ID: 1102569066

View in Genome Browser
Species Human (GRCh38)
Location 12:113816278-113816300
Sequence CTCACTGCTCTGGGGAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 233}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102569058_1102569066 -4 Left 1102569058 12:113816259-113816281 CCTGCATGTGGGAACTGCCCTCA 0: 1
1: 0
2: 3
3: 24
4: 146
Right 1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1102569047_1102569066 25 Left 1102569047 12:113816230-113816252 CCTCTGAAACCCAGCATAGGGCC 0: 1
1: 0
2: 0
3: 22
4: 181
Right 1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1102569054_1102569066 4 Left 1102569054 12:113816251-113816273 CCGGGCCCCCTGCATGTGGGAAC 0: 1
1: 0
2: 0
3: 22
4: 188
Right 1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1102569057_1102569066 -3 Left 1102569057 12:113816258-113816280 CCCTGCATGTGGGAACTGCCCTC 0: 1
1: 0
2: 3
3: 58
4: 599
Right 1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1102569055_1102569066 -1 Left 1102569055 12:113816256-113816278 CCCCCTGCATGTGGGAACTGCCC 0: 1
1: 0
2: 1
3: 22
4: 147
Right 1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1102569050_1102569066 16 Left 1102569050 12:113816239-113816261 CCCAGCATAGGGCCGGGCCCCCT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1102569051_1102569066 15 Left 1102569051 12:113816240-113816262 CCAGCATAGGGCCGGGCCCCCTG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG 0: 1
1: 0
2: 1
3: 28
4: 233
1102569056_1102569066 -2 Left 1102569056 12:113816257-113816279 CCCCTGCATGTGGGAACTGCCCT 0: 1
1: 0
2: 3
3: 16
4: 214
Right 1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG 0: 1
1: 0
2: 1
3: 28
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102569066 Original CRISPR CTCACTGCTCTGGGGAGGTA GGG Intergenic
900939316 1:5787557-5787579 CTTCCTGCTCTGAGGAGGCATGG - Intergenic
902860404 1:19241091-19241113 CTTACGGCTCTGGGGTGGTGTGG - Exonic
903557907 1:24206600-24206622 CTTCCTGCTCAGGGAAGGTAGGG - Intergenic
904378487 1:30096095-30096117 CTCACTGCACAGGGGATGGAAGG - Intergenic
904755328 1:32765712-32765734 CGCTCTGCTCTGGAGAGGCAGGG + Intronic
906109912 1:43315747-43315769 CTCACTGCTGTGGTGGGGGAGGG + Intronic
906118073 1:43368335-43368357 CTCAGGGCTCGGGGGAGGTTCGG + Intergenic
906590482 1:47020545-47020567 CTCAATGCACTGGGGAGACAAGG - Intergenic
907928633 1:58978536-58978558 CTCTGTGCTCAGAGGAGGTAAGG - Intergenic
908949327 1:69540624-69540646 CTCACTTTTCTGGGTAGTTAGGG - Intergenic
911121489 1:94301527-94301549 GTCACTGCAATGGGGAGGGAAGG + Intergenic
912705004 1:111905039-111905061 CTCAGTGTTCTGGGGAGGTACGG - Intronic
914451313 1:147794582-147794604 CCCACTGCTCTGGGGAGATGAGG - Intergenic
915890065 1:159765068-159765090 CTCACTGCACTGCAGTGGTAAGG - Intergenic
918154957 1:181835875-181835897 CTTAGTGCTGTTGGGAGGTAGGG + Intergenic
919774555 1:201185584-201185606 CTCACCGCTCTTGGGAGAGATGG + Intergenic
919807830 1:201391218-201391240 TTCACTTCTCTGGGGAGCAAGGG + Intronic
920556897 1:206910332-206910354 TCCAGTGCTCTGGGGAGGGAAGG + Exonic
920867306 1:209763571-209763593 CTGACAGCTCTTGGAAGGTAAGG + Exonic
922097082 1:222451809-222451831 CCTGCTGCTCTGGGCAGGTAGGG - Intergenic
922984578 1:229856399-229856421 GGCACAGCTCTGGGGAGGGAGGG + Intergenic
1063148963 10:3320075-3320097 CTCACTGCCCTGGGCAGGCAGGG + Intergenic
1063861030 10:10307745-10307767 CTCAGTGCTCTGGGGATAGAGGG - Intergenic
1064910490 10:20396047-20396069 CTCAATGCTTTGTGGAAGTAGGG + Intergenic
1065223115 10:23516273-23516295 CAAACAGCTCTGGGGAGATATGG - Intergenic
1067091024 10:43265990-43266012 CTCACTGCTCTGAGCAGGGAGGG + Intronic
1069058401 10:63868187-63868209 TTGTCTGCTCTGGGGAGGCACGG - Intergenic
1069957545 10:72061237-72061259 CACACTGCTCAGGGGATGTTGGG + Exonic
1070825034 10:79385942-79385964 CTGGCTGGTCTGGGGAGGTTTGG + Exonic
1071032773 10:81204757-81204779 TTCACTGCTCTTGAGAGGCAAGG + Intergenic
1071422487 10:85514453-85514475 CACAATGCTCTGGAGAGGTCAGG + Intergenic
1072227823 10:93386737-93386759 CACATTGCTCTGGGGAAGAAGGG + Intronic
1072278487 10:93845297-93845319 CTCACTGCCCGGGGCAGGCAGGG - Intergenic
1072739860 10:97902815-97902837 CTGCCTGCTCTGGGGAGGCCAGG + Intronic
1074692174 10:116016167-116016189 GTCATTGCCCTGAGGAGGTACGG + Intergenic
1075789179 10:125071212-125071234 CTCCCTGCTCTGGGAAGGGAAGG + Intronic
1078188692 11:9074091-9074113 CTCCCTGCTCTGGGTGGGTAGGG - Intronic
1079805007 11:24920084-24920106 CTTACTTTTTTGGGGAGGTAGGG + Intronic
1081652630 11:44834575-44834597 CTCACTTCTCTAGGGAGTTGGGG + Intronic
1083267025 11:61551512-61551534 GTCCCTGTTCTGGGGAGGTAGGG - Intronic
1083903294 11:65654345-65654367 CCCAGTGCTCTGGGGAGGGCAGG + Exonic
1084801663 11:71548077-71548099 GGCACTGCTCTGGGGAGGGAGGG + Intronic
1085313040 11:75527167-75527189 CTAACTGGCCTGGGGAGCTAAGG + Intergenic
1087161527 11:94952786-94952808 CTAACTGCACAGGGGAGGGAGGG - Intergenic
1088894366 11:114066634-114066656 CTCATTCCTCTGGGGAGAGAGGG + Intronic
1089325577 11:117654637-117654659 GTCACTGCTCTGGGAAGCTGCGG + Intronic
1090782718 11:130021778-130021800 CTCACTGCCCAGGGCTGGTAGGG - Intergenic
1091812326 12:3409784-3409806 GTGACTGCTCTGGGTAGCTAAGG + Intronic
1092095783 12:5840873-5840895 CTCACTCATCTTGAGAGGTAGGG + Intronic
1092104999 12:5914971-5914993 GACACAGCTCTGGGGAGGTCTGG - Intronic
1092905666 12:13098636-13098658 TTCACTGTTCTGGGGTGGAAAGG - Intronic
1092984891 12:13836069-13836091 CTCTCTGATCTGGGCAGGTTGGG + Intronic
1096475197 12:51905360-51905382 CTCAGTGCTCTGGGGAGATGGGG + Intergenic
1096870989 12:54591985-54592007 CACACAGCTCTGAGGAGATAAGG + Intergenic
1096890035 12:54760424-54760446 CTCACTTCTCTGTGGCTGTAGGG + Intergenic
1097054723 12:56242687-56242709 CTCACTGCTGCGGGGATGGAGGG + Exonic
1097151572 12:56983294-56983316 CTCCATGTTCTGGGGAGGGAGGG - Intergenic
