ID: 1102569778

View in Genome Browser
Species Human (GRCh38)
Location 12:113820434-113820456
Sequence GTGGGAGCCTGCAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 895
Summary {0: 1, 1: 0, 2: 10, 3: 88, 4: 796}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102569765_1102569778 13 Left 1102569765 12:113820398-113820420 CCAGGCAGAGGGAAGAGGCAGCT 0: 1
1: 0
2: 14
3: 115
4: 685
Right 1102569778 12:113820434-113820456 GTGGGAGCCTGCAGGGAGGAAGG 0: 1
1: 0
2: 10
3: 88
4: 796
1102569764_1102569778 14 Left 1102569764 12:113820397-113820419 CCCAGGCAGAGGGAAGAGGCAGC 0: 1
1: 0
2: 8
3: 96
4: 666
Right 1102569778 12:113820434-113820456 GTGGGAGCCTGCAGGGAGGAAGG 0: 1
1: 0
2: 10
3: 88
4: 796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102569778 Original CRISPR GTGGGAGCCTGCAGGGAGGA AGG Intronic
900225761 1:1533009-1533031 GTGGGCGCTTGCAGAGGGGACGG + Intronic
900320531 1:2081391-2081413 GGGGCAGGCTGCAGGGAGCAGGG + Intronic
900840218 1:5042672-5042694 GAAGGAGCCAGCAGGGAGCAGGG - Intergenic
901001409 1:6150689-6150711 GGGGGTGACTGAAGGGAGGATGG + Intronic
901173630 1:7282702-7282724 CAGGGAGCCTGCAGTGAGGGAGG + Intronic
901325221 1:8361273-8361295 GTGGGAGCCTGCAAGGCTGGGGG + Exonic
901656100 1:10770596-10770618 GTGGGAGCATGCAGGACAGAGGG - Intronic
901752848 1:11422112-11422134 GTGGGAGGCAGGAGTGAGGAAGG - Intergenic
901759132 1:11459307-11459329 GGGGGCGCCAGCAGGGAGCAGGG + Intergenic
901782353 1:11602368-11602390 GAGGGAGCCTGGAGCCAGGATGG + Intergenic
902163639 1:14552360-14552382 GGAGCCGCCTGCAGGGAGGAGGG + Intergenic
902820158 1:18938714-18938736 GGGAGACCCTGCAGGGAGGGTGG + Intronic
903282325 1:22257139-22257161 TTGTGATCCTGCAGGGAAGAAGG - Intergenic
903421055 1:23217783-23217805 GTAGGGGTCTGCAGGGAGGTGGG + Intergenic
903750864 1:25619501-25619523 GTGGGCGCTGGAAGGGAGGATGG - Intronic
903937775 1:26908625-26908647 GTTGGAGGCTGCAGTGAGCATGG - Intronic
904029038 1:27522643-27522665 GTGGCAGGCTGAATGGAGGAGGG + Intergenic
904491049 1:30859257-30859279 GTGGCAGTCTGCAGGGAGGTAGG - Intergenic
905323683 1:37135012-37135034 GTGGGAGTTTGCTGGGTGGAGGG + Intergenic
905341296 1:37279691-37279713 GTGGGAGACTGGAGGATGGAAGG - Intergenic
905375007 1:37514389-37514411 GAGGGGGCGTGGAGGGAGGACGG - Intronic
905567061 1:38973916-38973938 GTGGGAGCCAGAAGGGAGACTGG - Intergenic
905976743 1:42181032-42181054 GTGGCAGACAGCAGTGAGGAAGG - Intronic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
906681963 1:47733232-47733254 GTGGGAGTCAGGAGAGAGGATGG - Intergenic
906810798 1:48825121-48825143 GGGGTAGCTTGGAGGGAGGAGGG + Intronic
907074623 1:51567005-51567027 GTGGGAGCATGGAGAGAGGCAGG - Intergenic
907437661 1:54459788-54459810 GTTGGGGCCTCCTGGGAGGATGG + Intergenic
907490566 1:54806359-54806381 GTGGGGGCCGGCAGTGAGGAGGG + Intronic
908433816 1:64085296-64085318 ATGGGATCCTGCAAAGAGGAAGG + Intronic
909994736 1:82265568-82265590 GTGGGAGCCTTCAGCAATGAAGG + Intergenic
910223946 1:84917210-84917232 GTGGGAGGCTGAGGGTAGGATGG + Intergenic
911001026 1:93165894-93165916 GTGGGAGGCTGGGGGGTGGAGGG - Intronic
912394954 1:109335285-109335307 TGGGGAGCCTGCAGGCAGCAAGG + Intronic
912413061 1:109491083-109491105 GGGGGAGCCTGCAGGGTAGCTGG - Exonic
912497260 1:110099683-110099705 GAGGGGGCCGGCAGGGAGGGAGG + Intergenic
912554852 1:110508490-110508512 AGAGCAGCCTGCAGGGAGGAAGG + Intergenic
913320069 1:117581879-117581901 GCTGGAGCCTACAGGCAGGAGGG + Intergenic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
915128256 1:153680264-153680286 GGGGGAGGCGGAAGGGAGGAAGG - Intronic
915129443 1:153686737-153686759 GTGGGAGCCTGCAGGTGAGGGGG + Exonic
915285150 1:154847498-154847520 GGGGTTGCCTGCAGGGAGGCTGG + Intronic
915631383 1:157155852-157155874 GAGCCAGCCTCCAGGGAGGACGG + Intergenic
915734696 1:158077420-158077442 GGGGGAGCCTGGAGGAAGGAGGG + Intronic
916179408 1:162070510-162070532 GGGGGAGTCTGCAGGTGGGAAGG - Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916419861 1:164626817-164626839 GGGGGAACCTGCAGGCATGATGG - Intronic
916850046 1:168694597-168694619 CTGGGAGGGTGCAGGGAGCATGG - Intergenic
916909692 1:169333318-169333340 GTGGGAGGCTGTAGGGAAGGTGG + Intronic
917422189 1:174875448-174875470 GTGGTTGCCAGCAGGGAGTAAGG + Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917535568 1:175872128-175872150 GTGGGAGCTTGCAGGATGAAAGG + Intergenic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918125795 1:181582293-181582315 GTGGGAGGCAGCAGGAAGGAGGG + Intronic
919691518 1:200532197-200532219 GGGGGAGTCTGGAGGGAGGCAGG + Intergenic
919898198 1:202022989-202023011 CTTGGATCCTGCAGGGTGGATGG + Intergenic
919988412 1:202691830-202691852 CAGGAAACCTGCAGGGAGGAGGG - Intronic
920074758 1:203327847-203327869 GAGGGACTCTGGAGGGAGGACGG - Intergenic
920203108 1:204272642-204272664 GTGGTTGCCTCTAGGGAGGAAGG - Intronic
920254704 1:204646501-204646523 GGGGGAGCTGGCAGGGAGGAGGG + Intronic
920441646 1:205984880-205984902 CTGGGAGGAGGCAGGGAGGAGGG - Intronic
920508877 1:206536205-206536227 GTGGGTGCCTGCAGGTAGATGGG + Intronic
920717672 1:208356008-208356030 GTGGGAGGCTGGATGGGGGAGGG + Intergenic
920931702 1:210394749-210394771 CTGGAAGGCTGCAGGGAGCAGGG + Intronic
921194522 1:212741930-212741952 GTGGGAGCCTGTAGCAAGGCAGG - Intronic
922155495 1:223037388-223037410 GCGGGAGCATGCAGACAGGAAGG + Intergenic
922340033 1:224647740-224647762 CTGGGAGCCAGCAGGGCAGAGGG + Intronic
922466525 1:225848696-225848718 GTGGGGGAGTGCAGGGATGAGGG + Intronic
923499543 1:234553400-234553422 GTGGGAGCCTGAAGTGGGGATGG - Intergenic
923789806 1:237102351-237102373 GTGTGTGCCTGCATGCAGGATGG - Intronic
923855364 1:237839494-237839516 GTGAGTGCCTGCAGAGAGGCAGG + Intergenic
924145751 1:241072936-241072958 CTGGGAGGCTGCATGGAGTAGGG + Intronic
1063371080 10:5523554-5523576 GTGGGAGCCCTCAGGTAGGAAGG + Intergenic
1063410501 10:5833214-5833236 GATGGAGGCTGCAGGGAGCAGGG + Intronic
1063924979 10:10968539-10968561 GTGGGAGTGTACAGGGAGCAGGG + Intergenic
1063968982 10:11368144-11368166 GTGGGACTCCCCAGGGAGGAAGG + Intergenic
1064068834 10:12207701-12207723 GTGGGAGCAGGGTGGGAGGAAGG + Intronic
1064203938 10:13306916-13306938 GTGGGGGCCAGCAGTGGGGAAGG - Intergenic
1064762256 10:18633263-18633285 GTGGGAGCGGGGAGGGGGGAGGG + Intronic
1065193536 10:23237812-23237834 GAGGGAGCTTGCAGGGATGATGG + Intronic
1065571979 10:27080622-27080644 GTGGGAGCTTATAGGAAGGAAGG - Intronic
1065602946 10:27388322-27388344 GTGAGAGCCTGCAAGTGGGAAGG - Intergenic
1065652876 10:27911859-27911881 GTGGTAGCCTGCTGGGAGTGTGG - Intronic
1066022912 10:31320080-31320102 GCGGGAGGCGCCAGGGAGGAGGG - Intronic
1066573608 10:36801280-36801302 GTGAGAGTCTCCAGGGTGGAAGG + Intergenic
1067090249 10:43262741-43262763 CTGGGAGCCTCCTGGCAGGAGGG + Intronic
1067099327 10:43323107-43323129 CGGGGAGCCTGCAGAGAGCAGGG + Intergenic
1067697529 10:48546826-48546848 TAGAGAGCATGCAGGGAGGAGGG + Intronic
1067799490 10:49349300-49349322 GAGGGAGCCGGGAGGGAGGAAGG + Intergenic
1068098069 10:52516862-52516884 GTGGGAGCCCACGGGTAGGAGGG - Intergenic
1068725339 10:60294502-60294524 TAGGGGGCTTGCAGGGAGGATGG + Intronic
1069076563 10:64043471-64043493 GAGAGAGTCTGCAGGGAGAAAGG - Intergenic
1069620685 10:69835547-69835569 GTGGGAGGGTGCAGTGAAGAGGG - Intronic
1069897290 10:71687602-71687624 GCAGGAGGCTGCAGGGAGGCAGG - Intronic
1069902820 10:71715727-71715749 GAGGGGGTCTGCAGAGAGGAAGG + Exonic
1070158459 10:73851006-73851028 CAGGGAGCCTGCGGGGAGGAGGG - Intronic
1070341084 10:75499031-75499053 CTGGGAACCTGGAGGCAGGAGGG + Intronic
1070593785 10:77818582-77818604 GCTGGAGCCTCCAGGGAGAAGGG - Intronic
1070798968 10:79233833-79233855 GTGCCAGCCTGCAGCTAGGAGGG - Intronic
1070801320 10:79246072-79246094 GTGGCAGCCTGCTGCGGGGAAGG + Intronic
1071009602 10:80922584-80922606 GTTGGAGGGTGCAGGGAAGAGGG + Intergenic
1072231468 10:93417553-93417575 ATGGGAGCCTGGAGGAAGAAGGG - Intronic
