ID: 1102572737

View in Genome Browser
Species Human (GRCh38)
Location 12:113837150-113837172
Sequence GTGTATATTAAGTAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102572737_1102572740 30 Left 1102572737 12:113837150-113837172 CCATCCTCCTACTTAATATACAC 0: 1
1: 0
2: 1
3: 14
4: 177
Right 1102572740 12:113837203-113837225 ACTCTCACGTGCTACTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102572737 Original CRISPR GTGTATATTAAGTAGGAGGA TGG (reversed) Intronic
902118295 1:14139984-14140006 GTGTGTGTTAAGTAGGAAGGAGG + Intergenic
902963691 1:19982527-19982549 GGGTATCTGGAGTAGGAGGATGG + Intergenic
905636551 1:39557701-39557723 GTGTATAGTAAGAATCAGGAGGG - Intergenic
908188484 1:61675864-61675886 TTGTATAGTGATTAGGAGGACGG + Intergenic
910897356 1:92082873-92082895 GTGTATAGCAAATAGTAGGATGG - Intronic
912220782 1:107672474-107672496 GTGTTTAATAAGTCAGAGGAGGG + Intronic
913989007 1:143592376-143592398 CTGCATTTGAAGTAGGAGGATGG + Intergenic
918760255 1:188395663-188395685 GTGTATATGAAGTTGGAGCTAGG + Intergenic
919602992 1:199646151-199646173 TTATTTATTAAGTAGGAGAAAGG + Intergenic
924791520 1:247254688-247254710 GTAGACATGAAGTAGGAGGAAGG - Intergenic
1064295129 10:14072408-14072430 ATGTTTATAAAGTAGAAGGACGG - Intronic
1066493761 10:35920345-35920367 GTTTATATAAAGTGGGAGGCTGG + Intergenic
1068036381 10:51765090-51765112 GTGTGTATTAGGAAGGAAGATGG + Intronic
1068120124 10:52776237-52776259 GTTTATATTAAGCAGGAGAGGGG + Intergenic
1068736483 10:60419082-60419104 GTTTATATTCAGTAGGAGGTTGG - Intronic
1071092936 10:81941212-81941234 GAGAATATGAAGTAGGAAGATGG + Intronic
1072574313 10:96686358-96686380 GTGTAAATCCAGTAGGAGCAGGG - Intronic
1078693366 11:13604182-13604204 GTGTATATTATGTACAATGATGG - Intergenic
1079117692 11:17651059-17651081 GTTTTTTTTAAATAGGAGGAAGG - Intergenic
1079888604 11:26021261-26021283 GTGTAAATTAAGTAGAAGGAAGG + Intergenic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1082721955 11:56689240-56689262 GTGTATATTTAGTAATAGAATGG - Intergenic
1082772612 11:57220036-57220058 GAGTATAGTAAGTAGGGGAAAGG - Intergenic
1083248113 11:61445803-61445825 GTGTATATTTAGAAGAAGGATGG + Intronic
1086427371 11:86699202-86699224 TTGTAAAATGAGTAGGAGGAGGG - Intergenic
1086919738 11:92572765-92572787 GTGTATATTATGGAAGATGAAGG - Intronic
1087026699 11:93657037-93657059 GTGTATATTAGGGAGAAAGAGGG + Intergenic
1089374292 11:117983582-117983604 GTGTATGTAAAGTAGGTGAAGGG - Intergenic
1089842515 11:121430734-121430756 GTGTACATTTAGTAGGGGAAAGG - Intergenic
1090581484 11:128164999-128165021 GTGTATTTTTAGTAGAAGCAAGG - Intergenic
1091691066 12:2597878-2597900 GAGTGTATGAAGCAGGAGGAGGG - Intronic
1093141018 12:15510454-15510476 GTGTACATTAAGTAGGGCAAGGG - Intronic