1098385514 12:69914704-69914726 CTCAGAGGTCTGGAGAGGTAGGG + Intronic
1099367310 12:81783740-81783762 CTCTCTGATCTGGGGAGGTTTGG + Intergenic
1099735380 12:86562005-86562027 TTCACTGCTCTTGAGAGGCAAGG + Intronic
1100690527 12:97034361-97034383 CTATCTGCCCTGGGGAGATAGGG + Intergenic
1101834549 12:108286348-108286370 CTAGCTGCTCTGGGGAGGACAGG - Intergenic
1101841209 12:108328732-108328754 CTCCTAGCTATGGGGAGGTACGG - Intronic
1102569066 12:113816278-113816300 CTCACTGCTCTGGGGAGGTAGGG + Intergenic
1103155822 12:118684090-118684112 CTCACTGCTCTGGTGAGGCCTGG + Intergenic
1103398161 12:120623921-120623943 CCCACTGATCTGGAGATGTAAGG + Intergenic
1103869846 12:124083560-124083582 CACAGTGCTCTGGGGAATTAAGG - Intronic
1104875983 12:132035146-132035168 CTCACTGGTCTGGAGAAGGAAGG + Intronic
1105296066 13:19088916-19088938 CACACTGCTCTGAGGGGGCAAGG - Intergenic
1111795094 13:92909208-92909230 CTTAATGCTCTGGGAAGGTGGGG + Intergenic
1114402472 14:22422575-22422597 CTCTCTCTTCTGGGCAGGTAAGG + Intergenic
1114902365 14:27079322-27079344 CTTATTTCTCTAGGGAGGTAAGG + Intergenic
1115472837 14:33785991-33786013 CTCCCTGCTGTGGGGTGGTGGGG - Intronic
1117421302 14:55548392-55548414 CTAAATGTTCTGGGGAAGTAGGG + Intergenic
1119538952 14:75426703-75426725 TTCACTGCACTGGGGAAATAAGG + Intergenic
1119696788 14:76719716-76719738 CACATGGCTCTGGGGAGGTATGG - Intergenic
1122204829 14:100143187-100143209 CTCACTCCTCAGGAGAGGCAGGG - Intronic
1122598519 14:102909387-102909409 GAGACTGCTCTGGGGAGGAAGGG - Exonic
1122699993 14:103581913-103581935 CTCCCTGCTCTGTGGAGGGAGGG + Intronic
1122702288 14:103598064-103598086 CTCATTGCTCTGGGAAGGCCTGG - Intronic
1122921392 14:104881844-104881866 CACACTGCGCTGGGGATGCAGGG - Intronic
1123414652 15:20086440-20086462 CCCACTACTCTGGGGAGCTGAGG + Intergenic
1123523994 15:21093553-21093575 CCCACTACTCTGGGGAGCTGAGG + Intergenic
1123758269 15:23413888-23413910 CTCCCAGCTCTGGGGAGCGACGG - Intergenic
1124668507 15:31615992-31616014 CTCACTGTTCTGATGAGGTATGG + Intronic
1125585384 15:40815840-40815862 CTCCCTTCTCTGGGGAGTCAGGG - Intronic
1128749086 15:70135685-70135707 CTCTATGCTCTGTGGAGGTAGGG + Intergenic
1129084940 15:73079174-73079196 CTCTCTGCTCTTTGGAGCTAAGG - Intronic
1131043372 15:89293981-89294003 CTCACTGCTCTTTTCAGGTAAGG + Exonic
1131228316 15:90643038-90643060 GACACAGCTCTGGGGAGGGATGG - Intronic
1131434942 15:92414980-92415002 CCCAGGGCTCTGGGGAGGAAAGG - Intronic
1132605509 16:792205-792227 GTCACTGCAATGGGGAGGTCAGG - Exonic
1132686178 16:1163084-1163106 CTCTCTGTTCTGGGCAGGTGAGG + Intronic
1132746512 16:1438502-1438524 CACTCTGCTCGGGGGAGGCAAGG + Intronic
1132903489 16:2270785-2270807 CCCTCCGCTCTGGGAAGGTAAGG - Intergenic
1134458069 16:14409006-14409028 CTCCCAGCTCTGGGGAGCAATGG + Intergenic
1136656538 16:31712602-31712624 CTCCCTGCTCTGGAGAGGGATGG - Intergenic