1072430890 10:95369693-95369715 GTGCCAGCATGCAGTGAGGAGGG - Intronic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073075937 10:100825972-100825994 CAGGGAGTCTGCAGGGAGGTGGG + Intronic
1073483007 10:103798732-103798754 GTGGGAGCCCGCTGGGAGCTGGG - Intronic
1073537456 10:104290753-104290775 GTGTGAGCTGGCAGGGAGGTGGG + Intronic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074340072 10:112619828-112619850 GTGGGATCAGGAAGGGAGGATGG + Intronic
1075015198 10:118905598-118905620 ATGGAAGGCTGCAAGGAGGAAGG + Intergenic
1075559855 10:123460548-123460570 GGAGGAGCCTGCTGGGAGGATGG - Intergenic
1075688195 10:124378358-124378380 GAGGGAGAATGCAGTGAGGAGGG + Intergenic
1076120705 10:127934788-127934810 GTGGGAACTTGCTGGAAGGAAGG + Intronic
1076684894 10:132194138-132194160 GTGGGTGGCTGCAGGGAGGCTGG + Intronic
1076717828 10:132375475-132375497 GCGGGAACCTGCAGGAAGAAGGG - Exonic
1076798678 10:132810864-132810886 GTGGGACCCACAAGGGAGGAGGG - Intronic
1076850453 10:133089930-133089952 GTGGGAGCCTGGGGGCAGGCAGG - Intronic
1076851598 10:133095991-133096013 GTGGGTGCCAGCAGGGGTGAGGG - Intronic
1077054991 11:587126-587148 GCAGGAGCCTGCGGGGAGGTGGG + Intronic
1077141403 11:1026471-1026493 GTGGGCACCTGGAGGGAGGCAGG + Exonic
1077550285 11:3197146-3197168 GTGGGATCCTGGAGTGAGCAGGG + Intergenic
1078050678 11:7962700-7962722 GTGGGTGCCTGGGGGGAGGGAGG - Intronic
1078079087 11:8191096-8191118 TTGGGAGGCCCCAGGGAGGATGG + Intergenic
1078182085 11:9020343-9020365 GTGGAAGCTTGCAACGAGGAAGG + Intergenic
1081025291 11:38005083-38005105 GGGGGAGCGGGGAGGGAGGAGGG + Intergenic
1081866085 11:46361537-46361559 GTCTCAGGCTGCAGGGAGGAGGG + Intronic
1083148139 11:60773666-60773688 GAGGCAGCCTGCAGGGTGAAGGG + Intronic
1083253448 11:61482571-61482593 GTGGGAGGGTGCAGGGAGGAGGG + Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083445652 11:62706511-62706533 CTTGGGGCCTGCAGGGAGGCAGG - Intronic
1083594223 11:63911425-63911447 GAGGGAGGCTGCAGGGGGGGAGG - Exonic
1083716569 11:64580879-64580901 GTGGGAGCCCACAGGAAGGGGGG + Intergenic
1083927289 11:65815740-65815762 GTGGGACCCAGCAGGCTGGAGGG + Intergenic
1084096613 11:66915587-66915609 CTGTGATCCTGCAGGGAGCAAGG + Intronic
1084362034 11:68674977-68674999 GGAGGACCCTGCAGGGAGGAGGG + Intergenic
1084444160 11:69193807-69193829 GTGTGAGTCAGCAGGGTGGAGGG + Intergenic
1084572262 11:69966742-69966764 CTGGGACCCTGCAGAGAGCATGG + Intergenic
1084653285 11:70501337-70501359 GTGCCAGAGTGCAGGGAGGACGG + Intronic
1085181435 11:74540178-74540200 GTAGGAGACCGGAGGGAGGAAGG + Intronic
1085304125 11:75475637-75475659 GTGAGCGACTGCAGGGAGAAAGG + Intronic
1085410336 11:76287108-76287130 GCAGGAGCCTGGAGAGAGGATGG - Intergenic
1085778310 11:79385848-79385870 GTGGTAACTTGGAGGGAGGAGGG - Intronic
1086018962 11:82202579-82202601 GTGTGAGTCTGCAGGGAGTTAGG - Intergenic
1086555331 11:88103818-88103840 GTGAGATCCTGCAGGAGGGAGGG + Intergenic
1087396567 11:97608826-97608848 GTGGGAGCATGCAGACAGGCAGG + Intergenic
1087652546 11:100884923-100884945 GAGGGAGCAGGCAGGGAGAATGG - Intronic
1088645083 11:111911549-111911571 CTGGGTGCCCGCAGGAAGGAGGG + Exonic
1089320996 11:117626693-117626715 GTGGGTGCCTGCAATGATGATGG - Intronic
1089532110 11:119136907-119136929 GTGGGCTCCTGGAGGGAGGAGGG + Intergenic
1089554796 11:119310456-119310478 GGGGTAGCGTGCTGGGAGGAGGG + Exonic
1089597447 11:119589864-119589886 ATGGGAGTCTGCAGGAGGGAAGG + Intergenic
1089608555 11:119656517-119656539 GTGGGGGCTTTCAGGGATGAGGG + Intronic
1089626270 11:119753050-119753072 GGGAGAGCCTGCATGGAGGCTGG - Intergenic
1089667689 11:120030775-120030797 GTGGGAGCCTCCAGGAGGGTGGG + Intergenic
1089777428 11:120848133-120848155 GAGGAATGCTGCAGGGAGGATGG + Intronic
1089889862 11:121870158-121870180 GAGGAAGCCTGCAGGGAGAAAGG - Intergenic
1090044219 11:123316855-123316877 GAGGGAGGAAGCAGGGAGGAAGG + Intergenic
1090238238 11:125164965-125164987 GAGGGAGGCAGCAGGGAGGAGGG + Intronic
1090562647 11:127949168-127949190 GTGGGAGGTTGGAGGGAGGGAGG - Intergenic
1090844658 11:130520505-130520527 CTGGGAGGCGTCAGGGAGGAAGG + Intergenic
1091172610 11:133531867-133531889 GTTGGGACCTGCAGGGTGGAAGG - Intronic
1091219221 11:133920459-133920481 GCGGGCACCTGCAGGGAGGTGGG + Exonic
1091277209 11:134360598-134360620 GTGGGTGCCTGGAGGTGGGAGGG - Intronic
1091342184 11:134824469-134824491 CTGGGAGACTGCAGAGATGAAGG + Intergenic
1091654455 12:2335277-2335299 GTGGGAGCCTGCAGGCATGGCGG - Intronic
1091792623 12:3280504-3280526 GTGGGGCCAGGCAGGGAGGAGGG + Intronic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1092981476 12:13799223-13799245 GTGGGGACCTGCAGGGGGAAGGG - Intronic
1093135631 12:15446984-15447006 GTGCTAACATGCAGGGAGGAGGG - Intronic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094579252 12:31718905-31718927 GTGGGAGCTTGGCGGGGGGAGGG - Intronic
1094778912 12:33766814-33766836 GTCAAAGCCTGCAGTGAGGAAGG + Intergenic
1096215591 12:49796112-49796134 GTGGGCACCTGCAGTGGGGATGG + Exonic
1096536507 12:52278534-52278556 CAGGGAGCTTGCAGGGTGGAAGG + Intronic
1097189256 12:57211735-57211757 GTGGGCACCTGCAGAAAGGAGGG - Exonic
1099698992 12:86060919-86060941 GGGGGAACATGTAGGGAGGAAGG + Intronic
1100800748 12:98227892-98227914 GTGGGTCCCTGCAGGGAGTCAGG - Intergenic
1101636931 12:106551636-106551658 CTGGGAGGCTGCAGCGAGGCTGG - Intronic
1101830851 12:108255311-108255333 GTGGGAGACAAGAGGGAGGAAGG + Intergenic
1102207530 12:111100640-111100662 ATGTGAGCTTGCATGGAGGAGGG + Intronic
1102397106 12:112595814-112595836 GTGGTTGCCCCCAGGGAGGACGG - Intronic
1102569778 12:113820434-113820456 GTGGGAGCCTGCAGGGAGGAAGG + Intronic
1102582857 12:113902264-113902286 GTGGGAGGCAGGAGGGAGGGAGG - Intronic
1102683044 12:114703384-114703406 TTGGGAGCCTGCAGGGGGCAGGG - Intergenic
1102952750 12:117041159-117041181 GGAGGAGCCATCAGGGAGGAGGG + Intronic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103731112 12:123028338-123028360 GGGGCAGCTTGCAGAGAGGAAGG + Intronic
1103899717 12:124296932-124296954 ATGGGAGCCTGGCGGGTGGAAGG + Intronic
1103930246 12:124446297-124446319 TTTGGTGGCTGCAGGGAGGAAGG - Intronic
1104144423 12:126018966-126018988 GTGGGACATTGAAGGGAGGAGGG - Intergenic
1104214191 12:126720089-126720111 GTGGGAGCTTTCAGGGTGTATGG - Intergenic
1104748261 12:131223198-131223220 GTTGGAGGATGCAGGGAGGAGGG - Intergenic
1104880161 12:132065182-132065204 GAGGGACCCTGCAGGGACCAAGG + Intronic
1104987194 12:132603802-132603824 GCGGGAGCCTGCACCGAGCACGG + Intronic
1105306689 13:19173969-19173991 GTGGGAGAAGGCATGGAGGAGGG - Exonic
1105845102 13:24287034-24287056 GTGGGAGCCTGATGGGGGGGCGG - Intronic
1105847313 13:24304556-24304578 GTGGGGGGCTGCAGGGGAGAAGG - Exonic
1106477218 13:30109020-30109042 AGGGGAGCCTGGAGGGAGGTGGG - Intergenic
1106553185 13:30788828-30788850 GTGCCAGGCTGCATGGAGGAAGG - Intergenic
1106801927 13:33264653-33264675 GTGGGAGCCTTCAAAGAAGAAGG + Intronic
1107769722 13:43776848-43776870 GTGGGAGACCGCAGGGAAAAGGG - Intronic
1109493932 13:63143161-63143183 GTGGGAGGGAGGAGGGAGGAAGG + Intergenic
1109873231 13:68364932-68364954 GGCGGAGCCTGCAGTGAGCAGGG - Intergenic
1111354528 13:87080546-87080568 TTCTGAGCCTGCAGGGAGCAGGG + Intergenic
1112739021 13:102453345-102453367 TTGGGAGACTGAAGGGAGGAAGG + Intergenic
1112786064 13:102953066-102953088 CCTGGTGCCTGCAGGGAGGATGG + Intergenic
1113508328 13:110832006-110832028 GCGGGAGGCAGCAGGCAGGATGG + Intergenic
1113604874 13:111597958-111597980 GTGGCTTCCTGCAGGGAGGGTGG + Intronic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113643537 13:111975991-111976013 GTGGGCGCCTGCCGGGAGGAGGG + Intergenic
1113728847 13:112625373-112625395 TGTGGAGCCGGCAGGGAGGAAGG - Intergenic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1115497515 14:34021229-34021251 GTGGCAGGCTGCAGGGAGAAAGG - Intronic