1093627857 12:21371324-21371346 GTGAATATGAGGTAGGAGGCAGG - Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1094538852 12:31346040-31346062 TTGTATTTTTAGTAGGAGCAGGG - Intergenic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098796253 12:74891920-74891942 GTGTATTTAAAATAGGAGGGAGG - Intergenic
1098842309 12:75491011-75491033 GTTTAAAGAAAGTAGGAGGAAGG - Exonic
1099217479 12:79870784-79870806 GTATATAAGAAGTATGAGGAAGG - Intronic
1102572737 12:113837150-113837172 GTGTATATTAAGTAGGAGGATGG - Intronic
1102688160 12:114740283-114740305 TTGTATATTTAGTAGAAGCAAGG - Intergenic
1102751490 12:115298514-115298536 ATGAATAATAAGTTGGAGGATGG - Intergenic
1103285523 12:119798161-119798183 GTGTTTATTGAGTAGGTAGACGG - Intronic
1104411602 12:128562746-128562768 GTGTAGATTGAGTAGGATAAAGG + Intronic
1106064700 13:26334230-26334252 GTGGATATTAAGGAGGTGAATGG + Intronic
1108128100 13:47266932-47266954 GTGCATATTAAGTAAGTGGCTGG + Intergenic
1109944716 13:69418990-69419012 ATGTCTATTAACAAGGAGGATGG - Intergenic
1110541724 13:76713672-76713694 GGGTATACATAGTAGGAGGATGG + Intergenic
1112429815 13:99341546-99341568 GTGTATTTAAAGCTGGAGGATGG + Intronic
1115442146 14:33448065-33448087 GTATGAATTATGTAGGAGGAGGG + Intronic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1119102082 14:71889218-71889240 GTGTGTTTGACGTAGGAGGAAGG + Intergenic
1120917329 14:89721533-89721555 GCATGTATTAATTAGGAGGATGG + Intergenic
1122600847 14:102920981-102921003 GTGAATATTAAGTGGATGGATGG - Intergenic
1124089305 15:26582806-26582828 GTGTAGTTTAGGTAGCAGGAGGG + Intronic
1124821709 15:33052796-33052818 GTGTATATAAAATAGGGGAAGGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129953836 15:79615275-79615297 GTGTATCATAAGGAGAAGGAAGG - Intergenic
1138115260 16:54356002-54356024 ATGTCTATTATGTAGCAGGAAGG + Intergenic
1140950042 16:79808335-79808357 GTGTATATGAAATAGGTGAATGG - Intergenic
1142798078 17:2324666-2324688 GTGGGTATGAAGGAGGAGGATGG - Exonic
1153320974 18:3774034-3774056 ATTCCTATTAAGTAGGAGGAAGG - Intronic
1157986020 18:52438157-52438179 GTGTATATTGAATGGGAGGATGG - Intronic
1161358775 19:3834469-3834491 GTGACTATGAAGGAGGAGGAGGG - Intronic
1161919385 19:7254837-7254859 GTGAGTATCAGGTAGGAGGAAGG + Intronic
1163328458 19:16620360-16620382 GTGTAGATTAAACAGGAGGCAGG - Intronic
1164270172 19:23665669-23665691 GTGTATTTTAAGTAGAGGCAGGG + Intronic
1167123513 19:47533194-47533216 TTGTATTTTAAGTAGGAACAGGG - Intronic
1167829259 19:52005279-52005301 GAACATATAAAGTAGGAGGATGG + Intronic
925140248 2:1545102-1545124 GAGGATATTCAGTAGGAGAATGG - Intergenic
927849783 2:26491617-26491639 GTGGATTTTCAGCAGGAGGAAGG + Intronic
928275663 2:29898008-29898030 GTGAAAATGAAGTTGGAGGATGG + Intronic
929675407 2:43922355-43922377 GTGTGTATTAAGTATGTGAAAGG + Intronic
