ID: 1102573861

View in Genome Browser
Species Human (GRCh38)
Location 12:113843859-113843881
Sequence AGGGAGGACAGCATGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 754
Summary {0: 1, 1: 0, 2: 10, 3: 94, 4: 649}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102573861_1102573868 12 Left 1102573861 12:113843859-113843881 CCTCCAGCCATGCTGTCCTCCCT 0: 1
1: 0
2: 10
3: 94
4: 649
Right 1102573868 12:113843894-113843916 TACCGAGCTTGCTCCAACCTGGG 0: 1
1: 0
2: 1
3: 6
4: 62
1102573861_1102573874 30 Left 1102573861 12:113843859-113843881 CCTCCAGCCATGCTGTCCTCCCT 0: 1
1: 0
2: 10
3: 94
4: 649
Right 1102573874 12:113843912-113843934 CTGGGGGTCTCCCCTGCCCCTGG 0: 1
1: 0
2: 3
3: 44
4: 480
1102573861_1102573867 11 Left 1102573861 12:113843859-113843881 CCTCCAGCCATGCTGTCCTCCCT 0: 1
1: 0
2: 10
3: 94
4: 649
Right 1102573867 12:113843893-113843915 ATACCGAGCTTGCTCCAACCTGG 0: 1
1: 0
2: 0
3: 2
4: 30
1102573861_1102573869 13 Left 1102573861 12:113843859-113843881 CCTCCAGCCATGCTGTCCTCCCT 0: 1
1: 0
2: 10
3: 94
4: 649
Right 1102573869 12:113843895-113843917 ACCGAGCTTGCTCCAACCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 95
1102573861_1102573871 14 Left 1102573861 12:113843859-113843881 CCTCCAGCCATGCTGTCCTCCCT 0: 1
1: 0
2: 10
3: 94
4: 649
Right 1102573871 12:113843896-113843918 CCGAGCTTGCTCCAACCTGGGGG 0: 1
1: 0
2: 2
3: 10
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102573861 Original CRISPR AGGGAGGACAGCATGGCTGG AGG (reversed) Intronic
900148088 1:1167002-1167024 ACTGAGGACAGCATCGCCGGAGG - Intergenic
900399492 1:2467196-2467218 AGGGAGGACAGGATGAACGGTGG + Intronic
900685586 1:3945846-3945868 AGGGAGGGGAGCAAGGCTGGGGG - Intergenic
901012622 1:6210090-6210112 AAGGAGGGCAGCATGGCTCAGGG + Intronic
901163250 1:7196498-7196520 GTGGAGCACAGCGTGGCTGGAGG + Intronic
901222175 1:7589429-7589451 AAGGAGGACAGCTTGACTGTGGG + Intronic
901388028 1:8923958-8923980 AGGGAGGACAGCTTGATTGACGG - Intergenic
902644757 1:17790651-17790673 AGGGAGGACCTGAAGGCTGGGGG - Intronic
902692939 1:18121650-18121672 AGGGCCAACAGCAGGGCTGGTGG - Intronic
902693869 1:18127287-18127309 GGGGAGTACAGCAGGGCTGTGGG + Intronic
902782964 1:18716409-18716431 AGGGAGGCACGAATGGCTGGAGG - Intronic
902808155 1:18873501-18873523 AGGGAGGGCAGAGGGGCTGGAGG + Intronic
902906988 1:19565537-19565559 AAGGACGAAAGCATAGCTGGTGG - Intergenic
903004908 1:20292168-20292190 AGGGAGGACAGGAGGGGGGGAGG - Intronic
903082352 1:20820552-20820574 AGGGAGGACCTGAAGGCTGGGGG + Intronic
903192719 1:21665957-21665979 AGGCAGCTCAGCCTGGCTGGGGG - Intronic
903232302 1:21929368-21929390 GGAGGGGACAGCATGGGTGGGGG - Intronic
903337519 1:22635073-22635095 AGGGAGGGCCTCAAGGCTGGGGG - Intergenic
903345810 1:22683634-22683656 AGGGAGAACAGCATGGCAGGGGG - Intergenic
903838160 1:26219363-26219385 AGGGAGCACAGCAGGGGCGGGGG - Intergenic
903849281 1:26296552-26296574 AGGAAGGGCCTCATGGCTGGAGG + Intronic
904127019 1:28248117-28248139 AGGTAGGACAGGATGGTGGGAGG + Intergenic
904498456 1:30900811-30900833 GGGGAGGGCAGGATGGATGGGGG + Intronic
904754941 1:32763403-32763425 GAGGAGGCCAGTATGGCTGGAGG - Intronic
904927866 1:34062633-34062655 AGGGAGGACAGGATGGCCAGGGG + Intronic
905334932 1:37238714-37238736 AGTGGGGACTGCGTGGCTGGGGG - Intergenic
905490617 1:38340667-38340689 GGGGAGGTCAGGATGGGTGGTGG + Intergenic
905674562 1:39816566-39816588 TGGGGGCACAGGATGGCTGGAGG + Intergenic
905753668 1:40488592-40488614 AAAGTGAACAGCATGGCTGGAGG - Intronic
