ID: 1102565817

View in Genome Browser
Species Human (GRCh38)
Location 12:113796845-113796867
Sequence CTCATGGAACATTCTAGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102565808_1102565817 -3 Left 1102565808 12:113796825-113796847 CCAAGATAACACACCCCGCCCTC No data
Right 1102565817 12:113796845-113796867 CTCATGGAACATTCTAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102565817 Original CRISPR CTCATGGAACATTCTAGTTG GGG Intergenic
No off target data available for this crispr