930247370 2:48998259-48998281 TGGTATATTAATGAGGAGGAAGG + Intronic
930412101 2:51037637-51037659 AGCTATATTAAGTAGGAGGAGGG - Intergenic
931080242 2:58761063-58761085 GTGCATTTTCAGTAGGATGAAGG - Intergenic
932667276 2:73707987-73708009 GTGAATGTGAACTAGGAGGAAGG + Intergenic
933126721 2:78618364-78618386 GGGTATTTTAGGTAGCAGGATGG - Intergenic
937021198 2:118657813-118657835 GTATATATTAAATAGTAAGAAGG + Intergenic
937631329 2:124105063-124105085 GTGTGTATTAAAAAGGAGGGAGG - Intronic
938546915 2:132341753-132341775 GTGTAAATAAACTAGGAAGACGG + Intergenic
939064609 2:137467503-137467525 GTGTGTATTAACTAGTGGGAAGG + Intronic
941399804 2:165016735-165016757 ATGTATATTTAGAAAGAGGAAGG - Intergenic
942097508 2:172547750-172547772 GTGTATGTAAAGTAGGTGAAGGG - Intergenic
942199370 2:173555424-173555446 GTGTTATTTAAGTAGTAGGATGG - Intergenic
942616140 2:177793801-177793823 GTGTCTAGTCAGTAGAAGGATGG + Intronic
943235768 2:185317335-185317357 GTGCATATTATGTAAAAGGATGG - Intergenic
946702792 2:222429291-222429313 TAGTATATTCAGTAGGAGGGTGG + Intronic
947747213 2:232514541-232514563 GAGTCTACTATGTAGGAGGAGGG + Intergenic
1170225559 20:13988143-13988165 GTGTATATGAGGTATGAGGTGGG + Intronic
1174845698 20:53941120-53941142 GTGTGTGTGAAGTGGGAGGAGGG + Intronic
1175301842 20:57948530-57948552 GTGTATACTGAGAAGGAGGCTGG - Intergenic
1175756729 20:61535019-61535041 GTTTGTATTAACCAGGAGGAGGG - Intronic
1177102317 21:16913891-16913913 GTGTATTTTTAGTAGGGAGAGGG + Intergenic
1177763255 21:25426879-25426901 CTGTATACTAAGTAGGAATAAGG + Intergenic
1182105026 22:27682894-27682916 GTGGAAATTAAAAAGGAGGAGGG + Intergenic
1183217685 22:36491575-36491597 GTGTTTTTTAAGTAGGGAGAGGG + Intronic
949824522 3:8151500-8151522 GTATATAACAAGAAGGAGGAAGG + Intergenic
951257184 3:20463661-20463683 GGGTATTTTAAGTGGGAAGAAGG - Intergenic
956253639 3:67261136-67261158 GTGTATATCCAGTAGGAGCTGGG - Intergenic
958049195 3:88322632-88322654 ATGTATAATATTTAGGAGGAAGG - Intergenic
958612695 3:96447730-96447752 ATGGATAATAAGTAGAAGGATGG + Intergenic
963395402 3:144725971-144725993 GTGAATATTAGCCAGGAGGAAGG + Intergenic
964967923 3:162521251-162521273 GTGTGTATTCTGCAGGAGGAAGG - Intergenic
965945482 3:174235254-174235276 GTGTATATGAAGGAGGGGTAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967479330 3:189956097-189956119 TTGTATTTTGAGTAGGAGGGAGG + Intergenic
968209480 3:196836639-196836661 CTGTATTTTAAGTAGAAGCAAGG + Intergenic
968837426 4:2975399-2975421 CGGTATATTAGGTATGAGGAGGG - Intronic
970030250 4:11666044-11666066 GGGTATTTTAAGCAGGAGAATGG + Intergenic
970473100 4:16395845-16395867 GGGTCTGTTAAGAAGGAGGAAGG + Intergenic
970652431 4:18193493-18193515 GTGTGTATTGGGTAGGGGGAAGG - Intergenic
971146399 4:23981228-23981250 GTATATATTCAGTAGGAAGCTGG - Intergenic