1116192048 14:41674806-41674828 GGGGGCGGCTGCCGGGAGGAGGG + Intronic
1117051740 14:51867111-51867133 GTTGGAGCCCGCAGAGAGGTAGG - Intronic
1117145578 14:52833859-52833881 GGGCGAGCCGGCAGGGGGGAGGG - Intergenic
1117971476 14:61255016-61255038 GTGTGGGACTGCAGTGAGGATGG - Intronic
1118318214 14:64738246-64738268 CAGGGAGCATGCAAGGAGGAGGG - Intronic
1119314732 14:73683602-73683624 GTGGGGGGCTGAGGGGAGGATGG - Intronic
1119409616 14:74422229-74422251 GGGGGCAGCTGCAGGGAGGAAGG + Intronic
1119679586 14:76582151-76582173 GTGGGCGTGTCCAGGGAGGATGG + Intergenic
1120212631 14:81649007-81649029 GTGGGATGCTGCGGGGAGGTGGG + Intergenic
1120730368 14:87994216-87994238 CTGGGACCCTACAGGGACGAAGG + Intergenic
1120833241 14:89016699-89016721 GTGGGAGCCTCCAAGGAGAAAGG - Intergenic
1121199570 14:92106301-92106323 CTGGGAGCCGGGAGGGAGTATGG - Intronic
1121566117 14:94910445-94910467 CTGGGAGCCTGAAGGGGAGAGGG - Intergenic
1121626029 14:95385957-95385979 GTCAGAGCCAGCAGGGAGGGAGG - Intergenic
1121825733 14:97008222-97008244 GAGGGAGCCTCCAGGGTGCAGGG + Intergenic
1122270518 14:100566879-100566901 GTGGGAGCCTGGGGGCAGGTGGG - Intronic
1122309390 14:100785002-100785024 CTGGGAGCCGGCAGGGCAGAAGG - Intergenic
1122930911 14:104932750-104932772 GGAGGTGCCTGCGGGGAGGATGG - Exonic
1122937681 14:104967490-104967512 CTGGGAACCTGCATGGGGGAAGG + Intronic
1123121450 14:105918818-105918840 GTGGGTTCCAGCTGGGAGGAAGG + Intronic
1124169285 15:27358595-27358617 GTGGAACCCGGCAGGAAGGACGG - Intronic
1124218355 15:27828165-27828187 GTGGGAGCTGGCAGGGGGTAGGG - Intronic
1124483605 15:30098030-30098052 GAGGGAGCCTGCAGGGCAGCCGG - Intergenic
1124519973 15:30399196-30399218 GAGGGAGCCTGCAGGGCAGCCGG + Intergenic
1124538681 15:30567028-30567050 GAGGGAGCCTGCAGGGCAGCCGG - Intergenic
1124708751 15:31987271-31987293 GGGGGTGCCAGCAGGGAGGCAGG - Intergenic
1124759969 15:32440554-32440576 GAGGGAGCCTGCAGGGCAGCCGG + Intergenic
1125723918 15:41858579-41858601 GTGAGGCCCTGCAGGCAGGAGGG - Intronic
1125743155 15:41981504-41981526 GAGGAAGCCTGAAGGGATGAGGG + Intergenic
1126429266 15:48563414-48563436 CAGGGAGCAGGCAGGGAGGAGGG + Intronic
1126752351 15:51889757-51889779 TTGGGAGGCTGAGGGGAGGATGG + Intronic
1127488108 15:59437955-59437977 GTGGGAACGAGGAGGGAGGAGGG + Intronic
1127973282 15:63978864-63978886 ATGCCACCCTGCAGGGAGGAAGG - Intronic
1128745272 15:70110070-70110092 GAGGGAGGCTGCAGGCAGGTGGG - Intergenic
1128793076 15:70447420-70447442 GTCAGACCCTGGAGGGAGGAAGG + Intergenic
1129315153 15:74738202-74738224 GTGGGAGCAGGGAGGGAGTAGGG + Intergenic
1129322077 15:74781014-74781036 GTGGGAGAGTGCAGGGTGGCGGG - Intergenic
1129789867 15:78333766-78333788 CTGGTGGCCTGCATGGAGGATGG - Intergenic
1130054124 15:80507660-80507682 GTTGGAGCCTCCAGGGAGAAAGG + Intronic
1131364292 15:91825060-91825082 TTGGGAGGCTACAGAGAGGATGG - Intergenic
1131529537 15:93179904-93179926 ATGGGAGCGTGCTGGGAGGTAGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132229565 15:100171483-100171505 GTGGGAGCGTGCAGGGGTCAGGG - Intronic
1132243120 15:100276038-100276060 GTGGGTGCCTGGTGGGAGGGTGG + Intronic
1132243173 15:100276170-100276192 GTGGGTGCCTGGTGGGAGGGTGG + Intronic
1132243185 15:100276199-100276221 GTGGGTGCCTGGTGGGAGGGTGG + Intronic
1132243220 15:100276286-100276308 GTGGGTGCCTGGTGGGAGGGTGG + Intronic
1132243231 15:100276315-100276337 GTGGGTGCCTGGTGGGAGGGTGG + Intronic
1132243261 15:100276394-100276416 GTGGGTGCCTGGTGGGAGGGTGG + Intronic
1132243273 15:100276423-100276445 GTGGGTGCCTGGTGGGAGGGTGG + Intronic
1132243295 15:100276473-100276495 GTGGGTGCCTGGTGGGAGGGTGG + Intronic
1132243307 15:100276502-100276524 GTGGGTGCCTGGTGGGAGGGTGG + Intronic
1132393127 15:101453332-101453354 GGGGCAGCCTGCGGGGAGCAGGG - Intronic
1132409985 15:101569355-101569377 CTGGGAGCGGGCAGGGTGGAAGG + Intergenic
1132853957 16:2036563-2036585 CTGGGTCCTTGCAGGGAGGAGGG + Intronic
1132866535 16:2095643-2095665 GCTGGAGGCTGCAGTGAGGAAGG + Intronic
1132954678 16:2585426-2585448 GTGCGGCCCTGCAGGGAGGGAGG - Intronic
1133271474 16:4612809-4612831 GTGGGGGCCGCCAGGGAGGCTGG - Intronic
1133371551 16:5249239-5249261 CTGGGGGCCTTCAGGAAGGATGG + Intergenic
1133704094 16:8336919-8336941 GTGGAATCTTGGAGGGAGGATGG - Intergenic
1134041052 16:11068586-11068608 CTGGAAGCCTGCAGGGAGACAGG - Intronic
1134076773 16:11297583-11297605 GGGGGAGTCTGCAGGGAAGGGGG - Intronic
1134878060 16:17719832-17719854 GGGGGAGCCTTCAGGAAGGTGGG + Intergenic
1136340670 16:29641010-29641032 GGGGGAGCCTCCAGGGCAGAGGG + Intergenic
1136711443 16:32240389-32240411 TGGGGAGGCAGCAGGGAGGAGGG - Intergenic
1136756467 16:32689016-32689038 CGGGGAGGCAGCAGGGAGGAGGG + Intergenic
1136778433 16:32883516-32883538 GTGGGAGCCAGCTGGGAAAAGGG + Intergenic
1136811644 16:33181357-33181379 CGGGGAGGCAGCAGGGAGGAGGG - Intergenic
1136818120 16:33291437-33291459 CGGGGAGGCAGCAGGGAGGAGGG - Intronic
1136824684 16:33347966-33347988 CGGGGAGGCAGCAGGGAGGAGGG - Intergenic
1136829750 16:33446737-33446759 CGGGGAGGCAGCAGGGAGGAGGG - Intergenic
1136892187 16:33977998-33978020 GTGGGAGCCAGCTGGGAAAAGGG - Intergenic
1137031260 16:35526559-35526581 TGGGGAGGCAGCAGGGAGGAGGG + Intergenic
1137552688 16:49451438-49451460 GTGAGAGTCTGCAGGCAGGAAGG - Intergenic
1138128334 16:54456985-54457007 GGGGGAGCCAGAAGGGAGGTGGG + Intergenic
1138282686 16:55784035-55784057 GAGGGGGCCTGCATGGGGGAAGG + Intergenic
1138935958 16:61723499-61723521 GTGGGATGCTGAAGGGAGAAGGG - Intronic
1140376748 16:74450995-74451017 GAAGGAGACTGCAGAGAGGAAGG + Intergenic
1140700177 16:77574482-77574504 GTGGGTGGAGGCAGGGAGGATGG - Intergenic
1140840092 16:78830532-78830554 CTGGGAATCTGCTGGGAGGAAGG - Intronic
1140860433 16:79013217-79013239 GTGGGAGGATGCACAGAGGAAGG - Intronic
1140890226 16:79278794-79278816 TTGGGGGCCAGCAGGCAGGAAGG - Intergenic
1140997534 16:80276066-80276088 GCTGGAGCGTGCAGGGAGAAGGG - Intergenic
1141147982 16:81545172-81545194 AAGGCACCCTGCAGGGAGGAGGG - Intronic
1141173321 16:81704426-81704448 GGGGGAGGGGGCAGGGAGGAGGG - Intronic
1141524679 16:84603981-84604003 GTGGGGGCCATCAGGGAGGGAGG - Intronic
1141693191 16:85607829-85607851 GTGGGGGCCTCAAGGGAAGAAGG - Intergenic
1141923687 16:87153311-87153333 TTGGGAGCCTTGAGGGTGGAAGG + Intronic
1141988471 16:87595095-87595117 CTGGGAGCCACCAAGGAGGAGGG + Intergenic
1142287522 16:89177466-89177488 GAGGGGGCCTCCAGGGAGGAGGG + Intronic
1202990222 16_KI270728v1_random:4326-4348 CGGGGAGGCAGCAGGGAGGAGGG - Intergenic
1203058611 16_KI270728v1_random:949370-949392 CGGGGAGGCAGCAGGGAGGAGGG + Intergenic
1203080855 16_KI270728v1_random:1145625-1145647 GTGGGAGCCAGCTGGGAAAAGGG + Intergenic
1142560236 17:805240-805262 GGGGATGCCTGCAGGGAAGAGGG + Exonic
1143155655 17:4834309-4834331 CTGGGAGCCCTCGGGGAGGAGGG + Intronic
1143552032 17:7636273-7636295 GTGTGAGCCAGCAGGGAGGGGGG + Intergenic
1143698292 17:8637191-8637213 GTGGGAGCAGGGTGGGAGGAGGG + Intergenic
1144198817 17:12920646-12920668 GTGAGAGCCAGGAGGTAGGATGG + Intronic
1144205066 17:12974165-12974187 GCGGGAGGCTGCATGGAGGGCGG - Exonic
1144456659 17:15424262-15424284 CTGGTAGCCTGGAGGGAGGCAGG - Intergenic
1144675452 17:17158702-17158724 GCGGGAGCGTGCACGGAGGCGGG + Exonic
1144721192 17:17470922-17470944 GAGAGAGCCAGCAGGAAGGAGGG + Intergenic
1144876797 17:18401289-18401311 GTGGGTGCTTGTAGGGAGGGGGG - Intergenic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145911248 17:28544563-28544585 GAGTGAGCCTCCAGGGAGGTGGG - Intronic
1146582602 17:34052439-34052461 GTGGGAGTCTACACGGAGAATGG + Intronic
1146938251 17:36825923-36825945 GCTGGAGCCTGTAGGCAGGAGGG - Intergenic
1147155500 17:38542654-38542676 CTGGGAGCCAGTAGGGAGGCAGG + Intronic
1147251784 17:39156935-39156957 CAGGCAGCCTGCAGGGAGGAAGG + Exonic
1147458514 17:40553693-40553715 CTGGGAGAGGGCAGGGAGGAGGG + Intergenic
1147559766 17:41501630-41501652 GTGGGAGCTGGCGGGGAGGGAGG - Intronic