905893468 1:41531075-41531097 AGGGAGGACAGGAGAGATGGAGG + Intronic
905893480 1:41531125-41531147 AGGGAGGACAGGAGAGATGGAGG + Intronic
905893491 1:41531175-41531197 AGGGAGGACAGGAGAGATGGAGG + Intronic
905893737 1:41532306-41532328 AGGGAGGACAGAAGAGATGGAGG + Intronic
905922769 1:41730307-41730329 GGGGAGGACACCAAGGCTTGAGG - Intronic
906520519 1:46464373-46464395 AGGGAGGGAGGCCTGGCTGGTGG + Intergenic
906706287 1:47897267-47897289 AAGGAAGACAACGTGGCTGGAGG + Intronic
906725927 1:48044185-48044207 AGGGAGGAAAGCAGTGCTGTTGG + Intergenic
906764441 1:48414580-48414602 AGTTTGGACAGGATGGCTGGAGG - Intronic
906965688 1:50454311-50454333 AGGGAGGACAGTCTAGGTGGAGG - Intronic
907527477 1:55062442-55062464 AGGGAGAACAGCATGTCTCTTGG - Intronic
908552971 1:65228374-65228396 AGGGAGGGAAGGATGGATGGAGG - Exonic
908945293 1:69488203-69488225 AGGTAGGACAGGATGGCTAGAGG - Intergenic
909197348 1:72644671-72644693 AGGGAGAAGTACATGGCTGGAGG - Intergenic
910842003 1:91569976-91569998 AGGGTGGAGAGCATGGCTGCTGG + Intergenic
912550827 1:110484092-110484114 AGGGTGGTCAGGGTGGCTGGGGG + Intergenic
912731902 1:112114642-112114664 AGGAAGCAAAGCAGGGCTGGAGG + Intergenic
913666309 1:121051873-121051895 AGGGAGGAAAGGATGGAGGGAGG + Intergenic
914656608 1:149747518-149747540 AGGGAGGAAAGGATGGAGGGAGG + Intergenic
915130725 1:153693719-153693741 AGGGAGGAGAGCATGGGGAGGGG - Exonic
915243666 1:154541557-154541579 AGGGAGACCAGCATGGGTTGGGG + Intronic
915726203 1:158019470-158019492 AGGTAGGAGGGCATGGCTGTTGG + Intronic
915939491 1:160109730-160109752 GGGGAGGAAGGCAGGGCTGGTGG - Intergenic
916046228 1:161001735-161001757 AAGGAAGCCAGCAGGGCTGGAGG + Intronic
916214520 1:162384070-162384092 AGGGAGAACAGCAGGGGAGGAGG - Intronic
917254876 1:173103660-173103682 TTGGAGGACAGCCTGGCTGCTGG - Intergenic
917461514 1:175234498-175234520 AGGGAGGCCAGAAGGGCAGGGGG + Intergenic
917764142 1:178199029-178199051 AGGGCAGCCAGCCTGGCTGGAGG - Intronic
918094264 1:181321712-181321734 ACCAAGAACAGCATGGCTGGGGG + Intergenic
918556157 1:185801791-185801813 AGGGAGTTAAGGATGGCTGGAGG + Intronic
918685762 1:187413179-187413201 AGCTAGGACAGCATAGTTGGGGG - Intergenic
919739949 1:200975355-200975377 AGGGAGAACAGGAGGGCTTGGGG + Intronic
919748262 1:201021887-201021909 AGGGAGGGGTGCATGGCTGGGGG - Intronic
920461496 1:206144041-206144063 TGGGAGGACAGCATGGAGGACGG + Intergenic
920679533 1:208062043-208062065 AGGGAGGGCAGGATGGATGAAGG + Intronic
921133379 1:212238784-212238806 AGGGAGGAGAGCTAGGCTGCCGG + Intergenic
921819443 1:219600591-219600613 AGCAAGGTCAGCAAGGCTGGAGG + Intergenic
923433780 1:233949541-233949563 TGGGAGATCACCATGGCTGGTGG + Intronic
924432778 1:244010740-244010762 GGGGTGGACAGCAGGGCTTGAGG - Intergenic
924662498 1:246034629-246034651 GTGGAGGTGAGCATGGCTGGGGG + Intronic
1063009950 10:2012122-2012144 AGAGAAGACAGCATGGCTGCAGG + Intergenic
1063105465 10:2988048-2988070 AGGGGAGTCAGCAGGGCTGGAGG + Intergenic
1063128354 10:3155110-3155132 AGGGAGGACAGCGTGTGTGGGGG - Intronic
1063135965 10:3216588-3216610 AGGGAGGGAGGCATGGTTGGAGG + Intergenic
1063168868 10:3487915-3487937 AGGGAGGACAGCTTGGCAGTAGG - Intergenic
1063208436 10:3856431-3856453 AGAAGGGAGAGCATGGCTGGAGG - Intergenic
1063757683 10:9033161-9033183 TAGGAGGACAGGATGGCTGGAGG - Intergenic
1063948058 10:11196572-11196594 AGGGAGGACAGCATGGGCCCAGG + Intronic
1064432726 10:15285181-15285203 AGGGGGAACAGCATGTGTGGAGG + Intronic
1064452725 10:15457740-15457762 GGGGATGACTGGATGGCTGGAGG - Intergenic