971802422 4:31309248-31309270 GTGTATATATATTAGAAGGAGGG - Intergenic
972052771 4:34760079-34760101 GTTTATCTTAGGCAGGAGGATGG + Intergenic
973154614 4:46935331-46935353 TTATATATTTATTAGGAGGAAGG - Intronic
974637389 4:64582668-64582690 GTGGCTGTTAAGAAGGAGGAAGG + Intergenic
975872584 4:78796901-78796923 GTGGATATAAAGTAGGGGAAAGG + Intronic
977446185 4:97136090-97136112 GTGGAAAGAAAGTAGGAGGAAGG + Intergenic
977765519 4:100792934-100792956 CTGTATATTAAGTAGATAGATGG + Intronic
979978472 4:127225399-127225421 GGGTATTTCAAGTGGGAGGATGG - Intergenic
980199347 4:129635530-129635552 GTGAATATCAAGCAGGAGAATGG - Intergenic
983022493 4:162695593-162695615 ATCTATATTAATTAGGAGTATGG + Intergenic
983693927 4:170505571-170505593 GTGTATACCCAGTAGTAGGATGG + Intergenic
989741256 5:44775267-44775289 GTGTATACTCAGCAGTAGGATGG + Intergenic
990799034 5:59578752-59578774 GTGGAGATTAGGTAGGTGGAAGG - Intronic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991439549 5:66632489-66632511 GTGTTTATTTAGTAGGTGGAGGG + Intronic
992095453 5:73358412-73358434 GTGAATTTTAAGCAGGATGAGGG - Intergenic
993487691 5:88506658-88506680 GTGTAAAGAAAGTAGGAGGAGGG - Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
997696303 5:135863795-135863817 GTGTTACTGAAGTAGGAGGAAGG + Intronic
1000079639 5:157832765-157832787 TTGGATATTCAGTGGGAGGAAGG - Intronic
1000383087 5:160646610-160646632 CTGTTTATTAAGGAGGAGGCTGG + Intronic
1000431745 5:161160793-161160815 GTCTATAGTAAGCTGGAGGATGG - Intergenic
1000477447 5:161728662-161728684 GTGTTTATTCAGTAATAGGAGGG + Intergenic
1004306061 6:14502832-14502854 GAGCATATTAAGTAGATGGATGG - Intergenic
1006174616 6:32114417-32114439 GTGCATTCTAATTAGGAGGAAGG - Intronic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1009416947 6:63426402-63426424 GTGTATATGAAGTTGGTAGAGGG - Intergenic
1010751610 6:79621746-79621768 GTGTATATCAAGAAGGAGAATGG - Intergenic
1010846475 6:80715038-80715060 ATATAAATTAAGTAGGAGTAGGG + Intergenic
1010939136 6:81895300-81895322 GTCAATATTAATTAGGAAGAAGG + Intergenic
1014426894 6:121318113-121318135 GTGTATATAAAGTATGGGCAAGG - Intronic
1014540315 6:122667981-122668003 GTATATGTTAAGTGGGAGCAGGG - Intronic
1016956558 6:149632685-149632707 GATTATATTTAGGAGGAGGATGG - Intronic
1017578947 6:155839143-155839165 GTGTAAATTAAATGGGAGGAGGG + Intergenic
1018174768 6:161168942-161168964 GTGGATATTAAATAAGAGCATGG + Intronic
1018306716 6:162464898-162464920 ATATTTATTAAGAAGGAGGAGGG - Intronic
1020039316 7:4989337-4989359 GTTTATCTTAAGTAGGAAGAAGG - Intronic
1020155979 7:5725113-5725135 GTTTATCTTAAGTAGGAAGAAGG + Intronic
1022279306 7:28890154-28890176 TTGTATTTTTAGTAGAAGGAGGG + Intergenic
1022837346 7:34130816-34130838 GTGGATTTTAACTAGGAGAAGGG + Intronic