1136713852 16:32261628-32261650 GGCACTGCTCTGGTGGGGTAAGG + Intergenic
1137551009 16:49437632-49437654 CCCAAAGCTCTGGGGAGGGAAGG - Intergenic
1138493828 16:57394743-57394765 CTCACTCCTCTGGAGAGATTGGG - Intergenic
1139385539 16:66566710-66566732 CTCACTGCCTTGGGGACGTGCGG - Exonic
1139686080 16:68604804-68604826 CCCATTGCACAGGGGAGGTAAGG - Intergenic
1140207411 16:72945251-72945273 ATCACTGCTGTGGGAACGTATGG - Intronic
1142303027 16:89269979-89270001 CTCACGGCTCTGGTTAGGAAGGG + Intronic
1142499920 17:326544-326566 CTCTCAGCTCTGGGTAGGTCAGG - Intronic
1143748391 17:9010426-9010448 CTCAGTGTTGTGGGGAGGGAAGG + Intergenic
1146935446 17:36809982-36810004 CTCACTGCAGTGGGAAGGTGCGG + Intergenic
1148228498 17:45916400-45916422 CTCACAGTTCTGGGGAGTTCAGG - Intronic
1148799930 17:50217662-50217684 CTCAGTGCTCTGGGAAGCTGAGG - Intergenic
1149587798 17:57804459-57804481 CTCAGTACTTTGGGAAGGTAAGG - Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150640468 17:66946308-66946330 TTCCCTGGTCTGGGGAGGCAGGG - Intergenic
1150772272 17:68051978-68052000 CTCACTGCCCTGGGCCGGCAGGG - Intergenic
1151157271 17:72134113-72134135 CTCCCTTCACTGGGGAGGTATGG - Intergenic
1151596584 17:75081818-75081840 CACACTGCCCTTGGGAGGAAAGG - Intergenic
1151911447 17:77086129-77086151 CTCTCTCGTCTGGGGAGGTGGGG + Intergenic
1153866438 18:9273788-9273810 CTCAATGCTCTGGGAGGCTAAGG - Intronic
1154227873 18:12524721-12524743 CTCAGTGCGTTGGGAAGGTAAGG + Intronic
1155171503 18:23270141-23270163 CTCCCTGCTGTGGGGAGGCTAGG + Intronic
1155840507 18:30636890-30636912 CTGGCTGCTTTGGGGAGGTCAGG + Intergenic
1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG + Intergenic
1160397912 18:78585303-78585325 TCCACTGCTGTGGGGAGGGAAGG + Intergenic
1161147593 19:2688323-2688345 GTCAGTGCTCTGGGGAAGTGGGG + Intronic
1161586122 19:5106829-5106851 CTCACTGCTCTGGGCTGGGCTGG - Intronic
1161987542 19:7664898-7664920 CTCAGTGCTTTGGGAAGCTAAGG + Intergenic
1163020779 19:14479893-14479915 ATCACTTCCCTGGGCAGGTAGGG - Intronic
1164511845 19:28904035-28904057 TTCACTGCCCTGGGGAATTATGG - Intergenic
1164721161 19:30432495-30432517 CTCACAGCTGTGGTGAGGTGGGG + Intronic
1165232479 19:34395723-34395745 CTCACTGGTGTGGGGAGGAAGGG + Intronic
1167288151 19:48610527-48610549 CCCACAGCACTGGGGAGGTGGGG - Intronic
1167749629 19:51371905-51371927 CCCACTGCCCTGGGGAGCTTTGG - Intronic
1167776989 19:51564871-51564893 GTCCCTGCTGTGGGGAGGTGAGG - Intergenic
1168289786 19:55352010-55352032 GACACGGCTCTGGGGAGGTCAGG + Intronic
1168462518 19:56571011-56571033 CTCACTGCTGAGGGCAGGAAGGG + Intronic
925080135 2:1056735-1056757 CGCCCTGCTGTGGGGAGGGAGGG + Intronic
927874780 2:26648075-26648097 CTCACTGCCCAGGGGAGGAGGGG + Intergenic
928312369 2:30221409-30221431 GTCACTGCTCTGTGGAAGGAAGG + Intergenic
928611544 2:32996850-32996872 CGCACTGCCCAGGGGTGGTATGG + Intronic
929121145 2:38484908-38484930 CTTTCTGCTCTGGGGAGGAGGGG + Intergenic
