ID: 1102548109 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:113671200-113671222 |
| Sequence | GTGTGAAAAGGGAAAGTGAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1102548109_1102548115 | 23 | Left | 1102548109 | 12:113671200-113671222 | CCAGTCACTTTCCCTTTTCACAC | No data | ||
| Right | 1102548115 | 12:113671246-113671268 | TGAAGTTTACAAATGCCTCTGGG | No data | ||||
| 1102548109_1102548114 | 22 | Left | 1102548109 | 12:113671200-113671222 | CCAGTCACTTTCCCTTTTCACAC | No data | ||
| Right | 1102548114 | 12:113671245-113671267 | TTGAAGTTTACAAATGCCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1102548109 | Original CRISPR | GTGTGAAAAGGGAAAGTGAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||