ID: 1102558218

View in Genome Browser
Species Human (GRCh38)
Location 12:113742813-113742835
Sequence CCAGGGCACCAGAAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102558218_1102558228 24 Left 1102558218 12:113742813-113742835 CCTTCTGCCTTCTGGTGCCCTGG No data
Right 1102558228 12:113742860-113742882 ATGAGATGAGGAGGCCTCCCAGG No data
1102558218_1102558222 -10 Left 1102558218 12:113742813-113742835 CCTTCTGCCTTCTGGTGCCCTGG No data
Right 1102558222 12:113742826-113742848 GGTGCCCTGGGCAGTGAGCATGG No data
1102558218_1102558227 15 Left 1102558218 12:113742813-113742835 CCTTCTGCCTTCTGGTGCCCTGG No data
Right 1102558227 12:113742851-113742873 GTGGCAGTCATGAGATGAGGAGG No data
1102558218_1102558226 12 Left 1102558218 12:113742813-113742835 CCTTCTGCCTTCTGGTGCCCTGG No data
Right 1102558226 12:113742848-113742870 GCTGTGGCAGTCATGAGATGAGG No data
1102558218_1102558225 -4 Left 1102558218 12:113742813-113742835 CCTTCTGCCTTCTGGTGCCCTGG No data
Right 1102558225 12:113742832-113742854 CTGGGCAGTGAGCATGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102558218 Original CRISPR CCAGGGCACCAGAAGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr