052629-28052651 CGCTGCTAATACCTTGATTTTGG + Intronic
1039203764 8:35126107-35126129 CATAGATTATGCCTTGATTCTGG - Intergenic
1039485870 8:37909360-37909382 CCCTGCTGACACCTTCATTCTGG + Intergenic
1041308277 8:56486283-56486305 CCATGATGATACCTTGATCTTGG - Intergenic
1041345225 8:56890215-56890237 CACTGATGATACACTGATTAGGG - Intergenic
1041731944 8:61071292-61071314 CCCTGCTGACACCTTGATTTCGG - Intronic
1042101603 8:65280658-65280680 CCCTGTTGACACCTTGATTTTGG - Intergenic
1042156775 8:65852330-65852352 CCCTGTTGACACCTTGATTTTGG + Intergenic
1042792814 8:72627440-72627462 AACTGATGGTACCTTGCTTTTGG - Intronic
1043352182 8:79374707-79374729 CCCTGCTGACACCTTGATTTTGG - Intergenic
1043831110 8:84990560-84990582 CCCTGATGACAACTTGATTGAGG - Intergenic
1044077246 8:87837386-87837408 CCCTGCTGATACCTTGATTTAGG + Intergenic
1044473596 8:92600704-92600726 AACTGTTGGTACCTTGATTTTGG + Intergenic
1044848396 8:96404449-96404471 CTCTGCTGACACCTTGATTTCGG - Intergenic
1045155864 8:99470023-99470045 CCCTACTGATACCTTGATTTTGG + Intronic
1045403480 8:101842040-101842062 CCCTGTTGACACCTTGATTTTGG - Intronic
1045749025 8:105459578-105459600 GCCTGCTGATACCTTGATTTTGG - Intronic
1046069980 8:109239222-109239244 CCCTGCTGACACCTTGATTTTGG - Intergenic
1046688102 8:117249576-117249598 CCCTGAAGACACCTTGATTTTGG - Intergenic
1046760579 8:118016031-118016053 CTCTGCTAACACCTTGATTCTGG + Intronic
1047541585 8:125771854-125771876 CCCTGCTGATACCTTGATTTCGG + Intergenic
1048289334 8:133168421-133168443 CACTGAAAATACTTTGATTTTGG - Intergenic
1048335978 8:133502548-133502570 CCCTGATGACACCTTGATCTTGG + Intronic
1048581354 8:135732026-135732048 TCCTGCTGATACCTTGATTTTGG - Intergenic
1049178165 8:141206575-141206597 CACTGAAGAAAACTTGCTTCCGG + Intergenic
1050158256 9:2690769-2690791 CTCTGCTGATACCTTGATTCTGG - Intergenic
1050642535 9:7683642-7683664 CTCTGCTGACACCTTGATTTTGG + Intergenic
1051014015 9:12453352-12453374 CACTGCTGACACGTTGATTTTGG - Intergenic
1051247712 9:15128426-15128448 CCCTGCTGACACCTTGATTTTGG + Intergenic
1051530273 9:18094588-18094610 CACTGATTATACTTAGATTTAGG - Intergenic
1052220780 9:26018828-26018850 CACTGATGTTACCTTCTTTGGGG - Intergenic
1052476312 9:28964696-28964718 CATTGACAATAGCTTGATTCAGG - Intergenic
1053241597 9:36500064-36500086 CCCTGCTGACACCTTGATTTTGG - Intergenic
1055019179 9:71650509-71650531 CTCTGCTGACACCTTGATTTTGG + Intergenic
1055071678 9:72173125-72173147 CCCTGTTGACACCTTGATTTTGG - Intronic
1057952003 9:99376671-99376693 CACTGCCAACACCTTGATTCTGG + Intergenic
1058553380 9:106139564-106139586 CCCTGCTGATGCCTTGATTTTGG + Intergenic
1058678127 9:107418703-107418725 CACTTATTATACCTTGACTATGG - Intergenic
1059181480 9:112217129-112217151 CACTGCTGACACCTTGATCGTGG + Intergenic
1059894897 9:118852072-118852094 CCCTGCTGGTACCTTGATTTCGG - Intergenic
1060041919 9:120307513-120307535 CCCTGCTGACACCTTGATTTTGG + Intergenic
1061213329 9:129206104-129206126 CTCTGATGAGGCCCTGATTCTGG - Intergenic
1185614653 X:1413478-1413500 CTCTGGTGATCCCCTGATTCAGG + Intronic
1186421066 X:9426874-9426896 CCCTGCTGATATCTTGATTTTGG + Intergenic
1186642790 X:11473654-11473676 CACTGCTGACACTTTGATTTTGG + Intronic
1187023306 X:15406905-15406927 GATTGAGGAGACCTTGATTCTGG + Intronic
1187077028 X:15945645-15945667 CCCTGTGGATACCTTGATTTTGG - Intergenic
1187625350 X:21106020-21106042 CACTTATGATACTTTGTTTCCGG - Intergenic
1187637199 X:21242734-21242756 GCCTGCTGATGCCTTGATTCTGG + Intergenic
1187865617 X:23720661-23720683 CTCTGCTGACACCTTGATTTTGG + Intronic
1188213675 X:27452601-27452623 CTCTGATGACACCTTGATCTGGG - Intergenic
1188694169 X:33168718-33168740 CATTGATGATGCCTTGAGTGTGG + Intronic
1188906151 X:35794048-35794070 CACTGCTGACACCTTGATTTTGG - Intergenic
1189689897 X:43605081-43605103 CACAGCTGACACCTTGATTGAGG + Intergenic
1189793151 X:44622670-44622692 CTCTGCTGATACCTTGATTTTGG - Intergenic
1190034714 X:47010877-47010899 CCCTGATGACACCTTGATCTTGG - Intronic
1190146429 X:47895517-47895539 CCCTGCTGACACCTTGATTTTGG + Intronic
1190372220 X:49753627-49753649 CCCTGCTGACACCTTGATTTTGG + Intergenic
1191259357 X:58297321-58297343 CACAGATGATAGCTTCTTTCTGG - Intergenic
1192341341 X:70266103-70266125 CCCTGCTGAAACCTTGATTTTGG - Intergenic
1192498429 X:71632311-71632333 CCCTGCTGACACCTTGATTTTGG - Intergenic
1194265265 X:91745304-91745326 CCCTGATGACACCTTAATTTTGG + Intergenic
1194425208 X:93728778-93728800 CTCTGCTGATACCTTAATTTAGG - Intergenic
1195406174 X:104515744-104515766 CACTGCTGGTACCTTGATCACGG + Intergenic
1196296724 X:114006160-114006182 CTCTGCTGACACCTTGATTTTGG + Intergenic
1197508211 X:127335374-127335396 CCCTAATGATACCTTGATCTTGG + Intergenic
1197714468 X:129696500-129696522 TCCTGCTGATACCTTGATTTTGG - Intergenic
1198167175 X:134069375-134069397 CCATGATGACACCTTGATTTGGG + Intergenic
1198620258 X:138500015-138500037 CACTGATGACACTATGATTTTGG + Intergenic
1200582417 Y:4965752-4965774 CCCTGATGACACCTTAATTTTGG + Intergenic