ID: 1102554924

View in Genome Browser
Species Human (GRCh38)
Location 12:113720594-113720616
Sequence GCTCCAGCACCCTTAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102554911_1102554924 25 Left 1102554911 12:113720546-113720568 CCAGGACAGGAGAGACCCCAGTC No data
Right 1102554924 12:113720594-113720616 GCTCCAGCACCCTTAGAAGGAGG No data
1102554920_1102554924 -9 Left 1102554920 12:113720580-113720602 CCTCCTCAGCCTTGGCTCCAGCA No data
Right 1102554924 12:113720594-113720616 GCTCCAGCACCCTTAGAAGGAGG No data
1102554916_1102554924 0 Left 1102554916 12:113720571-113720593 CCCCTGCAGCCTCCTCAGCCTTG No data
Right 1102554924 12:113720594-113720616 GCTCCAGCACCCTTAGAAGGAGG No data
1102554913_1102554924 9 Left 1102554913 12:113720562-113720584 CCCAGTCCTCCCCTGCAGCCTCC No data
Right 1102554924 12:113720594-113720616 GCTCCAGCACCCTTAGAAGGAGG No data
1102554914_1102554924 8 Left 1102554914 12:113720563-113720585 CCAGTCCTCCCCTGCAGCCTCCT No data
Right 1102554924 12:113720594-113720616 GCTCCAGCACCCTTAGAAGGAGG No data
1102554917_1102554924 -1 Left 1102554917 12:113720572-113720594 CCCTGCAGCCTCCTCAGCCTTGG No data
Right 1102554924 12:113720594-113720616 GCTCCAGCACCCTTAGAAGGAGG No data
1102554919_1102554924 -2 Left 1102554919 12:113720573-113720595 CCTGCAGCCTCCTCAGCCTTGGC No data
Right 1102554924 12:113720594-113720616 GCTCCAGCACCCTTAGAAGGAGG No data
1102554915_1102554924 3 Left 1102554915 12:113720568-113720590 CCTCCCCTGCAGCCTCCTCAGCC No data
Right 1102554924 12:113720594-113720616 GCTCCAGCACCCTTAGAAGGAGG No data
1102554912_1102554924 10 Left 1102554912 12:113720561-113720583 CCCCAGTCCTCCCCTGCAGCCTC No data
Right 1102554924 12:113720594-113720616 GCTCCAGCACCCTTAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102554924 Original CRISPR GCTCCAGCACCCTTAGAAGG AGG Intergenic
No off target data available for this crispr