929335492 2:40739223-40739245 CTCACTGCCCAGGGAAGGAAAGG - Intergenic
932433381 2:71688649-71688671 CCCACTGCCCTGGGGAAGGAAGG + Intergenic
932463653 2:71899122-71899144 CTGCCTGCTCAGGGGAGGTGAGG + Intergenic
933302365 2:80556521-80556543 CTCACTGCTATGGTCAGGTATGG + Intronic
934558390 2:95299501-95299523 CTCACTCCTATGGGGAGGCGGGG + Intronic
935465693 2:103395457-103395479 CTCACTGCTTTGGTGAGATGTGG + Intergenic
936059771 2:109286782-109286804 GTCACTCCTCCCGGGAGGTATGG - Intronic
936439755 2:112541758-112541780 ATCAGTATTCTGGGGAGGTAAGG + Intergenic
936515718 2:113180248-113180270 CCCACTGCAGTGGGGAGCTAGGG - Intronic
936936847 2:117847185-117847207 CTCACTGCTTGGGGGAGCTCAGG + Intergenic
937205877 2:120236923-120236945 CCCACTGCACTTGGGAGGAAAGG - Intergenic
939789067 2:146549129-146549151 CTCACTGCTCCTGAGAGGCAAGG - Intergenic
941079800 2:161047205-161047227 CTCAGTGCTTTGGGGAGCTGAGG + Intergenic
941309237 2:163909628-163909650 CTCACTGCCCGGGGCCGGTAGGG - Intergenic
943899477 2:193414321-193414343 TCCCTTGCTCTGGGGAGGTATGG - Intergenic
946239508 2:218345106-218345128 CACACTGCTCAGGGGAGGGGAGG + Exonic
947182007 2:227419848-227419870 GTCAATGGTCTGGGGAGGAAAGG + Intergenic
947354495 2:229277763-229277785 CTCACTGCTGGGAGGTGGTAGGG + Intergenic
948532165 2:238615985-238616007 CTTCCTGCCCTGGGGAGGAAGGG - Intergenic
1171869195 20:30512557-30512579 TTCACTGATCTGGTGAGGCAGGG - Intergenic
1171992562 20:31708083-31708105 CACACTGAGATGGGGAGGTAAGG + Intronic
1172063215 20:32201332-32201354 CTCACTGCTTTGGGAAGCCAAGG + Intronic
1175245999 20:57582267-57582289 CTCTCGGCTCTGGGGAGAGAAGG - Intergenic
1176382455 21:6120129-6120151 CTCAGTGCTCTGGGCAGGCTGGG + Intronic
1179023019 21:37656789-37656811 CTCTCTTCTCTGGGGAGGGGAGG + Intronic
1179741017 21:43418110-43418132 CTCAGTGCTCTGGGCAGGCTGGG - Intronic
1180174561 21:46081466-46081488 CTCACTGCTGGGGGGATGCAGGG - Intergenic
1181166128 22:20983987-20984009 CTCACTGCACTGGGGCGGCACGG + Intronic
1181488633 22:23247481-23247503 CTCATTGTTCTGGGTAGGGAGGG + Intronic
1181763083 22:25071399-25071421 CCCACTGCTCTGGGGGGCTCAGG - Intronic
1182652391 22:31862674-31862696 CCCACTGCACTGGGAGGGTAAGG + Intronic
1183120779 22:35728580-35728602 CCCACTGCCCTGGGGCGGGAGGG + Intronic
1183529988 22:38348117-38348139 CTCACACCCCTGGGGAGGTCAGG + Intronic
1184234447 22:43175421-43175443 CTCCCTGCTGTGGGGAGGGCTGG + Intronic
1184404710 22:44293269-44293291 CTCACAGCTATGGAGAGGGAAGG + Intronic
1184755418 22:46513032-46513054 TTCACTCCACTGGGGAGGGATGG - Intronic
1185275072 22:49947250-49947272 GACACAGCTCTGGGGAGGCAAGG - Intergenic
950217346 3:11168929-11168951 CCCACTGCTCTGTGGGGCTATGG - Intronic
951524847 3:23643958-23643980 CTCTCACCTCTGGGGAGGAATGG + Intergenic
951582494 3:24180904-24180926 CTCCCTGCCCTGGAGAGGTAAGG + Intronic
952186359 3:30973707-30973729 CTCACTTCTCAGGTGAGATATGG - Intergenic