1147612574 17:41810746-41810768 GGAGGAGCCAGCCGGGAGGAAGG - Intronic
1147660139 17:42112961-42112983 GTGGGGGGCTGCAGGCAGGTAGG + Intergenic
1147769259 17:42856507-42856529 GTGGGAGAAGGCAGGGAGGTCGG - Exonic
1147771993 17:42874326-42874348 GTGGGAGAAGGCAGGGAGGTCGG - Intergenic
1147840492 17:43368340-43368362 GGGCCAGCCTGCGGGGAGGACGG - Intergenic
1148195246 17:45708498-45708520 CTGGGACCCTGCAAGGAGGCAGG - Intergenic
1148368539 17:47075232-47075254 GTGGGAGATTGCAGGGATGGTGG - Intergenic
1148479183 17:47949055-47949077 GTGGCCCCCTGCAGGCAGGAGGG + Intergenic
1148805673 17:50262661-50262683 GTGGGAGGCGGCAAGGTGGAGGG + Intergenic
1148872850 17:50668784-50668806 GGGGTAGCCTGCAGGGAGGCTGG - Intronic
1149002962 17:51775863-51775885 TTGGGAACCTGAAGGGAGGCAGG + Intronic
1149304551 17:55335334-55335356 TGGGGAGGCTGCAGGGGGGATGG - Intergenic
1149403255 17:56320706-56320728 GTGAGAGGCTGCTGAGAGGACGG + Intronic
1149686663 17:58539487-58539509 GAGGGAGTCTGCAGGGAGATGGG - Intronic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1150132532 17:62677109-62677131 GTTGGAGCCAGGAGGGAGGAAGG - Intronic
1150819973 17:68427061-68427083 GAGGGAGCGTGCAGGGAGAAGGG + Intronic
1151974485 17:77476560-77476582 GTGGACGCCTGCGGGGAGGAGGG + Intronic
1152002190 17:77653940-77653962 GGGGCAGGCAGCAGGGAGGAGGG - Intergenic
1152122653 17:78428232-78428254 CTGGAAGACTGCAGGGTGGAGGG + Intronic
1152247712 17:79193948-79193970 GGGAGAGCATGAAGGGAGGAAGG + Intronic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1152630400 17:81408390-81408412 GTGGGAGCCTGGGGGGTGGGAGG - Intronic
1152738326 17:82008228-82008250 GTGGGAGACTGCAGGGTAGACGG + Intronic
1152930818 17:83108825-83108847 GAAGGATCCTGCAGCGAGGAAGG - Intergenic
1154261560 18:12838550-12838572 CTGGGAGGCAGTAGGGAGGAGGG + Intronic
1154344804 18:13532849-13532871 TTGGGAGCCTGGAGGACGGAAGG - Intronic
1154346073 18:13544566-13544588 ATGGCAGCCTGCATGGTGGATGG + Intronic
1155358441 18:24977069-24977091 CTGGGAGCATGCAGGGAGCCTGG + Intergenic
1155490628 18:26398053-26398075 GTGACAGCCCTCAGGGAGGAGGG - Intergenic
1155493644 18:26422625-26422647 GTGGGACCTCACAGGGAGGAGGG - Intergenic
1155983171 18:32202164-32202186 ATGGGAGCCTGCCAGGAGGTGGG - Intronic
1156489056 18:37485673-37485695 GCGGGAGCCTGGAGGGCGGGCGG - Intronic
1156637803 18:39051933-39051955 ATGGGAGCCTTCATGGAAGAGGG - Intergenic
1156651964 18:39235594-39235616 GGGGGGCCGTGCAGGGAGGAAGG - Intergenic
1156970770 18:43151744-43151766 GTTCCAGCCTGCTGGGAGGAAGG - Intergenic
1157475284 18:48020142-48020164 GTGGAAGTCTGGATGGAGGAGGG - Intergenic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1157855402 18:51100470-51100492 GGGGGAGCCAGAAGGGAGGATGG - Intergenic
1158405124 18:57153801-57153823 GTGGGAGCCACGAGGGAGGAGGG - Intergenic
1158828518 18:61251887-61251909 CTGGGAGACAGCAGGGAGGCTGG - Intergenic
1159480858 18:68989613-68989635 CAGGGGGCCTGCGGGGAGGAAGG + Intronic
1159732854 18:72053340-72053362 GTGGGAGCATCCAGGGAGGTAGG + Intergenic
1159962786 18:74568469-74568491 GTGGGAGACAGCTGGGATGATGG + Intronic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1160570433 18:79813543-79813565 GGGGTAGCGTGGAGGGAGGATGG + Intergenic
1160679481 19:406242-406264 GTGGCAGCCCCCAGCGAGGACGG + Exonic
1160692031 19:464587-464609 GGGGAAGGCAGCAGGGAGGAGGG - Intronic
1160767524 19:815074-815096 GTGGACACCTGCAGGGCGGAAGG + Exonic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160874840 19:1292155-1292177 GGTGGCGCCTGCAGGGGGGAGGG - Intronic
1160903184 19:1439329-1439351 GTGGGAGGCTGCAGTGAGCTGGG - Intronic
1161051890 19:2168428-2168450 GTGGGTGGCTGCTTGGAGGAGGG + Intronic
1161297220 19:3526198-3526220 GTGGGGGCCTGCAGGGCGGATGG - Intronic
1161319907 19:3636371-3636393 GTGGGGGCCAGAAGGGAGGCAGG - Intronic
1161395763 19:4044137-4044159 GTGGGCGGCTGCAGGGAAGGTGG - Intergenic
1161457389 19:4376392-4376414 CTGGCTGCCGGCAGGGAGGAGGG - Intronic
1161457601 19:4377312-4377334 CTGGCTGCCAGCAGGGAGGAGGG + Intronic
1161591639 19:5131637-5131659 GGGGGAGGGGGCAGGGAGGAGGG + Intronic
1162562789 19:11427102-11427124 GTGGGAGAAGGAAGGGAGGAAGG - Intronic
1162913490 19:13862331-13862353 GTGGGAGGTGGCGGGGAGGAGGG + Intronic
1163186246 19:15641400-15641422 GTGGCATCCTGCAGGGCAGATGG - Exonic
1163580512 19:18135938-18135960 TTGGGAAGCTGCATGGAGGAGGG + Intronic
1163582681 19:18147677-18147699 GTGGGCCCCAGGAGGGAGGAAGG + Intronic
1163588186 19:18175273-18175295 GTGAGAGCCTGCTGGTAGGCTGG - Intronic
1163618302 19:18342418-18342440 GTTTGAGCTAGCAGGGAGGAGGG + Intronic
1163636010 19:18437517-18437539 GCGGGAGCCTGCAGGGGGCGGGG - Intronic
1163748011 19:19059427-19059449 CTGGGAGTCTCCAGGGAGGAGGG - Intronic
1163794782 19:19331120-19331142 GTGAGAGGCTGCAGGGAGCAGGG - Intronic
1163847850 19:19647318-19647340 GTGGCAGACTGCAGGGTGGTGGG + Exonic
1164462069 19:28457484-28457506 ATAGGAGATTGCAGGGAGGAAGG - Intergenic
1164825817 19:31284263-31284285 GTGGGAGGCTGCAGAGAGAATGG - Intronic
1165044207 19:33091797-33091819 GTGCGAGGCTGCAGGTAAGAGGG + Intronic
1165061888 19:33208916-33208938 GTGGCAGGCAGCAGGGAGGGTGG + Exonic
1165323884 19:35102850-35102872 GTGGGAGCCTGCCTGGAGTATGG - Intergenic
1165362509 19:35345612-35345634 GTGGGGGCCTTCAGAGAGGGGGG - Exonic
1165794529 19:38511225-38511247 GTTGGAGGCTGCAGGGAGCTGGG + Intronic
1166015220 19:39974446-39974468 GGGGGAGCCTGCAGCTGGGAGGG + Intronic
1166047695 19:40238995-40239017 GTGGGAGGTGGGAGGGAGGAGGG + Intronic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166870468 19:45867324-45867346 GGGAGAGCCTGCATGGGGGAAGG + Intronic
1166930920 19:46300952-46300974 GTGGGAACTGGCAGGGAGGTGGG - Intronic
1167217074 19:48171779-48171801 CTGGGGGCCTGCGTGGAGGAGGG - Exonic
1167233253 19:48298154-48298176 GTGGGAGACGGCAGGGAGCCGGG - Intronic
1167635933 19:50655776-50655798 GTGGGAGCCTGCAAGGCAGGAGG - Intronic
1167643527 19:50694557-50694579 TAGGGGGCCTGCTGGGAGGAAGG + Intronic
1167665491 19:50820961-50820983 GTGGGGGCAGGTAGGGAGGAGGG + Intronic
1167822421 19:51940721-51940743 GTGAGAGCCAGCAAGGAGGGTGG + Intronic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
1168312144 19:55465662-55465684 GTGGGGGCCAGCAGGCAGGTGGG + Intergenic
1168339209 19:55614094-55614116 TTGGGAACCTGAAGCGAGGAGGG + Exonic
1168472524 19:56651031-56651053 GTGGTTGTCTGCAGGAAGGAGGG - Intronic
1168595046 19:57668641-57668663 GAGGGAGAGTGCAGGGAAGAAGG + Intergenic
925017633 2:543768-543790 GTGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017695 2:543944-543966 GTGGGAGGCTGGAGGCAGGGAGG + Intergenic
925068952 2:951141-951163 GAGGGGGCGTGGAGGGAGGAGGG - Intronic
925662076 2:6213255-6213277 GTGGGAGCTTGCTGGGAGGCAGG - Intergenic
925730992 2:6919091-6919113 GTGGGAGCCCCCAGGAGGGAAGG + Intronic
925806093 2:7649896-7649918 GTGGGAGCCAGAAAGGAGGGTGG + Intergenic
925899456 2:8498227-8498249 GTGGTTGCTTGCAGGGAGGGAGG - Intergenic
925905963 2:8539806-8539828 CTGGGGCCCTGCAGCGAGGACGG - Intergenic
925978083 2:9155093-9155115 GTGGGAGATTGGAGGGAGGAAGG + Intergenic
926156150 2:10455027-10455049 GTGGGAGCCTGGAGGATGGGCGG - Intergenic
927174550 2:20396353-20396375 GTGGGAACCTGCAGTGGGCACGG - Intergenic
927184520 2:20472833-20472855 CTGGGAGCCTGCAGGGTGGTAGG + Intergenic
927497333 2:23559712-23559734 GCGGCAGGCTGCAGGGAGGTGGG + Intronic
927497819 2:23562526-23562548 GCCTGAGCCTGCAGGGAGGCAGG - Intronic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927646978 2:24884063-24884085 GTGAGAGGCTGTAGGGAAGAGGG - Intronic
927990482 2:27443497-27443519 GTTGGGCCCTGCAGGAAGGACGG + Exonic
928026189 2:27741253-27741275 GAGGGAGACTGCAGGGAGGGAGG - Intergenic
928392213 2:30918674-30918696 GTGGCATCAGGCAGGGAGGATGG + Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929560124 2:42951287-42951309 CAGAGAGCCTGCAGGAAGGAAGG + Intergenic
929776388 2:44933535-44933557 CTGGGAGACTGCATGGCGGAGGG - Intergenic