1064554436 10:16534455-16534477 ACAGAGGACAGCATGGCTACCGG - Intergenic
1064720209 10:18221090-18221112 AGGGAGGAGAGAAGGGCAGGGGG + Intronic
1066058226 10:31700671-31700693 TGGGAGGACAGGGTGGCTGCAGG + Intergenic
1067283847 10:44893316-44893338 AGGGAGGACAGCAAGGCTCAGGG + Intergenic
1067285124 10:44902259-44902281 AGGGAGGAGAGGAGGGATGGGGG + Intergenic
1067804473 10:49383408-49383430 AGGGAGGAGAGCTTTGCTGGGGG + Intronic
1068298847 10:55112573-55112595 AGTAAGGACCCCATGGCTGGTGG + Intronic
1068311465 10:55282196-55282218 AAGGAGGGCAGCATGGCTAGAGG - Intronic
1069919333 10:71807105-71807127 AGGGAGCAAAGCATGGCCCGCGG - Intronic
1069940857 10:71954315-71954337 AGGGAGGACAGCCTGATTGATGG + Intergenic
1069994780 10:72335568-72335590 GGGGAGGACAGCATCGCTAGAGG + Exonic
1070350987 10:75592092-75592114 AGAGGGGACAGCATGACTTGAGG + Intronic
1070499300 10:77055463-77055485 AGGGAGGAAGGAATGGATGGAGG - Intronic
1070828865 10:79406651-79406673 AGGGAGGATGAAATGGCTGGTGG - Intronic
1071301911 10:84262247-84262269 AGGCAGGAGAGGAAGGCTGGTGG - Intergenic
1071490482 10:86133146-86133168 CAGGAGGAGAGCATTGCTGGTGG - Intronic
1071545062 10:86522335-86522357 AGGAAGGACTGCAGGGCTGGAGG - Intergenic
1072253545 10:93600553-93600575 AGGGAGCACCGAATGGGTGGAGG - Intronic
1073035246 10:100560302-100560324 TGGGAAGACAGCCTGGCTGGAGG - Intergenic
1073834503 10:107425665-107425687 AAGGAGGACAGTGTAGCTGGAGG - Intergenic
1074119345 10:110481829-110481851 AAGGAGGGCAGCAGGGCTGGCGG - Intergenic
1074831241 10:117250907-117250929 AGTGGGCACAGTATGGCTGGTGG + Intronic
1074880250 10:117651189-117651211 AGGAAACCCAGCATGGCTGGAGG - Intergenic
1075102670 10:119517296-119517318 AGGGTGGACAGCATGGCTTTCGG - Intronic
1075427261 10:122351446-122351468 AGGGAGGACAGGCAGGATGGCGG - Intergenic
1075672040 10:124269454-124269476 AGGGAAGACAGCATGGAAGGAGG - Intergenic
1075672124 10:124270037-124270059 AGGGAAGACAGCATGGAAGGAGG - Intergenic
1076124447 10:127962920-127962942 AGAGAGGAGAGCTGGGCTGGGGG + Intronic
1076473471 10:130736270-130736292 AAGGAAGACAGGATCGCTGGAGG + Intergenic
1076524754 10:131105323-131105345 AGAGAGGACAGCATGGAGAGGGG - Intronic
1076549156 10:131267016-131267038 AGGGAGGACCTGAAGGCTGGGGG - Intronic
1076743824 10:132502637-132502659 AGGAGGGAGAGCAAGGCTGGAGG - Intergenic
1077052397 11:573207-573229 AAGGAGGACGGGATGCCTGGGGG - Intergenic
1077173745 11:1179621-1179643 AGGGAGGAGGGCGTGGCTGACGG + Intronic
1077173765 11:1179695-1179717 AGGGAGGAGGGCGTGGCTGACGG + Intronic
1077182783 11:1223998-1224020 TGGGTGGTCAGCAGGGCTGGAGG + Intronic
1077390481 11:2298676-2298698 AGGCAGGACAGCAGGCTTGGTGG + Intronic
1077458460 11:2695268-2695290 AGGGAGGAGAGCAAGGATAGAGG - Intronic
1077908586 11:6555171-6555193 AGGGAGGAGAGGAGGGATGGAGG - Intronic
1078079645 11:8194494-8194516 AGAGAGGACTTCATGGGTGGTGG + Intergenic
1078093381 11:8281662-8281684 ATGGAGGACAGGATGGCAGGGGG - Intergenic
1078536338 11:12178074-12178096 AGGGAGGAGAGAAGGGCTGAAGG + Intronic
1079365715 11:19807583-19807605 AGAGAGAAGAGCATGGCTGATGG - Intronic
1080274882 11:30492784-30492806 AGGGTGTACAGCATGACTGAGGG - Intronic
1080368555 11:31608283-31608305 AGGGAGGACAGCCTGATTGATGG + Intronic
1080410031 11:32014573-32014595 AAGGAGGACAGCAGGGCAGAAGG + Intronic
1081356465 11:42120486-42120508 AGGGAAGACAGCATGTGTAGGGG - Intergenic
1081839252 11:46184462-46184484 AAGGCAGACAGTATGGCTGGAGG + Intergenic
1081852600 11:46284238-46284260 ATGGAGCAGAGCATGGCAGGAGG + Intronic
1083264372 11:61539555-61539577 AGGGAAGACAGTAGGGCTGACGG + Intronic