953941784 3:47105673-47105695 CTCAATGCTTTGGTGAGGTCAGG + Intronic
954095737 3:48326224-48326246 CACACTGCGCTGGGAAGGGAAGG + Intronic
954943184 3:54393639-54393661 CTTACTGCTCTGGGCAGACAAGG - Intronic
956776428 3:72569097-72569119 ATCACTGCTTTGGGCAGGCATGG + Intergenic
957002272 3:74900188-74900210 CTCACTGCCCTGGGCCGGTGGGG + Intergenic
960993013 3:123323972-123323994 CTCTTTGCTCAGGGGAGGGAGGG + Intronic
961574296 3:127822523-127822545 CTCCCCGCCCTGGGGAGGGAGGG - Exonic
961867811 3:129966713-129966735 CATGCTGCTCTGCGGAGGTAGGG + Intergenic
964667698 3:159192020-159192042 GTCACTTCTCTGAGGAGGAAAGG - Intronic
965003517 3:162987463-162987485 CTCACTGCCCAGGGCAGGCAGGG - Intergenic
965230954 3:166052275-166052297 CTCACTGCTCTGGGTGCCTAAGG - Intergenic
965370480 3:167855977-167855999 CACACAGCTCTGTGGAAGTATGG + Intergenic
966929781 3:184668867-184668889 CTCTGTGCTCTGGGTAGATAGGG - Intronic
967969242 3:194986950-194986972 CCCACGGCTCTGGGGTGGGAGGG - Intergenic
970857401 4:20665022-20665044 CTCACTGCTCTGGTTGGGTTTGG - Intergenic
972726097 4:41747294-41747316 CGCACTGGTCCGGGGAGGTGTGG - Intronic
975888235 4:78991790-78991812 CTCACTTCTCAAGGGAGGTGAGG - Intergenic
976871611 4:89800874-89800896 ATCACAGCTCAGGGGAGGAAGGG - Intronic
978855069 4:113385627-113385649 CTCACTGCTCCAGGCAGGGAAGG + Intergenic
979524016 4:121698240-121698262 CTTACTGGTGTGGGGAGGGAAGG + Intergenic
979950564 4:126887743-126887765 GTGAGTGCTCTGGGGAGGGAAGG + Intergenic
981162303 4:141513185-141513207 CTCACTTCTCTGGCTAGGGAGGG - Intergenic
982504964 4:156205732-156205754 CTCACTGATCTGTGCAGCTATGG - Intergenic
985105909 4:186500049-186500071 TTCACAGCTCAGGGGAGGGAGGG - Intronic
985658201 5:1142863-1142885 CTCAGAACTCAGGGGAGGTAAGG + Intergenic
986505629 5:8447565-8447587 CTCAATGCTTTGGGAAGGTGAGG - Intergenic
986932667 5:12846123-12846145 CTGCCTTCTTTGGGGAGGTAAGG - Intergenic
986961820 5:13222133-13222155 CTGTCTGCTCTGGGGCGGGAAGG - Intergenic
986982175 5:13460665-13460687 CTCAGTGCTCTGGAGAAGCATGG - Intergenic
993489381 5:88527755-88527777 CTCAGTGCTTTGGGAAGCTAAGG - Intergenic
994338407 5:98597193-98597215 CTCACTGGTGTGGGAAGGGATGG - Intergenic
1000223687 5:159237667-159237689 TTCACTGCTCTGCAGAGGCAAGG - Intergenic
1000418856 5:161013970-161013992 TCCACTGCACTGGGGAGCTAAGG + Intergenic
1002618274 5:180468831-180468853 CTCCCTGAGGTGGGGAGGTAGGG + Intergenic
1002695664 5:181086682-181086704 CTCACAGTTCTGGGGAGCTGGGG + Intergenic
1003147990 6:3525212-3525234 CTCAATGCTCAGTGGAGTTAGGG - Intergenic
1007956112 6:45919268-45919290 CTCACAGCACTGGGGAGATGGGG + Intronic
1008079755 6:47181431-47181453 TTCACTGCTCTTGAGAGGCAAGG - Intergenic
1011071255 6:83386928-83386950 CTCACAGTTCTGGGGAGGCTGGG - Intronic
1013583575 6:111559380-111559402 CTCAGTGATCTGGGGATGAACGG + Exonic
1015184172 6:130394509-130394531 CAGTCTGCTCTGGGGAGGTGGGG + Intronic
1015513626 6:134063405-134063427 CTCACCACTCCTGGGAGGTAAGG - Intergenic
