ID: 1102562871

View in Genome Browser
Species Human (GRCh38)
Location 12:113775102-113775124
Sequence ACTGCTCTAAGTGCTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102562870_1102562871 -1 Left 1102562870 12:113775080-113775102 CCATGTAAGGCACTTTCAGAAAA No data
Right 1102562871 12:113775102-113775124 ACTGCTCTAAGTGCTTTTAAAGG No data
1102562869_1102562871 0 Left 1102562869 12:113775079-113775101 CCCATGTAAGGCACTTTCAGAAA No data
Right 1102562871 12:113775102-113775124 ACTGCTCTAAGTGCTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102562871 Original CRISPR ACTGCTCTAAGTGCTTTTAA AGG Intergenic
No off target data available for this crispr