ID: 1102556385

View in Genome Browser
Species Human (GRCh38)
Location 12:113729472-113729494
Sequence ATGGTGAAGGTGAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102556380_1102556385 -5 Left 1102556380 12:113729454-113729476 CCACTTTTTAAAGGGAAGATGGT No data
Right 1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG No data
1102556376_1102556385 19 Left 1102556376 12:113729430-113729452 CCATCAAAAGGATTCAAATTATT No data
Right 1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG No data
1102556375_1102556385 26 Left 1102556375 12:113729423-113729445 CCTAAAGCCATCAAAAGGATTCA No data
Right 1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102556385 Original CRISPR ATGGTGAAGGTGAGGGTGGA TGG Intergenic
No off target data available for this crispr