1083316175 11:61816198-61816220 AGGGAGGAGAGCAAGGATGCAGG - Intronic
1083608327 11:63992403-63992425 ATGGAGGCCAGTGTGGCTGGTGG + Intronic
1083991684 11:66250027-66250049 AGGGTGGTGAGCATGGCAGGGGG - Intergenic
1084268329 11:68016340-68016362 AAGGAGGCCAGCATAGCTGTCGG + Intronic
1084289359 11:68151914-68151936 ACAGAAGACAGCAGGGCTGGGGG - Intergenic
1084356944 11:68645355-68645377 GGGGAGGACGGCAGGGCTGGAGG + Intergenic
1084374052 11:68764036-68764058 AGAGAGGACAGCACGGCAGGAGG + Intronic
1084420384 11:69057786-69057808 CGGGTGGGCAGGATGGCTGGCGG - Intronic
1084441251 11:69174822-69174844 ATGGAGGACTCCATGGCTGTAGG - Intergenic
1084495627 11:69501508-69501530 ATGGAGGAAAGGAGGGCTGGAGG + Intergenic
1084685863 11:70694874-70694896 AGGGTGGGCAGCACGGATGGAGG - Intronic
1085035621 11:73298090-73298112 ACAGAGGGAAGCATGGCTGGGGG + Exonic
1085071587 11:73551292-73551314 AGGGAGGACAGATTTGGTGGAGG + Intronic
1085083712 11:73652978-73653000 ATGGAAGACAGCACTGCTGGAGG + Exonic
1085129460 11:74025704-74025726 AGGGAGGATACGAGGGCTGGAGG + Intronic
1086079847 11:82891613-82891635 AGGGAGGATGGTATGTCTGGAGG - Intronic
1088626961 11:111736447-111736469 AGGGAGGAGAGCTTGGCTGAAGG - Intronic
1088876486 11:113940759-113940781 CGGGAGAAGAGCTTGGCTGGGGG - Intronic
1089215644 11:116833023-116833045 TGGGAGGCCAGCATGCCTGGAGG - Exonic
1089493991 11:118899382-118899404 GGGGAGGGCAGCATGGCGGGCGG + Exonic
1089535929 11:119160788-119160810 AGGGATGACAGCATTGCAGCTGG + Intronic
1089595853 11:119579648-119579670 AGTGAGGACAGCCAGCCTGGGGG - Intergenic
1089958753 11:122597233-122597255 AGGGAGGGCAGGAGGGATGGAGG + Intergenic
1090998617 11:131889383-131889405 TGTGAGGCCAGCCTGGCTGGGGG - Intronic
1091041501 11:132285278-132285300 AGGGTGGAGAGGAAGGCTGGTGG - Intronic
1091049147 11:132352142-132352164 AGTGAGGACAGCATGGCGGGTGG - Intergenic
1091171804 11:133526275-133526297 AGGGAGAGCACCAAGGCTGGGGG + Intronic
1091259910 11:134225503-134225525 AGGGAGGACAGTAACGCAGGGGG - Intronic
1091931517 12:4399407-4399429 AGGGAAGACAGGAAGGATGGAGG + Intergenic
1092192940 12:6533671-6533693 GCGGAGGACAGGATGGCTGGTGG - Intergenic
1092507389 12:9117599-9117621 AAGGAGGACAGAAGGGCTGAGGG + Intergenic
1092704837 12:11271152-11271174 TTTGAGGACAGCTTGGCTGGAGG + Intergenic
1092745571 12:11669342-11669364 AGGGAGGACAGGAGGACGGGAGG - Intronic
1093638959 12:21503028-21503050 AGGGAAGACAGCCTGATTGGGGG - Intronic
1094567552 12:31613556-31613578 AGGGAGGGAAGGATGGATGGAGG + Intergenic
1095233698 12:39772163-39772185 AGGGAGTACAGCATGGCACAAGG + Intronic
1095955334 12:47802675-47802697 AGGTGGGAGAGCCTGGCTGGGGG + Intronic
1096102548 12:48978495-48978517 GCGGCGGACAGCATGGCTCGCGG - Intronic
1096480068 12:51934224-51934246 AGGGAGTCCAGAGTGGCTGGAGG - Intergenic
1096491957 12:52017686-52017708 AGAGAAGACAGCATGGGTGAAGG - Intergenic
1097076273 12:56397211-56397233 AGGGAGGACCTGAAGGCTGGGGG - Intergenic
1097106635 12:56629925-56629947 TGGGAGGAGAACAGGGCTGGTGG - Intronic
1098669176 12:73203121-73203143 AGGGAGAACATCATGGATGGTGG - Intergenic
1099027718 12:77486624-77486646 AGGCATGACAGCATGGCTGAGGG - Intergenic
1100150395 12:91729627-91729649 AGGGAATACAGAATGGATGGTGG + Intergenic
1100370810 12:93967058-93967080 AGGGAAGAAAGGATGGCGGGAGG - Intergenic
1100370836 12:93967134-93967156 AGGGAGGAAGGGATGGATGGAGG - Intergenic
1100412703 12:94337861-94337883 AGGGAGGAGAGAATGGATGAAGG + Intronic
1100587139 12:95990781-95990803 AGGGAGGAAAGGAGGGCTGGAGG + Intronic
