ID: 1102554931

View in Genome Browser
Species Human (GRCh38)
Location 12:113720610-113720632
Sequence AAGGAGGAGGAGGAGAGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102554915_1102554931 19 Left 1102554915 12:113720568-113720590 CCTCCCCTGCAGCCTCCTCAGCC No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554920_1102554931 7 Left 1102554920 12:113720580-113720602 CCTCCTCAGCCTTGGCTCCAGCA No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554921_1102554931 4 Left 1102554921 12:113720583-113720605 CCTCAGCCTTGGCTCCAGCACCC No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554912_1102554931 26 Left 1102554912 12:113720561-113720583 CCCCAGTCCTCCCCTGCAGCCTC No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554914_1102554931 24 Left 1102554914 12:113720563-113720585 CCAGTCCTCCCCTGCAGCCTCCT No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554922_1102554931 -2 Left 1102554922 12:113720589-113720611 CCTTGGCTCCAGCACCCTTAGAA No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554916_1102554931 16 Left 1102554916 12:113720571-113720593 CCCCTGCAGCCTCCTCAGCCTTG No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554919_1102554931 14 Left 1102554919 12:113720573-113720595 CCTGCAGCCTCCTCAGCCTTGGC No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554925_1102554931 -10 Left 1102554925 12:113720597-113720619 CCAGCACCCTTAGAAGGAGGAGG No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554913_1102554931 25 Left 1102554913 12:113720562-113720584 CCCAGTCCTCCCCTGCAGCCTCC No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data
1102554917_1102554931 15 Left 1102554917 12:113720572-113720594 CCCTGCAGCCTCCTCAGCCTTGG No data
Right 1102554931 12:113720610-113720632 AAGGAGGAGGAGGAGAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102554931 Original CRISPR AAGGAGGAGGAGGAGAGGCA TGG Intergenic
No off target data available for this crispr