1023305299 7:38819617-38819639 GTGGAGATTAAATAGGGGGAAGG - Intronic
1023503638 7:40876981-40877003 GTGTATATTAAAGAAGAGAAAGG - Intergenic
1028169164 7:87575022-87575044 TTGTATACAAAGTAGGAGAATGG - Intronic
1028293821 7:89102180-89102202 GTAGATATTCAGTAGAAGGATGG + Intronic
1028388739 7:90290665-90290687 GTGCATAGAAAGTAGGAGTAGGG - Intronic
1031198010 7:118641181-118641203 GTGAATATTAAGTAAAAGTAAGG + Intergenic
1032853877 7:135817981-135818003 ATGCATTTTGAGTAGGAGGAGGG - Intergenic
1033604835 7:142919276-142919298 GTGGATAAAAAGTAGGAGGGAGG - Intronic
1034861236 7:154596619-154596641 TTGTAGTTTAAGTAGGAGGGAGG + Intronic
1037062235 8:14528753-14528775 GTGGTTATTAACTGGGAGGAAGG - Intronic
1039514728 8:38123039-38123061 GTGCATATTAAATATGAGCAAGG - Intronic
1040716314 8:50257182-50257204 GTGTATGTTCAGTGGGAGAAGGG - Intronic
1040843599 8:51810911-51810933 GTGTATAATAATTAGGTCGAAGG + Intergenic
1042576499 8:70226240-70226262 GTTTATAATAAGAAGGAAGAGGG + Intronic
1048060277 8:130912329-130912351 GTGTTTACTGAGTAGGTGGATGG + Intronic
1048120770 8:131579086-131579108 GTGACTGTTAAGAAGGAGGATGG + Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1051011262 9:12417074-12417096 ATGTATATAAAGTAGGAGACTGG - Intergenic
1051084038 9:13327040-13327062 GTCCATATTTAATAGGAGGAAGG + Intergenic
1051123336 9:13775715-13775737 GTGTGTATTTGGTAGGAGGGGGG - Intergenic
1052368418 9:27639198-27639220 GTATAAATTAAGTAGGAAGGTGG - Intergenic
1052560984 9:30083031-30083053 ATTTATATTAGGTAGAAGGAGGG - Intergenic
1052709898 9:32041175-32041197 GAATATATTAAGTACGAGGAAGG + Intergenic
1056422892 9:86446874-86446896 GTGTGTATGAAGGAGAAGGATGG + Intergenic
1057157686 9:92858027-92858049 GTGTATAATAAGTTGTAGGCAGG - Intronic
1060777042 9:126382493-126382515 GTGTATTTTAAATACCAGGAAGG + Intronic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1061616339 9:131782097-131782119 GTATATATCCAGTAGTAGGATGG + Intergenic
1192432246 X:71120237-71120259 ATCTAGATTAAGAAGGAGGATGG - Intronic
1193745653 X:85276564-85276586 GTCTATGTTAAGAAGGAGTAAGG + Intergenic
1196700196 X:118659780-118659802 GTGTATCTTAAGTAGAAGTAGGG - Intronic
1197129225 X:122985121-122985143 GAGTAGACTAAGGAGGAGGAGGG + Intergenic
1198148792 X:133887177-133887199 GTGTATATTTTGTAGGAACAGGG + Intronic
1199446128 X:147924183-147924205 GTGTATAATAACTCAGAGGAGGG + Intronic
1199716635 X:150511606-150511628 GTGCATATTTTGTAGAAGGAAGG - Intronic
1199912856 X:152306847-152306869 GTGTATATCAACTTAGAGGAGGG - Intronic
1200294563 X:154905504-154905526 GTGTATATTAAGGATGTAGAAGG - Intronic
1202104927 Y:21353857-21353879 TTCTAAAATAAGTAGGAGGATGG - Intergenic
1202332914 Y:23773507-23773529 GTGTATATCTAGTAATAGGATGG + Intergenic
1202537855 Y:25896556-25896578 GTGTATATCTAGTAATAGGATGG - Intergenic