1101443856 12:104723340-104723362 AGTCAGGACAGCCTGGCGGGCGG + Intronic
1101811812 12:108113806-108113828 ATGGAGGACAGCATGACTCCTGG + Intergenic
1102573861 12:113843859-113843881 AGGGAGGACAGCATGGCTGGAGG - Intronic
1102574002 12:113844496-113844518 AAGGTGGACAGCAGGTCTGGAGG + Intronic
1102780929 12:115563706-115563728 AGGGAAGAGAGGATGGCAGGAGG + Intergenic
1103620872 12:122186375-122186397 AGTGTGGCCAGCATGGGTGGAGG + Intronic
1103729514 12:123017911-123017933 AGGGAGGAAGGGATGGATGGAGG - Intronic
1104176120 12:126334420-126334442 AGAGAGGAGAGCATGGAGGGAGG + Intergenic
1104470903 12:129028820-129028842 AGGGAGGACAGCGATGCAGGAGG + Intergenic
1104578224 12:129988110-129988132 AGGAAGGACAGCAAGGGTGATGG + Intergenic
1104740014 12:131165266-131165288 AGGGTGGACCGCAGGGCTGTGGG - Intergenic
1104928675 12:132327148-132327170 AGGGAGGACAGCTAGGATGAAGG + Intronic
1105419396 13:20239389-20239411 AGAGAGGAGATAATGGCTGGAGG + Intergenic
1106589561 13:31087849-31087871 AGGGAGGACTGCATCCCTGGGGG - Intergenic
1107773081 13:43809677-43809699 AGAGAAGGCAGCATGGTTGGGGG - Intergenic
1108531544 13:51331500-51331522 AGTGAGGACAGCAAGGCTGGGGG - Intergenic
1109116899 13:58399749-58399771 AGGGAAGAAATTATGGCTGGGGG + Intergenic
1109302626 13:60604874-60604896 AAGGAGGCCAGTGTGGCTGGCGG + Intergenic
1110689306 13:78413196-78413218 AGGGAGGCCAGAGTGGCTGAAGG - Intergenic
1111546243 13:89741084-89741106 AGCGAGGAAGGCATGGCCGGGGG + Intergenic
1112368325 13:98774056-98774078 CGGAAGGACAGCAGGGCGGGTGG + Intergenic
1112461385 13:99606532-99606554 AGGAAGGAGGGCGTGGCTGGCGG + Intergenic
1112664300 13:101551937-101551959 AGGGAGGGCAGCCTTGATGGGGG + Intronic
1113592809 13:111512781-111512803 AGGGAGGAGCCCCTGGCTGGGGG - Intergenic
1113720620 13:112553253-112553275 ATGGAGAAGAGCATGGCTGGTGG - Intronic
1114252240 14:20971444-20971466 AGGGAGGGGAGGAGGGCTGGGGG - Intergenic
1115294653 14:31812360-31812382 AAGGAGGCAAGCCTGGCTGGGGG - Intronic
1116598267 14:46882201-46882223 AGGCTGGACAGCAGCGCTGGTGG - Exonic
1116658026 14:47675215-47675237 AGGCAAGACAGCAGGGCTGGGGG - Intergenic
1117316697 14:54577767-54577789 AGAGAAGACAGAATGGCGGGGGG + Intronic
1118090111 14:62465302-62465324 ATGGAGAACAGCATGACTGTGGG - Intergenic
1118204198 14:63706515-63706537 AGGCAGGAGAGAATTGCTGGTGG - Intronic
1118457656 14:65959214-65959236 AGGCAGAACAGGATGGCTGAGGG - Intronic
1118967278 14:70599609-70599631 AAGGAGGTCAGTGTGGCTGGAGG - Intronic
1119184722 14:72631960-72631982 AAGGGGAACAGCATGGGTGGAGG + Intronic
1119413737 14:74455844-74455866 AGGGAGAACAGCACAGTTGGAGG - Intergenic
1119705391 14:76779830-76779852 ACTGAGGCCAGCATGGCTGTGGG + Exonic
1119871586 14:78022528-78022550 AAAGAGGACAGGATGGCTGAGGG + Intergenic
1120206018 14:81588603-81588625 AGGGAGCAGGGCAGGGCTGGGGG + Intergenic
1121017107 14:90555534-90555556 TGGGAGGACAGGATGGCATGGGG + Intronic
1121031192 14:90659981-90660003 AAGGAGGAGAGAATGGCAGGTGG + Intronic
1121242142 14:92438835-92438857 AGGGAGGAGAGAGGGGCTGGAGG - Intronic
1121916010 14:97837432-97837454 AGGGAGGGCAGCAGGGAGGGAGG + Intergenic
1121930154 14:97964915-97964937 AGGGAGAAGGGCAGGGCTGGGGG - Intronic
1122797773 14:104214933-104214955 AGGGAGGTCAGCATGTAGGGAGG + Intergenic
1122806222 14:104260071-104260093 AGGTGGGACAGGATGGCTGGAGG - Intergenic
1122882287 14:104695537-104695559 AGGGAGGACAGGAAGGGCGGAGG - Intronic
1122993964 14:105252709-105252731 AGGGAGGCCAGCCAGGCTTGCGG - Intronic
1123191999 14:106580356-106580378 AAGGAGGACAGCATGGAAAGTGG - Intergenic
