ID: 1102554912

View in Genome Browser
Species Human (GRCh38)
Location 12:113720561-113720583
Sequence GAGGCTGCAGGGGAGGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102554912_1102554927 16 Left 1102554912 12:113720561-113720583 CCCCAGTCCTCCCCTGCAGCCTC No data
Right 1102554927 12:113720600-113720622 GCACCCTTAGAAGGAGGAGGAGG No data
1102554912_1102554923 7 Left 1102554912 12:113720561-113720583 CCCCAGTCCTCCCCTGCAGCCTC No data
Right 1102554923 12:113720591-113720613 TTGGCTCCAGCACCCTTAGAAGG No data
1102554912_1102554931 26 Left 1102554912 12:113720561-113720583 CCCCAGTCCTCCCCTGCAGCCTC No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554912_1102554926 13 Left 1102554912 12:113720561-113720583 CCCCAGTCCTCCCCTGCAGCCTC No data
Right 1102554926 12:113720597-113720619 CCAGCACCCTTAGAAGGAGGAGG No data
1102554912_1102554930 21 Left 1102554912 12:113720561-113720583 CCCCAGTCCTCCCCTGCAGCCTC No data
Right 1102554930 12:113720605-113720627 CTTAGAAGGAGGAGGAGGAGAGG No data
1102554912_1102554924 10 Left 1102554912 12:113720561-113720583 CCCCAGTCCTCCCCTGCAGCCTC No data
Right 1102554924 12:113720594-113720616 GCTCCAGCACCCTTAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102554912 Original CRISPR GAGGCTGCAGGGGAGGACTG GGG (reversed) Intergenic
No off target data available for this crispr