ID: 1102548109

View in Genome Browser
Species Human (GRCh38)
Location 12:113671200-113671222
Sequence GTGTGAAAAGGGAAAGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102548109_1102548115 23 Left 1102548109 12:113671200-113671222 CCAGTCACTTTCCCTTTTCACAC No data
Right 1102548115 12:113671246-113671268 TGAAGTTTACAAATGCCTCTGGG No data
1102548109_1102548114 22 Left 1102548109 12:113671200-113671222 CCAGTCACTTTCCCTTTTCACAC No data
Right 1102548114 12:113671245-113671267 TTGAAGTTTACAAATGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102548109 Original CRISPR GTGTGAAAAGGGAAAGTGAC TGG (reversed) Intergenic
No off target data available for this crispr