1124589638 15:31041534-31041556 AGGTGGGACAGGATGGCTAGAGG - Intronic
1127005890 15:54569907-54569929 AGGGTGGATAGGAGGGCTGGAGG - Intronic
1127525935 15:59792115-59792137 AGGGAGGGCCTAATGGCTGGGGG - Intergenic
1128388554 15:67167335-67167357 AGGGAGCTCAGCGTGGCTGGAGG + Intronic
1129252985 15:74318891-74318913 AGGGAGGACAGAAGGGCTTCTGG + Intronic
1130399390 15:83535308-83535330 AGGTTGGACAGGATGGCTTGAGG + Intronic
1130655458 15:85789356-85789378 AGGGAGCCCAGCAGGGCAGGAGG - Intronic
1130966942 15:88705057-88705079 AGGGAGGTCAGCATGGATTGAGG + Intergenic
1130991340 15:88877695-88877717 AGGGAGACCAGCCTGGATGGCGG + Exonic
1131254676 15:90854340-90854362 AGGGAGCACTGCATGGGAGGAGG - Intergenic
1131257221 15:90871077-90871099 AGGGAGGACTGCACGGCGGCAGG - Intronic
1131338239 15:91571061-91571083 AGGTAGGTCAGGATTGCTGGGGG + Intergenic
1131399074 15:92110191-92110213 AGGATGGACTGCATTGCTGGAGG - Intronic
1132549131 16:547159-547181 AGTGAGGACTGCGGGGCTGGTGG + Exonic
1132746434 16:1438238-1438260 AGGGAGGGGAGCTTGGCTGCTGG + Intronic
1132814252 16:1818359-1818381 AGGGCGGAGGGCATGGCGGGAGG - Intronic
1132850919 16:2024606-2024628 ATGGAGAACAGCATGGCAGAGGG - Intergenic
1132888672 16:2193943-2193965 CAGGAGCAGAGCATGGCTGGAGG + Intronic
1133319608 16:4904785-4904807 AGAGAGGACAGCAAGGGTGTGGG + Intronic
1133398868 16:5470192-5470214 ATGCAGGACAGCATGGTGGGTGG - Intergenic
1133734875 16:8607391-8607413 TGGGAGGCCAGGATGCCTGGGGG - Intergenic
1134026517 16:10958190-10958212 AGGAAGGAGAACATGTCTGGTGG + Intronic
1134104441 16:11475930-11475952 ATGGAGGACAGCATGGCACAGGG + Intronic
1135181833 16:20281560-20281582 AGGGAGGCCAGTGTGGCTGGAGG + Intergenic
1135394199 16:22118726-22118748 ACGGAGCACAGCATGTCTGCAGG + Intronic
1136350151 16:29701494-29701516 GGGGTGGACAGGATGGGTGGGGG - Intergenic
1136475434 16:30510279-30510301 AGGTAGGCCAGGAGGGCTGGTGG + Intronic
1137581325 16:49635298-49635320 AGTGAGGGCACCATGGGTGGTGG - Intronic
1138199770 16:55080069-55080091 TGGGAAGGCAGCATGGATGGGGG - Intergenic
1138330492 16:56211420-56211442 CTGGAGGACGGCATAGCTGGAGG - Intronic
1139491491 16:67288421-67288443 AGGCAGGAGGGCATGGCTTGGGG + Intronic
1139590713 16:67931392-67931414 TAGGAGAACAGCAGGGCTGGGGG - Intronic
1141539561 16:84709302-84709324 AGTGGGGACAGCATGTGTGGTGG + Intronic
1142020773 16:87780864-87780886 AGGGAGGAAGGCGTGGGTGGAGG - Intergenic
1142081226 16:88149920-88149942 GGGGAGCACAGCAAAGCTGGAGG - Intergenic
1142112337 16:88339391-88339413 ATGGGGGACAGGATGGCAGGGGG + Intergenic
1142112399 16:88339548-88339570 ATGGGGGACAGGATGGCAGGGGG + Intergenic
1142172375 16:88629704-88629726 GGTGTGGTCAGCATGGCTGGGGG - Intronic
1142306309 16:89287887-89287909 AGGCAGGACAGCAAGGCTGAGGG - Intronic
1142490347 17:274446-274468 AGGGATGACAGGAGGGTTGGCGG - Intronic
1143141155 17:4742499-4742521 AAGGAGGTCAGAATGGTTGGGGG + Intronic
1144658296 17:17052041-17052063 AGGGTGGCCAGCAGGGCTGGTGG + Intronic
1145043743 17:19596067-19596089 AGTGTGGACAGCATGGATGGGGG + Intergenic
1145389217 17:22443026-22443048 AGGGGAGACAGCAGGGCTGAAGG - Intergenic
1146251473 17:31348385-31348407 AGGGAGGGAAGGATGGATGGAGG - Intronic
1146829656 17:36057687-36057709 AGGGAGGACATGATGGCAGGAGG - Intergenic
1146927362 17:36754255-36754277 AGGGAGGCCGGCATGGTAGGAGG + Intergenic
1147120304 17:38331544-38331566 AGGGAGGAAAGCAGGGCTGCAGG + Intronic
1147194752 17:38758583-38758605 AGGGAGGAGGCCAAGGCTGGAGG - Intronic
1147335334 17:39724044-39724066 AGGAAGGACCCCATGGCTGCAGG + Intronic
1147344167 17:39776468-39776490 AGGGAGGACAGCAAGGAGGAGGG + Intronic
1147850550 17:43439335-43439357 GCGGTGGACAGCATGGCAGGTGG - Intergenic
1147924595 17:43938709-43938731 AGGTAGGACAGCCTGGATGCTGG + Exonic
1148681710 17:49477854-49477876 TGGGAGGGGAGCCTGGCTGGTGG + Intergenic
1148905302 17:50908174-50908196 GGGGTGGACAGCATGCCAGGTGG - Intergenic
1148991258 17:51668943-51668965 AGGCAGGCCAGCAGTGCTGGGGG - Intronic
1149599127 17:57881938-57881960 AGGGAGGCCAGCAGTGCTGCTGG - Intronic
1150607971 17:66710549-66710571 AGGGTGGAGAGCATGGCTGCAGG - Intronic
1151487056 17:74407638-74407660 AGGGAGGCCAGGCTGGATGGTGG + Intergenic
1151582041 17:74985508-74985530 AGGGAGGGAAGCAGGGTTGGTGG - Intergenic
1151625459 17:75272772-75272794 GGAGAGGACAGCCTGGGTGGTGG + Intergenic
1151698011 17:75727872-75727894 GTGGAGGACAGCAGGGCAGGAGG + Intronic
1151773077 17:76177574-76177596 AGGGAGGACGTGAAGGCTGGGGG + Intronic
1152449120 17:80365274-80365296 AAGGAGGCCAGCATGGATGCTGG + Intronic
1152564610 17:81094642-81094664 AGGGAGGGCAGCATGGCAGGTGG - Intronic
1152576497 17:81143562-81143584 AGGCGGGGCTGCATGGCTGGGGG - Intronic
1152783573 17:82236950-82236972 CTGGAGGACAGCAGGGCGGGTGG + Intronic
1152800184 17:82327227-82327249 GGGCAGGTCTGCATGGCTGGTGG + Exonic
1154123349 18:11669482-11669504 AGGCAGCACAGCAGGGCTGGCGG + Intergenic
1154446738 18:14440843-14440865 GGGGAAGCCAGCAGGGCTGGAGG - Intergenic
1154497942 18:14975970-14975992 AGAGGGGACAGCAGGGCTGGAGG - Intergenic
1155447065 18:25923236-25923258 AGGGAGGAGAGCAGAGCTGTTGG - Intergenic
1155979525 18:32166001-32166023 AGGGATAACAGTGTGGCTGGAGG - Intronic
1156161204 18:34360348-34360370 AGTGAGGAGATGATGGCTGGAGG - Intergenic
1156449888 18:37260995-37261017 TGGGAAGACAGCATGGTTGGAGG - Intronic
1157335511 18:46734402-46734424 AGGGTGGAGAGCAGGGGTGGGGG - Intronic
1158067120 18:53424154-53424176 AGGAAGGACAGCAAGACTGGAGG - Intronic
1158187293 18:54785019-54785041 TGGGAGGACATTGTGGCTGGAGG - Intronic
1158495286 18:57949711-57949733 AGGGAGGAAAGAAAGGCGGGTGG + Intergenic
1159416091 18:68151266-68151288 AGGGATGGGAGCATGGCAGGGGG + Intergenic
1160022415 18:75190755-75190777 CCGGAGGACGGCATGGCTGAGGG + Intergenic
1160617370 18:80141811-80141833 AGGGGTGGCAGCATGGCTTGAGG - Intronic
1160702991 19:517476-517498 ATGGAGGCCAGGATGGGTGGGGG + Intronic
1160703035 19:517569-517591 GGGGAGGCCAGGATGGGTGGGGG + Intronic
1160703049 19:517600-517622 AGGGAGGCCAGGCTGGGTGGGGG + Intronic
1160703163 19:517868-517890 AGGGAGGCCAGGCTGGGTGGGGG + Intronic
1160803025 19:979327-979349 AGGAGGGTCAGCGTGGCTGGAGG + Intergenic
1161141653 19:2651436-2651458 AGGGAGGAAAGGAAGGCAGGAGG - Intronic
1161346837 19:3772346-3772368 AGGGAGGGCAGGGTGGATGGAGG + Intergenic
1161436868 19:4268750-4268772 ATTGAGGCCAGCATTGCTGGTGG + Exonic
1161524087 19:4742867-4742889 ACGGAGGACTGCAAGGCTGGTGG - Intergenic
1161868717 19:6854055-6854077 AGAAGGGACAGCAAGGCTGGTGG + Exonic
1161927662 19:7313117-7313139 AGGAGAGACAGAATGGCTGGTGG - Intergenic
1161939578 19:7394521-7394543 AGGGAGGACAGTGGAGCTGGGGG - Intronic
1161939601 19:7394580-7394602 AGGGAGGACAGCGGAGTTGGGGG - Intronic
1161939613 19:7394610-7394632 AGGGAGGACAGCGGGGTTGGGGG - Intronic
1161939626 19:7394639-7394661 AGGGAGGACAGCGGGGTTGGGGG - Intronic
1162467163 19:10849144-10849166 AAGGAGGCCATCATGGCAGGAGG - Intronic
1163691250 19:18739626-18739648 GGGGAGCACAGCATGGTGGGGGG + Intronic
1164220643 19:23190519-23190541 AGGGAGGCGGGCAGGGCTGGCGG + Intergenic
1165062791 19:33212942-33212964 GGAGATGACAGCAAGGCTGGTGG + Exonic