929994107 2:46814449-46814471 GGGGGAGCGTGGAGAGAGGAGGG - Intergenic
930108608 2:47658981-47659003 GAGGGAGCAGGCAGGCAGGAGGG - Intergenic
930755521 2:54968441-54968463 CTGGAAGCCAGAAGGGAGGATGG + Intronic
931390104 2:61834351-61834373 GAGGGAGAGTGGAGGGAGGAGGG + Intronic
931830587 2:66046988-66047010 CTGGGATCCAGTAGGGAGGAAGG + Intergenic
931855647 2:66299388-66299410 GAAGGAGTCTGCAAGGAGGACGG + Intergenic
931987950 2:67759097-67759119 GTTGGACCCTGGAGGGAAGAGGG - Intergenic
932048636 2:68376901-68376923 GTGGGGGACTGCAGGGAGGTGGG - Intronic
932337083 2:70937656-70937678 CCGGGTGCCTGCAGGGAGGAGGG - Intronic
932422268 2:71608240-71608262 GAGGGAGCCTGCAGAGAGGAGGG + Intronic
932460600 2:71879608-71879630 GTAGGTCCCGGCAGGGAGGAAGG - Intergenic
932573029 2:72947842-72947864 AGGGGAGCCGGCAGGGTGGAGGG - Intronic
932816342 2:74865170-74865192 GAGGAGGGCTGCAGGGAGGAGGG + Intronic
933262675 2:80147764-80147786 GTGGGTGGGTGCAGGGAGGTAGG - Intronic
934552731 2:95272002-95272024 TTGGGATCCTGCTGGGGGGAAGG + Intergenic
934557940 2:95297269-95297291 ATAGAAGCCGGCAGGGAGGAAGG + Intergenic
934704888 2:96470608-96470630 CTAGGAGCCTGCAGGCTGGAGGG + Intergenic
934771649 2:96911450-96911472 GTGGAAGCCTGCAGGGAGCAGGG + Intronic
934884073 2:98009008-98009030 GTGGAAGGCTGTAGGGAGAAAGG - Intergenic
935179720 2:100678572-100678594 GTGGGAGATTGCAGAGGGGATGG + Intergenic
935181244 2:100692939-100692961 GAGGGAGCTTGCAGGGAGAGTGG - Intergenic
935213281 2:100956359-100956381 GCTGGAGGCTGGAGGGAGGAAGG - Intronic
935520358 2:104096745-104096767 GTGGGAGGGTGGAGGGAGAAAGG - Intergenic
935982263 2:108638972-108638994 GGCGGAGCCTGCAGTGAGCATGG + Intronic
936514576 2:113173776-113173798 GTGGGGGCCTCCAAGGAGCAGGG + Intronic
936847275 2:116852567-116852589 GTGAATGCCTGCAGGGAGGCAGG + Intergenic
936847529 2:116854538-116854560 GTGAATGCCTGCAGGGAGGCAGG + Intergenic
937248514 2:120509483-120509505 GAGGGAGGCTGCAGGGAAGGAGG + Intergenic
937259884 2:120578497-120578519 GAGAGAGCCTGCAGGAGGGATGG + Intergenic
937884314 2:126889604-126889626 GTGGGAGCTGACAGGGAAGAGGG + Intergenic
938070964 2:128308184-128308206 GAGCGAGGCTGCAGGGAGGCAGG + Intronic
938080447 2:128367303-128367325 GAGGGGGGCTGCAGCGAGGAGGG - Intergenic
938100875 2:128497500-128497522 GTGGGAGGCAGCATGGAGCATGG - Intergenic
938201760 2:129378030-129378052 GTGGGAGGTTACAGAGAGGATGG + Intergenic
938422628 2:131156619-131156641 GTGGAAGGCTGCGGGGAGGTGGG + Intronic
939994618 2:148908243-148908265 GTGGGATCTTGCTGGGAGGGAGG - Intronic
940453703 2:153871756-153871778 GCGGGAGCAGGGAGGGAGGAGGG + Intergenic
940567751 2:155389431-155389453 GTGGGAGGAGGAAGGGAGGAAGG + Intergenic
941492140 2:166155425-166155447 ATGGGAGGATGCAGGGAGGCAGG + Intergenic
942116764 2:172735824-172735846 GCGGGAGCCCGCGGGGAGGGCGG + Exonic
942376577 2:175343824-175343846 GTGGCAGCCTGCAGTGATGGTGG + Intergenic
942958706 2:181804282-181804304 GTGGCAGCCTGGATGGGGGAGGG - Intergenic
944277191 2:197852236-197852258 GGGGGAGGGAGCAGGGAGGATGG + Intronic
945983898 2:216339390-216339412 GTGGGAGCCTGAAGGATGGGTGG - Intronic
946170069 2:217889881-217889903 GGGGGAGGCTGCAGCCAGGATGG - Intronic
946190062 2:218003284-218003306 GCGGGGGTCTGCAGTGAGGAGGG - Intergenic
946401105 2:219468844-219468866 GGGGCAGCCTGCAGAAAGGAGGG - Exonic
946402649 2:219476730-219476752 GTGGTGGCTTGCAGGGAGGCGGG + Intronic
946905385 2:224411032-224411054 GTGGGAGCCTGGTGGAATGAAGG + Intergenic
947718647 2:232354273-232354295 GTGAGAGCCTGCAGGGGCCAGGG + Intergenic
948571900 2:238922927-238922949 CTGAGTGCCAGCAGGGAGGATGG - Intergenic
948577658 2:238965023-238965045 GGGGGAGGCAGGAGGGAGGAGGG - Intergenic
948602570 2:239115789-239115811 GTGGGATCCTGCAGGAGGGGAGG - Intronic
948809289 2:240466663-240466685 GTGGGAGGAGGCGGGGAGGAAGG - Exonic
948854200 2:240722484-240722506 TTGGGAGCCTCCAGGGGTGATGG + Exonic
949043961 2:241862198-241862220 GTGGAAGCCTACTGGGTGGAAGG - Intergenic
1168830586 20:843249-843271 GTGGGAGGTTATAGGGAGGATGG + Intronic
1168954030 20:1821661-1821683 GTGAATGTCTGCAGGGAGGAAGG - Intergenic
1168998814 20:2151878-2151900 TTGGGTGCCTGCAGGGTAGAGGG + Intronic
1169291747 20:4359004-4359026 GTGGGAGCCAGAAGGGGAGAGGG + Intergenic
1170436761 20:16338367-16338389 ATGGCTGCCTGCAAGGAGGAGGG - Intronic
1170603493 20:17859384-17859406 ATGGCAGCCTTCAGGGATGAGGG + Intergenic
1170841333 20:19926959-19926981 ATAGGAAGCTGCAGGGAGGAGGG - Intronic
1171428140 20:25061321-25061343 GTGGGAGCCTGCTGGGTGATGGG - Intergenic
1171486656 20:25490725-25490747 GTGGGGGACTGCAGTGAGAAGGG + Intronic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171530230 20:25848393-25848415 CTGGGGGCCTGCAGAGAGGTCGG + Intronic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1172071536 20:32260947-32260969 CTGGGAGCCTCCAGGGACGAGGG + Intergenic
1172115950 20:32573820-32573842 CTGGGAGGCTCCATGGAGGATGG - Intronic
1172348336 20:34222251-34222273 ATGGTAGGCTACAGGGAGGAAGG + Intronic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172598669 20:36168448-36168470 ATGGGAAGCTGCAGTGAGGAGGG - Intronic
1172599696 20:36175309-36175331 GCAGTAGCCTGCAGGGAAGATGG + Intronic
1172626407 20:36350008-36350030 TTGGGAGCCTGTGGGGATGAGGG - Intronic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1173569595 20:44067756-44067778 GAGGGAGAGTGCAGTGAGGAGGG + Intronic
1173727086 20:45305609-45305631 GTCAGAGCCTGGAGGGAGGAAGG + Intronic
1173771785 20:45666137-45666159 GTGGCAGCCTGGCGGGGGGAGGG - Intronic
1173873178 20:46354312-46354334 TTGGCAGGCTGCAGGGAGCAAGG - Intronic
1173983312 20:47241544-47241566 GTGAGGGCAGGCAGGGAGGAGGG + Intronic
1174084170 20:47993521-47993543 GTGAGGTCCTGCAGGGAGGCTGG + Intergenic
1174339384 20:49886579-49886601 CTGGGAGCCTGCAGGGAGGCAGG - Intronic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1175247026 20:57588491-57588513 GGGGGGGCCTGCAGGGTGGTGGG - Intergenic
1175257413 20:57655679-57655701 GTTGGAGGCTGCTGGGAGCAGGG - Intronic
1175807613 20:61838473-61838495 ATGGGAGCCTTGAGGGAAGAAGG - Intronic
1175835048 20:61988281-61988303 CTGTGCACCTGCAGGGAGGAGGG + Intronic
1175854621 20:62113816-62113838 GTGGGAGAATGCAGGAGGGAGGG + Intergenic
1175874811 20:62224315-62224337 GTGGGAGAGTGCAGGAGGGAGGG + Intergenic
1175960909 20:62635976-62635998 GAGGGCGCCTGCAGGCAGCAGGG + Intergenic
1176090242 20:63315413-63315435 GAGGGAGCCGTCAGGGCGGAGGG - Exonic
1176106914 20:63393766-63393788 GTGCCAGCCCTCAGGGAGGACGG + Intergenic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1176129635 20:63491213-63491235 CAGAGAGCCTGCAGGGAGCAGGG - Intronic
1176171242 20:63697313-63697335 GGGGGTGCCTGCAGCCAGGAGGG - Exonic
1176290825 21:5043725-5043747 CTGGGAGAATGCAGTGAGGAAGG + Intergenic
1177348128 21:19900112-19900134 GGGGGAGGGTGCAGGGAGGCCGG - Intergenic
1177701558 21:24645688-24645710 GTGGGAGAGTGGTGGGAGGAGGG + Intergenic
1178376754 21:32073779-32073801 GGGGGAGCCCACAGGGAGCAGGG + Intergenic
1178612560 21:34097014-34097036 TTGGTAACCTGCAGAGAGGAGGG + Exonic
1178685245 21:34705495-34705517 CTGGGAGCCTGAAGGGTGGAAGG - Intronic
1178853259 21:36230752-36230774 CGAGGAGCCTGCAGGGAAGAGGG + Exonic
1179195681 21:39160433-39160455 GTGGGAGCCTTCATAGAGCATGG - Intergenic
1179251200 21:39673260-39673282 GTTGGAGGCGGCAGGGAGGGAGG + Intergenic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179866430 21:44219916-44219938 CTGGGAGAATGCAGTGAGGAAGG - Intergenic
1179932468 21:44579572-44579594 GTGGGCCCCTGCTGGGAGGCAGG + Exonic
1179979949 21:44890654-44890676 GTGGGAGAATGCAGGGACAAGGG + Intronic
1180168012 21:46040113-46040135 GGGAGAGGCTGGAGGGAGGATGG - Intergenic
1180593877 22:16961527-16961549 GGTAGAGCCTGCAGGGAGGACGG - Intergenic
1180641626 22:17303860-17303882 GTGGGAGCCAGGAGGAAGGCAGG - Intergenic
1180749130 22:18111957-18111979 CTGGGAGCCCGCTAGGAGGAGGG - Intronic
1181164155 22:20974500-20974522 GTGGGTGCCAGGAGGGTGGAGGG - Intronic
1181310867 22:21944033-21944055 GTGGCACTCTGCAGGGAGCAGGG - Intronic
1181557723 22:23681449-23681471 GTGGGAGCCTGCATGGACACAGG + Intergenic
1182010297 22:26995102-26995124 CTGGGAGCCTGGAGGGTGAAGGG + Intergenic
1182103265 22:27671990-27672012 GAGGGAGCAGGGAGGGAGGAAGG + Intergenic
1182104434 22:27679325-27679347 GTGGCTGCCTGAACGGAGGAAGG + Intergenic
1182483666 22:30626532-30626554 GTGCGAGGCTGCTGGGATGAGGG - Exonic
1183429046 22:37754862-37754884 GAGGGAGGCTGCAAGGAGGATGG - Exonic
1183489141 22:38107525-38107547 CTGGGAGGCTGCAGTGAGGAGGG + Intronic
1183642996 22:39103629-39103651 GTGGGACACCACAGGGAGGAAGG - Intronic
1184459050 22:44626903-44626925 GTTGCAGGCTGCAGGGAGGAAGG + Intergenic
1184582971 22:45429598-45429620 GTGGGAGGCTGCAGTGGGGCCGG + Intronic
1184881003 22:47304198-47304220 GCGTGGGCCTGCAGGGAGGCTGG - Intergenic
1185038415 22:48491154-48491176 CTGGCCGCCTGCAGGGAGCAGGG + Intronic
1185098628 22:48825676-48825698 AAGGGAGCAGGCAGGGAGGAGGG + Intronic
1185101836 22:48844745-48844767 GAGAGAGGCTGGAGGGAGGAAGG - Intronic
1185130387 22:49035513-49035535 AAGGCCGCCTGCAGGGAGGATGG + Intergenic
1185275693 22:49949440-49949462 GTGGGGGCCAGCCGGGAGGGTGG - Intergenic
1185332252 22:50257048-50257070 GGGGGAGGCTGCAGGGAGGCAGG - Intronic
1185376400 22:50484453-50484475 CTGAGAGGCTGCAGGGTGGAGGG + Exonic
1185395215 22:50583185-50583207 GTGGGAGCCGGCGGGGCGGCGGG + Intronic
949722708 3:7009626-7009648 AGGGGAGCCAGGAGGGAGGAAGG + Intronic
950253753 3:11487847-11487869 GGGGCAGCCTGCCGGGCGGAGGG + Intronic
950319838 3:12041124-12041146 GTGGCTGGCTGCAGGGAGGCAGG - Intronic
950427357 3:12931687-12931709 CTGGGATCCTGCAGGGAGCGTGG - Intronic
950671727 3:14531422-14531444 GAGGGATGCTGCAGGGAGGCTGG - Intronic
950677521 3:14563623-14563645 GAGGGAGAAGGCAGGGAGGAGGG + Intergenic
950894853 3:16439676-16439698 GTGGGTGGCTGGAGTGAGGAAGG + Intronic
951469091 3:23036146-23036168 GTGGCAGCCTGGATGGGGGAGGG - Intergenic
952206956 3:31189937-31189959 GCGGGGGCTGGCAGGGAGGAGGG - Intergenic
952322862 3:32294485-32294507 GTGGGAGTCTGCAGTCAGGCAGG + Intronic
952708334 3:36402775-36402797 GTGGGATCAAGCAGGCAGGATGG - Intronic
952834231 3:37590405-37590427 GAGGGAGCCAACAGGAAGGAGGG + Intronic
953619620 3:44521874-44521896 GTGCAAGCATGCATGGAGGAAGG - Intergenic
953626899 3:44579267-44579289 GCGGGAGCGTGCACGGAGGCGGG - Intronic
953763237 3:45711092-45711114 GTGGGATCCTGAAGGAATGAGGG + Intronic
954148748 3:48647207-48647229 GTGGGAGGGTGGAGGGTGGAGGG + Intronic
954148759 3:48647235-48647257 GTGGGAGGGTGGAGGGTGGAGGG + Intronic
954148805 3:48647362-48647384 GTGGGAGGGTGGAGGGTGGAAGG + Intronic
954148835 3:48647440-48647462 GTGGGAGGGTGGAGGGTGGAGGG + Intronic
954148846 3:48647468-48647490 GTGGGAGGGTGGAGGGTGGAGGG + Intronic
954148887 3:48647571-48647593 GTGGGAGGGTGGAGGGTGGAGGG + Intronic
954389454 3:50260995-50261017 ATGGGGGGCTGCAGGCAGGAAGG + Intergenic
954425570 3:50441123-50441145 GGGGGATCCTCCAGGAAGGAGGG + Intronic
954449585 3:50564420-50564442 GTGGCAGCCATCAGGAAGGAAGG - Intronic
955645978 3:61137851-61137873 GTGTGAGGCTGCAGGGAGAGAGG - Intronic
956009548 3:64816150-64816172 GTGGGAGCCTGAAGTGAGCTGGG - Intergenic
956110113 3:65861689-65861711 GTGGGAGCTTGCAGAGGGAAGGG + Intronic
957521719 3:81326938-81326960 GTGGGAGCCTGAGGGGAGGTGGG + Intergenic
959009138 3:101054224-101054246 GTGGCTGCCTCCAGGTAGGAAGG - Intergenic
959295732 3:104531577-104531599 GTGAATGCCTGCAGGGAGGGAGG + Intergenic
960655948 3:120004175-120004197 GTGGGAGCTTGGTGGGGGGAGGG + Intronic
960672198 3:120164944-120164966 GTGGTGGCATGCTGGGAGGAAGG + Intronic
961482547 3:127193356-127193378 GTGGGAGAGTGCGGAGAGGATGG - Intronic
961547141 3:127642526-127642548 ATGGGAGCCTGCAGGGAAAGTGG + Intronic
961559194 3:127717224-127717246 GTGGGAGATTGCAGGGAGGGAGG - Intronic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961612147 3:128148521-128148543 ATGTGAGCCTGCAGTTAGGAGGG + Intronic
961637041 3:128340073-128340095 GAGGGAGACAGCAGGGAGGGAGG - Intronic
961773824 3:129269636-129269658 TTGGGAGCCTACTGTGAGGAAGG - Intronic
962298875 3:134219216-134219238 GTGGGAGAGAGCAGGTAGGAGGG - Intronic
964062083 3:152537376-152537398 GTGAATGCCTGCAGGGAGGCAGG - Intergenic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
964876708 3:161375599-161375621 GGGGGAGCAGGCAGGAAGGAAGG - Intergenic
965355620 3:167669493-167669515 TTGGGAGGATGGAGGGAGGAGGG + Intergenic
965558778 3:170042582-170042604 TTGGGAGGCTGAGGGGAGGAAGG + Intronic
965684206 3:171284117-171284139 GAGGGGGGCGGCAGGGAGGAGGG + Intronic
966695807 3:182789843-182789865 GTGGGAGGATGAAGGTAGGAGGG - Intergenic
967072586 3:185974461-185974483 GTGGGAGGCTGTAGGGAAGCAGG + Intergenic
967830011 3:193910511-193910533 GTGGAAGCCGCCAGGGAGAAAGG + Intergenic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968603010 4:1519350-1519372 GTAGGAGGCTGCAGGGAGCTGGG - Intergenic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
969138727 4:5051420-5051442 GTGGGCGGCGGCAGGGCGGAAGG - Exonic
969263438 4:6048213-6048235 GTGTAAGGCTGCAGGTAGGAGGG + Intronic
969272594 4:6112990-6113012 TTGGGATCCTGAAGGAAGGAGGG + Exonic
969293112 4:6253103-6253125 ATGGCACCCAGCAGGGAGGAAGG + Intergenic
969306180 4:6327461-6327483 GTGGCAGCTTGAAGGAAGGACGG + Intronic
969344466 4:6562587-6562609 CTGGGCCCCTGAAGGGAGGAGGG + Intronic
969438454 4:7202095-7202117 GTGGGAACCTGCTGGGAGCGGGG - Intronic
969594818 4:8142996-8143018 GAGGGGGCCTGCAGAGGGGAGGG - Intronic
970180267 4:13384305-13384327 GTGAATGCCTGCAGGGAGGCAGG + Intronic
973365978 4:49210050-49210072 GTGAACGCCCGCAGGGAGGAAGG - Intergenic
973394620 4:49582401-49582423 GTGAACGCCCGCAGGGAGGAAGG + Intergenic
973646070 4:52952383-52952405 GCAGGGGCCTGCAGAGAGGAGGG - Intronic
974121169 4:57640628-57640650 GCGGGAGCATGCAGGCAGGCAGG - Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975264824 4:72350960-72350982 CTGAGAGCCTGGAGAGAGGAAGG - Intronic
975359515 4:73451554-73451576 CTGGGAGGCTGCAGGGATGCAGG + Intronic
975413208 4:74079233-74079255 GTGGGAGAGTGAAGGGAGAAGGG + Intergenic
975999803 4:80360257-80360279 GTGAGTGCCTGCAGAGAGGCAGG - Intronic
976600741 4:86935393-86935415 GTGGGAGCCCTCGGGGAGAACGG + Intronic
977570716 4:98626609-98626631 GAGGGAGCCTGTAGGGGTGAAGG - Intronic
977905994 4:102478318-102478340 GTGGAAGCCTGGCGGGGGGAGGG + Intergenic
978655992 4:111066155-111066177 GTTGCAGCCTGCTGGGAGGCCGG + Intergenic
980210044 4:129775173-129775195 AATGGAGACTGCAGGGAGGAAGG + Intergenic
980750136 4:137077247-137077269 CTCTGAGCCTGCAGGGATGAGGG + Intergenic
981346862 4:143685867-143685889 GTGGGGGCCTGGAGGAGGGATGG + Intronic
983204922 4:164902126-164902148 CTGGGAGCCAGGAGGGAGCAAGG - Intergenic
985005969 4:185535564-185535586 GTGGGAGGGGGCGGGGAGGACGG - Intronic
985689685 5:1300205-1300227 GTGGCAGCTCCCAGGGAGGACGG + Intergenic
985769576 5:1800425-1800447 GTTGGGGCCTGCAGGGAGCGCGG - Intronic
985822620 5:2170347-2170369 TGGAGAGCCTGCAGGGAGGCAGG - Intergenic
986064474 5:4222308-4222330 GCGAGAGCCTGCAGGAAGAAAGG - Intergenic
986449304 5:7850267-7850289 GTGGGAGCGTGCGGAGATGAAGG - Intronic
986799200 5:11241994-11242016 ATGGGGGCCTCCAGAGAGGACGG + Intronic
988584205 5:32494750-32494772 GTGGGAACGTGCAGGGTGGTCGG - Intergenic
988604590 5:32668615-32668637 GTGGGAGCGTGTAGGTACGAGGG + Intergenic
988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG + Intergenic
989408679 5:41091795-41091817 GTTGGAGCCTTCAGGCAGGCAGG - Intergenic
989491443 5:42060261-42060283 GTGGGAGCCAGAACGGGGGATGG - Intergenic
991102846 5:62812201-62812223 GTGGGAGCCTTCTTGAAGGATGG - Intergenic
994726723 5:103444748-103444770 ATGGGAGCCTGCTGGGAGTTTGG + Intergenic
994768979 5:103957088-103957110 GTGGGAGCCTGAAGGGCTGTTGG + Intergenic
994888115 5:105593095-105593117 GTGGAAGCCTGCCTGGAGAACGG - Intergenic
995182036 5:109238358-109238380 GTGGGAGCCACCAGGCAGGACGG - Intergenic
995354808 5:111224879-111224901 GTGGCAGCCTGCGAGAAGGAGGG - Intronic
997358131 5:133277640-133277662 GGAGGAGCCTGCAGGAAGGCTGG + Intronic
997466476 5:134091291-134091313 GTGGTAACCTTCAGTGAGGAAGG - Intergenic
998205344 5:140153484-140153506 GTGGGACCAGGCAGGGAGGAAGG + Intergenic
998292284 5:140926874-140926896 GTGGACGCCTAGAGGGAGGATGG + Exonic
998377288 5:141699622-141699644 GTGGGAGTCTGCAGGAAGAGGGG + Intergenic
998821167 5:146059287-146059309 GTCGGGGGCTGCAGGGAGAAAGG - Intronic
999194219 5:149771196-149771218 GTGGCTGCCTGCAGGGAAAATGG - Intronic
999214010 5:149916393-149916415 GATGCACCCTGCAGGGAGGATGG - Intronic
999375832 5:151085909-151085931 GTGGGAGAGGACAGGGAGGAAGG - Intronic
999479371 5:151932537-151932559 GAGGGATACTTCAGGGAGGAAGG - Intergenic
999693899 5:154171505-154171527 GTGGGAGCTAAAAGGGAGGAGGG + Intronic
1000369278 5:160519462-160519484 GTGGGAGCCAGAAGAGAGGAAGG - Intergenic
1001268949 5:170296576-170296598 ATGCCAGCCTGCAGGGATGAGGG + Intronic
1001429237 5:171646416-171646438 GGGTGAGCCTGAAGGTAGGAAGG + Intergenic
1001477976 5:172064545-172064567 GAGGAAGGCTGCATGGAGGAGGG + Intronic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002261226 5:177995268-177995290 TAGGGAGCCTGTGGGGAGGAAGG - Intronic
1002276778 5:178109086-178109108 GTGGGTGCATCCAGGGAGGCTGG + Intergenic
1002439627 5:179257555-179257577 GCGGGAGCCAGCAGCGGGGAGGG - Intronic
1002452977 5:179330249-179330271 GTGGGCACCTGCAGGCAGGTTGG + Intronic
1002457035 5:179351157-179351179 CAGGGAGCCTGCAGGGAGAATGG - Intergenic
1002576944 5:180179286-180179308 GAGGGAGGCTGCAGGGAGAAGGG + Intronic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1002770500 6:286786-286808 GTAGGGGGCTGCAGGGAGCAGGG - Intergenic
1003968682 6:11278025-11278047 GTCGGAGGCTGGAGGGAGAATGG + Intronic
1004160226 6:13206143-13206165 GTGGGCACCAGGAGGGAGGACGG + Intronic
1004227747 6:13802456-13802478 GTGGTAGGAGGCAGGGAGGAGGG + Intronic
1004662804 6:17725294-17725316 GTGGGAGTCGGCAGGAGGGAGGG + Intergenic
1004806044 6:19205087-19205109 GTGAATGCCTGCAGGGAGGCAGG - Intergenic
1004870163 6:19896280-19896302 GTGGGAGACTGCAGTCTGGATGG + Intergenic
1005081041 6:21956792-21956814 GCTGGAGCCTGAAGGGTGGAGGG + Intergenic
1005200938 6:23343099-23343121 GTGGGAGCATGCAGGTAAGTGGG - Intergenic
1005782116 6:29202882-29202904 AGAGGAGCCTGCAGGCAGGAGGG + Intergenic
1006173647 6:32109336-32109358 GAGGGAGTCTGCAGCGAGCAGGG + Intronic
1006253078 6:32807255-32807277 GTGGATGCCTGCAGGGAGGTGGG - Intergenic
1006446861 6:34084496-34084518 AGGGGCACCTGCAGGGAGGAGGG + Intronic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1006920849 6:37626178-37626200 AGGAGGGCCTGCAGGGAGGAGGG - Intergenic
1007246993 6:40470132-40470154 GTGGGGTTCTGCAGGCAGGATGG - Intronic
1007649859 6:43412705-43412727 TTCTGAGCCTGCAGGGAGGAGGG - Intergenic
1007710658 6:43821935-43821957 GGAGGAGCATCCAGGGAGGAAGG + Intergenic
1007740794 6:44008353-44008375 GTAGGACCCTGCAGGCAGGGCGG + Intergenic
1008056502 6:46951214-46951236 GTGGAAGCCTGGAGGCAGAAAGG + Intronic
1009409203 6:63346228-63346250 GTGGGCGTCTGCATGGAGGTTGG + Intergenic
1009415918 6:63416425-63416447 GTGGCAGCCTGTAGGGAGTAAGG - Intergenic
1009465483 6:63963123-63963145 GGGGGAGGCGGGAGGGAGGAAGG + Intronic
1009596862 6:65746586-65746608 GTGAAAGCCTGCAGGGAGGCAGG + Intergenic
1010122968 6:72400616-72400638 GTGGGATCCACCAGTGAGGACGG - Exonic
1011153650 6:84303940-84303962 GTGGGAAGTTGGAGGGAGGAGGG + Intergenic
1012171035 6:96016452-96016474 GTGGGAGCCTGGGGGCTGGAAGG - Intronic
1012406971 6:98911107-98911129 GTGGCAGCCTGGATGGGGGAGGG + Intronic
1013175460 6:107673172-107673194 GTGGGAGGCTGCAGGAGCGATGG - Intergenic
1013235518 6:108194979-108195001 GTGGGAGGCTGGAGGTAGGGAGG + Intergenic
1013616631 6:111849562-111849584 GTGGCAGGCTGGAGGGAGAAAGG + Intronic
1013655408 6:112241737-112241759 GCTGGAGTCTGCAGGGAGAATGG + Intronic
1015195174 6:130517841-130517863 GAGGGTGCCAGCAGGTAGGATGG + Intergenic
1015526924 6:134182784-134182806 GAGGGAGACTGAATGGAGGAGGG - Intronic
1015749541 6:136546340-136546362 GTGGGAGGTGGCAGGGAGGTGGG - Intronic
1015754945 6:136597496-136597518 GTTGGAGACTGGAGGCAGGATGG - Intronic
1015823183 6:137284334-137284356 GTGGGAGGAGACAGGGAGGAAGG + Intergenic
1016363114 6:143289050-143289072 GTGGCAGCCTTCAGAGAGAATGG + Intronic
1016439327 6:144067286-144067308 GTGAGAGCGAGGAGGGAGGAGGG + Intergenic
1016881554 6:148916967-148916989 ATGGGAGCTGGAAGGGAGGAAGG - Intronic
1017594782 6:156016794-156016816 GTGGGAATCTGCAGTGAGGCTGG - Intergenic
1017653226 6:156601843-156601865 GTGGGGGCCTGCAGGGCTGTAGG - Intergenic
1018429622 6:163713099-163713121 CTGGGGGCCTGCAGGGAGCCAGG + Intergenic
1018619184 6:165714263-165714285 ATGGGAGCCTGCAGAGGGGGTGG + Intronic
1018630361 6:165816871-165816893 GTGGAAGAGTGCAGGCAGGAAGG + Intronic
1018701410 6:166430415-166430437 GGGGCAGCCTTCGGGGAGGAGGG - Intronic
1019045616 6:169143168-169143190 GTGGGAGCATGCAGACAGGCAGG + Intergenic
1019291660 7:253535-253557 GTGGGGGCTTTCTGGGAGGAAGG - Intronic
1019511479 7:1419756-1419778 GTGGGTGCATTCAGGGATGAGGG - Intergenic
1019530134 7:1499173-1499195 GAGGGAGCGAGGAGGGAGGAAGG + Intronic
1019636373 7:2078248-2078270 GGGGGATCCTGCAGGTAGGCGGG - Intronic
1020001600 7:4759296-4759318 GGGGGAGCCTGCACGGAGGGCGG - Exonic
1020277249 7:6632219-6632241 GTGGGTGCTGGCAGTGAGGAGGG - Intergenic
1020742803 7:12043250-12043272 TTGAGAGCCTGCTGAGAGGAGGG - Intergenic
1021910954 7:25385663-25385685 GTGGTCACCTGCAGGGAGAAGGG + Intergenic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1022140676 7:27491149-27491171 ATGGGAGGCTGCAGGGAGCAGGG - Intergenic
1022473835 7:30697825-30697847 GGGGGAGCCTGGTGGGAGGTGGG - Intronic
1022480396 7:30739784-30739806 GTGGGAGCCTGGAGGAGGGCAGG + Intronic
1022753036 7:33252249-33252271 GGTGGAGCCTGGAGGGAGGGAGG - Intronic
1022788384 7:33661924-33661946 GTTTGAGCCTGCAGGCAGGCTGG + Intergenic
1022998849 7:35786769-35786791 TTGGTAGCTTGCAGGGAGAATGG + Intergenic
1023505071 7:40890593-40890615 GTTGGAGTCTTCAGGCAGGATGG - Intergenic
1023598346 7:41855933-41855955 GTGGGGGCAGGCAGGGATGAAGG - Intergenic
1023650217 7:42361666-42361688 ATGGCAGGCAGCAGGGAGGACGG + Intergenic
1024267848 7:47620519-47620541 GTGGGAGCATGGAGAGAGGAGGG - Intergenic
1024555451 7:50599598-50599620 GAGGAAGGCTCCAGGGAGGACGG + Intronic
1025012029 7:55405229-55405251 GTTGAAGCCGGCAGGCAGGAAGG + Intronic
1025730015 7:64100514-64100536 GAAGGAGCCTGCAGGGACCAGGG - Intronic
1026652025 7:72223998-72224020 GAGGGAGGATGTAGGGAGGAAGG + Intronic
1026889366 7:73973220-73973242 GTGGCAGCTTGTAGGCAGGAGGG - Intergenic
1026975580 7:74495715-74495737 GAGGGAGCCAGCAGCGGGGAAGG + Intronic
1026996133 7:74617852-74617874 GGGGGAGCCAGCAGAGAGAAGGG + Intergenic
1027669464 7:81077844-81077866 GTGGGAGCTTGCAGACAGGCAGG + Intergenic
1028173660 7:87628688-87628710 AAAGGAGCCTGGAGGGAGGAAGG - Exonic
1028761063 7:94497061-94497083 GTGGGAGCATGCAGGCAAGCGGG + Intergenic
1029146124 7:98447381-98447403 GTGGGAGGATGCAGGGAAGAGGG + Intergenic
1029174392 7:98653849-98653871 GAGGGACCCTGGAGAGAGGATGG + Intergenic
1029599043 7:101553234-101553256 CTGGGGGCCTGCAGGGAGTCAGG - Intronic
1029687596 7:102159493-102159515 GTGGGCTCCTGGGGGGAGGAAGG - Intronic
1029737479 7:102472778-102472800 GTGGGGGCCTGCAGGGCTGCCGG - Exonic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1031359913 7:120836946-120836968 GTGGGATGCTGGAGGGAGGCAGG - Intronic
1031746062 7:125499612-125499634 GTGGGAGTTTGCAGGGGAGATGG - Intergenic
1031927929 7:127655954-127655976 GTGGAAGGCTGAAGGGAGGACGG + Intronic
1033036323 7:137879330-137879352 GTGGAAGTGTGGAGGGAGGAGGG + Exonic
1033118147 7:138644632-138644654 GTGGAAGGCTGGAGGGAGGGGGG - Intronic
1033150854 7:138913926-138913948 GAGGGAGACAGGAGGGAGGAGGG + Intronic
1033705487 7:143882151-143882173 GGGGCAGCCGGCAGGGAGGAGGG + Intronic
1033769057 7:144527957-144527979 GTGGGAGGCGGGTGGGAGGAGGG + Intronic
1033881248 7:145886823-145886845 GTGGGAGCATGCAGACAGGCAGG + Intergenic
1034436357 7:151064511-151064533 GCGGTGGTCTGCAGGGAGGAGGG - Exonic
1035029193 7:155846352-155846374 GGGGGAGCATTCTGGGAGGAGGG + Intergenic
1035051757 7:156002932-156002954 CTGGGAGGCTGCAGAGGGGAGGG - Intergenic
1035121313 7:156570244-156570266 GTGGGTGGCTGCAGGGAAGGTGG - Intergenic
1035140261 7:156752572-156752594 GAGGGGAGCTGCAGGGAGGAGGG + Intronic
1035389522 7:158496196-158496218 GGGGGAGGCTGCAGGGAAGGGGG - Intronic
1035676211 8:1457775-1457797 GAGGCATCCTGGAGGGAGGAAGG - Intergenic
1035701464 8:1642024-1642046 GTGGGGGCCGGCAGGGTCGAGGG - Intronic
1036206491 8:6809216-6809238 GCGAGAGACTGCATGGAGGAAGG + Exonic
1036401627 8:8413837-8413859 CTGGGTGCCTGGGGGGAGGAGGG + Intergenic
1036552438 8:9827086-9827108 GGGAGAGCCCGCAGGGTGGAGGG + Intergenic
1036727524 8:11232716-11232738 GAGGGAGGCTTCAGGGTGGAAGG + Intergenic
1036946695 8:13100807-13100829 CTGGCAGCCAGCAGGGAGCAGGG + Intronic
1037767850 8:21782851-21782873 TCGGGGCCCTGCAGGGAGGAAGG + Exonic
1037842600 8:22255974-22255996 TTGGGAACTTGCAGGGAGCAGGG + Intergenic
1037857708 8:22383630-22383652 GTGCTGGCCTGCAGGGAGGCTGG + Intronic
1038455146 8:27668017-27668039 GAGGGAGGATGCAGGGAGAAGGG - Intronic
1039546957 8:38417305-38417327 CTGGGGGCCTGCACGCAGGATGG - Exonic
1039885422 8:41651440-41651462 GTGGGAGCCTGCTGGGAAGAGGG + Intergenic
1040404370 8:47086028-47086050 GTGAATGCCTGCAGGGAGGCAGG - Intergenic
1041306087 8:56462555-56462577 GTGAGAACCTGCAGTGGGGAGGG + Intergenic
1041953599 8:63533084-63533106 GAGGGAGACAGAAGGGAGGAAGG - Intergenic
1042166596 8:65951612-65951634 GTGGGAGGCAGCAGGTAAGAGGG - Intergenic
1043418972 8:80079656-80079678 GAGGGACCCAGCCGGGAGGATGG + Intronic
1044782680 8:95759428-95759450 GAGAGAGCCTGCAGGGAGAATGG + Intergenic
1047417744 8:124679265-124679287 GTGTGCGACTGCAGTGAGGATGG - Intronic
1048011218 8:130457869-130457891 GTCAGATCCTGCAGGGAGGGAGG - Intergenic
1048300074 8:133244984-133245006 GGGGGAGGCTGCGGGGAGGGTGG + Intronic
1048319771 8:133389318-133389340 GTGGGAGGCAGCAGGGAAGGAGG - Intergenic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048549304 8:135419076-135419098 GTGGGAGGCTGTGGGGAGGTGGG + Intergenic
1049036577 8:140081031-140081053 GTGGGTGCCTCCCTGGAGGAGGG - Intronic
1049232220 8:141490287-141490309 GTGGGAGCAGGCAGGGCGGGAGG + Intergenic
1049391889 8:142375887-142375909 GTGGACGCCTGCAGGGTGTAAGG + Intronic
1049401350 8:142428875-142428897 GACAGAGCCTGCAGAGAGGAAGG - Intergenic
1049418404 8:142505893-142505915 GTGGGCAGCTGCAGGGAGGTGGG + Intronic
1049441771 8:142612872-142612894 GTGGAGCCCTGCAGGGGGGAGGG + Exonic
1049687929 8:143946417-143946439 CCGAGAGCCGGCAGGGAGGAAGG + Intronic
1050090616 9:2014761-2014783 GTGCGAGCCTGCAGAGAGAGAGG - Intergenic
1050391201 9:5146370-5146392 GTGAATGCCTGCAGGGAGGCAGG - Intronic
1051210759 9:14740114-14740136 GAGGGAGGCTGCACTGAGGAGGG - Intronic
1051899544 9:22024366-22024388 GTGAATGCCTGCAGGGAGGCAGG - Intronic
1051936234 9:22446697-22446719 GTGGGGACCTTCTGGGAGGAGGG - Intergenic
1053054063 9:34983552-34983574 GTGGGAGCCTGGTGAGCGGATGG - Intergenic
1053689527 9:40576777-40576799 GTGTGAGCCTGCAGGCACGCAGG - Intergenic
1054274503 9:63054280-63054302 GTGTGAGCCTGCAGGCACGCAGG + Intergenic
1054300773 9:63377716-63377738 GTGTGAGCCTGCAGGCACGCAGG - Intergenic
1054400321 9:64710649-64710671 GTGTGAGCCTGCAGGCACGCAGG - Intergenic
1054433912 9:65194907-65194929 GTGTGAGCCTGCAGGCACGCAGG - Intergenic
1054496475 9:65826763-65826785 GTGTGAGCCTGCAGGCACGCAGG + Intergenic
1054746566 9:68859653-68859675 GTGGTATCCTGGAGGAAGGAAGG + Intronic
1054865868 9:70000290-70000312 GTGGGAGGCTGGAGGGAGGTGGG + Intergenic
1055528423 9:77158591-77158613 GTGGAAGCCTGAAGCAAGGAAGG + Intergenic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1056251846 9:84756474-84756496 AAGGGAGCCAGCAGGGAGGAGGG + Intronic
1056544973 9:87605961-87605983 GTGAGTGCCTTGAGGGAGGAGGG + Intronic
1056606474 9:88089858-88089880 GTGGGAGTCTGCACGAAGGAGGG + Intergenic
1056795388 9:89655444-89655466 TTGTGAGGCAGCAGGGAGGAAGG - Intergenic
1057003446 9:91534131-91534153 GTGAGAGCCTGCAGGAAGTCAGG - Intergenic
1057441496 9:95086881-95086903 GAGGCAGCCTCCAGGGAGGGAGG - Exonic
1057914808 9:99047550-99047572 GTTGGAGCCTGCAGGAAAGCAGG + Intronic
1058012006 9:99988964-99988986 GTGGCAGCCTGGCTGGAGGAGGG + Intronic
1058939639 9:109801194-109801216 GTGGGTCCCTCCAGGGAGAAAGG + Intronic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1060389559 9:123267502-123267524 AGGGGAGCCTGCAGGGAGGCGGG - Intronic
1060591337 9:124818958-124818980 TTGAGAGCCTGCTGGGAGCAGGG + Intergenic
1060913460 9:127369525-127369547 CCAGGAGCCTGCAGGAAGGAGGG + Intronic
1061245043 9:129397286-129397308 GTGGGAGGATGGATGGAGGATGG + Intergenic
1061824031 9:133246856-133246878 GAGGGAGCCTGCAGAGGAGACGG - Intergenic
1061884171 9:133583297-133583319 GGCTGAGACTGCAGGGAGGATGG + Intronic
1062045261 9:134422019-134422041 ATGGGAGCATCCAGGGAGGGGGG - Intronic
1062448649 9:136606394-136606416 CTGGGCGTCTGCAGGGCGGAGGG - Intergenic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1062594916 9:137295325-137295347 GTGGGAGGCTGCGGGGAGCCGGG - Intergenic
1062612369 9:137380700-137380722 ATGCCAGCCAGCAGGGAGGAAGG - Intronic
1062631336 9:137464489-137464511 GTGGCAGCCCGCAGGGAGGGTGG - Intronic
1062640245 9:137515056-137515078 GAGGGACCATGCAGGGAGGGCGG + Intronic
1062699734 9:137892627-137892649 CTGTGAGACTGCAGGCAGGAGGG + Intronic
1186359623 X:8826755-8826777 GTGGTTACCTGCAGGGAGGGAGG + Intergenic
1186444272 X:9613248-9613270 ATTGGAGTCTGCAGGGTGGAGGG - Intronic
1186645798 X:11506107-11506129 GTGGGAGACTTCAGGGAGGAGGG - Intronic
1187717070 X:22113408-22113430 GGGGGTGCAGGCAGGGAGGAAGG - Intronic
1187822755 X:23305949-23305971 GTGAGATCCAGCAGGTAGGATGG + Intergenic
1187963521 X:24588284-24588306 GAGGGGGCCTACAGTGAGGAAGG - Intronic
1188117570 X:26263835-26263857 ATGGGAGCCAGAAGGGCGGATGG + Intergenic
1188585392 X:31768314-31768336 GTGGGAGACAGGAGGGAGAAAGG - Intronic
1188977626 X:36694055-36694077 GTGGGGGCCTGGCGGGAGGTGGG + Intergenic
1189444383 X:41067156-41067178 GTGGCAGCTTGCAGGAAGAAAGG + Intergenic
1189695023 X:43654881-43654903 GCGCGAGCCTGCAGGCAGGCCGG + Intergenic
1190190693 X:48274548-48274570 GTGGGAAGCTGCAGGCAGGAAGG + Intronic
1190190699 X:48274588-48274610 GTGGGAAGCTGCAGGCAGGAAGG + Intronic
1190289243 X:48981364-48981386 GAGGGAGGCTACAGGTAGGAGGG + Intronic
1190380727 X:49837366-49837388 GGGGAAGCCTGCATGGAAGAGGG + Intergenic
1190482872 X:50894850-50894872 GTGGGGGCTGGCAGGGAGGCAGG + Intergenic
1191101292 X:56731223-56731245 GTGGAAGGTTGCAGGGAGTAGGG + Intergenic
1191103424 X:56757781-56757803 GGGGGAGCTTGTAGGAAGGAAGG + Intergenic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1194144720 X:90247571-90247593 GTGAATGCCTGCAGGGAGGCAGG + Intergenic
1194838986 X:98715360-98715382 GTGGGAGTTTGCAGAGAAGAGGG + Intergenic
1196584070 X:117409251-117409273 GTGGGAAGCTGCAGTGAGTACGG - Intergenic
1198311113 X:135426304-135426326 GTGGGAGCCACTAGGGAGGGGGG - Intergenic
1198369182 X:135974217-135974239 GGCGGGGCCTGCGGGGAGGATGG + Intergenic
1198416436 X:136424662-136424684 GGGGGAGCCTTCTGGGAGGCCGG + Intergenic
1199938585 X:152601836-152601858 CTGGGAGCCATCAGTGAGGAGGG - Intergenic
1200101396 X:153690540-153690562 GTGGGAGCCAGCTGGGAGAAGGG - Intronic
1200273867 X:154713375-154713397 GAGGATGGCTGCAGGGAGGAGGG + Exonic
1200490475 Y:3816876-3816898 GTGAATGCCTGCAGGGAGGCAGG + Intergenic
1200795678 Y:7339115-7339137 GTGGGTTCCTGCAAGCAGGAAGG + Intergenic