ID: 1102548391

View in Genome Browser
Species Human (GRCh38)
Location 12:113673267-113673289
Sequence ATATGTTAGCTATAGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102548391_1102548395 12 Left 1102548391 12:113673267-113673289 CCTCCCTTCTATAGCTAACATAT No data
Right 1102548395 12:113673302-113673324 TTTAAGCTGTGGATCCAGCATGG No data
1102548391_1102548394 1 Left 1102548391 12:113673267-113673289 CCTCCCTTCTATAGCTAACATAT No data
Right 1102548394 12:113673291-113673313 TATGTTGATATTTTAAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102548391 Original CRISPR ATATGTTAGCTATAGAAGGG AGG (reversed) Intergenic
No off target data available for this crispr