1015646058 6:135389853-135389875 ATCACTGTTATGGGTAGGTAGGG - Intronic
1016468285 6:144348248-144348270 CGCCCAGCTCTGGGGAGGTATGG + Intronic
1019040402 6:169099354-169099376 TTCACTGCTCTTGAGAGGCAAGG + Intergenic
1023252860 7:38284261-38284283 CTCATTACTCTGTGGAGATAGGG + Intergenic
1023365107 7:39456253-39456275 CTCCTGGCTCTGGGGAGGTTGGG - Intronic
1023844257 7:44112222-44112244 CTCTGTGCTCTGGGGAGCTGAGG + Exonic
1025117978 7:56274822-56274844 CTCAGTGTTCTGGGGGGCTAAGG + Intergenic
1026474100 7:70719235-70719257 CTAACAGCTCAGGGGAGATATGG - Intronic
1029473168 7:100767230-100767252 CTCACTGCTCAGAGGCTGTAAGG + Exonic
1031528567 7:122850374-122850396 CCCAGTGCTCTGGGGAGGGAAGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033081876 7:138306337-138306359 CCCCCTACTCTGGGGAGGGAAGG - Intergenic
1034488255 7:151379763-151379785 TTCTCTGCTGTGGGGAGATAAGG + Intronic
1035034422 7:155885748-155885770 CTCACAGCCCTGGGAAGGGAAGG - Intergenic
1035262380 7:157670142-157670164 CTTCCTGCTCTGGGGAGGTGAGG + Intronic
1037154511 8:15684090-15684112 CGTAGTGCTCTGGGGAGGGAAGG + Intronic
1037290390 8:17343546-17343568 CTCACTGCTTTAGTGAGGTCTGG - Intronic
1037374563 8:18213619-18213641 CTCAATGCTCTGCTGAGGAAAGG - Intronic
1037856886 8:22378213-22378235 TTCACTGCTCTGGGGAGTGGAGG + Intronic
1038516045 8:28188465-28188487 CTCCCTCCTCCGGGGAGGGAAGG + Intronic
1039115032 8:34083676-34083698 CTCACTGCTCTTGAGAGATGAGG + Intergenic
1040124432 8:43720903-43720925 CTCACTGGTCTGGGGACACAAGG + Intergenic
1041030291 8:53729591-53729613 CACCCTGCTGTGGGGAGGAAGGG + Intronic
1044202006 8:89449432-89449454 TTCACTGCTCTTGAGAGGCAAGG + Intergenic
1045109872 8:98930188-98930210 CTCACTACCCTGGGGAGGAGGGG + Intronic
1046009082 8:108524570-108524592 CACACTGCTCTGGGCAGGTGAGG + Intergenic
1047311545 8:123696645-123696667 CTCACTGCTCCTGGGTGGGAGGG + Intronic
1049615880 8:143575694-143575716 CTCACTGCCCTGGGTGGGGAAGG + Exonic
1052789373 9:32860336-32860358 TTCACTGCTCTTGAGAGGCAAGG - Intergenic
1055192281 9:73539883-73539905 CTCACTGCTGGGGGGAGGGAAGG - Intergenic
1056938624 9:90936900-90936922 CTCACTGCAGTGGGGAAGGAAGG + Intergenic
1058160762 9:101568320-101568342 CTCTCTGTTCTGTGGAGCTAGGG + Intergenic
1059957973 9:119537885-119537907 CTAACTGCTCTAGGCAGTTATGG - Intergenic
1060555913 9:124507124-124507146 CCCCCTGCTCTGGGCAGGGAAGG - Intronic
1060656170 9:125374195-125374217 GACACTGCTCTGGAGAGGGAGGG - Intergenic
1061682561 9:132250176-132250198 CTCACAGGACTGGGGAGGTGGGG + Intergenic
1062442443 9:136576796-136576818 CTCACTGCTCTGGGGAACAAAGG - Intergenic
1190845417 X:54186277-54186299 ATCACTGCTCTGGTCAGGCACGG - Intergenic
1191868323 X:65724003-65724025 CTCAGTGCTGGGGGGAGGGAGGG - Intronic
1195772942 X:108371795-108371817 GTGAGTGCTCTGGAGAGGTATGG + Intronic
1199914458 X:152323993-152324015 CTAAGTGCTCTGGGGATGTAAGG - Intronic