ID: 1102565543

View in Genome Browser
Species Human (GRCh38)
Location 12:113794991-113795013
Sequence CTGAATAGGGGGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102565528_1102565543 28 Left 1102565528 12:113794940-113794962 CCGTGTACATATGTAACCAGAAA No data
Right 1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG No data
1102565532_1102565543 12 Left 1102565532 12:113794956-113794978 CCAGAAACGGGGCTGAAAAGCAA No data
Right 1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102565543 Original CRISPR CTGAATAGGGGGAAGGAGGG AGG Intergenic
No off target data available for this crispr