1165112980 19:33512982-33513004 AGTCAGGACAGCATGGGTGGTGG - Intronic
1165343690 19:35229746-35229768 CGGGAGGCCAGCGTGGTTGGAGG - Intergenic
1165374365 19:35431348-35431370 AAGGAGGCCAGTGTGGCTGGGGG - Intergenic
1166318134 19:42000046-42000068 AAGCAGGTCAGCATGGCTGGAGG + Intronic
1166504822 19:43364601-43364623 AAGGGGCACAGGATGGCTGGAGG + Intergenic
1166505718 19:43370313-43370335 AAGGGGCACAGGATGGCTGGAGG - Intergenic
1166586829 19:43956494-43956516 AGAGAGGATAAAATGGCTGGGGG - Intronic
1166898132 19:46036705-46036727 TGGGAGGGCCTCATGGCTGGGGG + Intergenic
1166948729 19:46412746-46412768 CGGGAGGTCAGGCTGGCTGGGGG - Exonic
1167369012 19:49069985-49070007 AGGGTGGAGGGCAAGGCTGGGGG - Exonic
1167448574 19:49553989-49554011 AGGGAGGACATGAAGGATGGGGG + Intergenic
1167603765 19:50469168-50469190 AGGGAGGCCAGTGTGGCTGGAGG - Intronic
1167605421 19:50479257-50479279 ATGCAGGACACCATGCCTGGCGG - Intronic
1168097558 19:54124285-54124307 AGGGAGGGCAGCTGGCCTGGGGG - Intronic
1168242922 19:55096231-55096253 AGGGAGGAGTCCAGGGCTGGCGG - Intronic
1168511481 19:56977219-56977241 AGTGAGGACAGCATGGCCAGGGG + Intergenic
1168521036 19:57050697-57050719 AGGGAGGGCAAAAGGGCTGGAGG - Intergenic
925021070 2:568317-568339 TGGGCGGCCAGCATGACTGGAGG + Intergenic
925363447 2:3295375-3295397 AGAGAGGATAGCCTGGATGGAGG - Intronic
925369813 2:3336403-3336425 ATGGAGGGCAGCATGGCATGTGG - Intronic
925865228 2:8221262-8221284 AGAGAGGAGAGCATGACTGGAGG + Intergenic
926056356 2:9776281-9776303 GGGGAGGACAGCCAGGCTGAGGG - Intergenic
926850556 2:17192707-17192729 GGGGAGGGTAGCAAGGCTGGTGG - Intergenic
927241176 2:20920631-20920653 AGGGAAGACTGCAAGGATGGTGG - Intergenic
927712886 2:25336619-25336641 AGAGAGGACAGCAGGGAGGGAGG - Intronic
927875173 2:26650433-26650455 AAGGAGGCCAGCATGGCTCTAGG + Intergenic
928182744 2:29080923-29080945 AGGGAGGCCAGGAGGGCTGAGGG - Intergenic
928452974 2:31395282-31395304 TGGTGGGACAGGATGGCTGGAGG + Intronic
928940441 2:36721788-36721810 CTGGAGGATAGCATGGTTGGTGG - Intronic
929051195 2:37838358-37838380 AGGGAGGAGAGGATAGCTGGGGG + Intergenic
929137378 2:38637677-38637699 AGGGAGGAAGGCAGGCCTGGGGG + Intergenic
929296509 2:40253861-40253883 AGGAAGGACAGCAGGAGTGGGGG + Intronic
929484123 2:42339596-42339618 AAGGAGGAAAGCAAGGCAGGAGG - Intronic
929570216 2:43018211-43018233 AGGGAGGGCAACATAGCAGGAGG + Intergenic
929654621 2:43717938-43717960 AGTGAAGTCAGCAAGGCTGGTGG + Intronic
930001008 2:46861383-46861405 AGGCAGGACCACATGGCGGGGGG + Intergenic
930033544 2:47072237-47072259 GGGGAGGACAGGGTGGCTGCAGG - Intronic
930217438 2:48711017-48711039 GGGGAGGCCAGTGTGGCTGGAGG - Intronic
930475350 2:51875149-51875171 AGAGAGGACACAGTGGCTGGGGG + Intergenic
930719891 2:54628876-54628898 AGGGAGCTCAGCATGGGTGCAGG - Intronic
931916590 2:66963146-66963168 AGGGCTGACAGAATGGCTGGGGG - Intergenic
933648595 2:84831448-84831470 TGGGTGGACAGCATTGCTGAGGG + Intronic
934062079 2:88304208-88304230 AGGGATGAATGGATGGCTGGAGG - Intergenic
935195887 2:100816040-100816062 AGGGAGGAAAACAGGGCTGGAGG - Intergenic
935306852 2:101745337-101745359 AGGGAGGACAGCAGTATTGGGGG - Intronic
935433061 2:102998970-102998992 AGGTGGGACAGGATGGCTAGTGG + Intergenic
935601336 2:104925189-104925211 AGTGAAGACAGGATTGCTGGTGG - Intergenic
935718692 2:105960725-105960747 AAGGAGGTCAGTGTGGCTGGAGG - Intergenic
936085705 2:109467486-109467508 TGGAAGGACAGCAGGACTGGGGG + Intronic
936145871 2:109980367-109980389 AAGGGGGACAGCGTGGCTGGAGG - Intergenic
936198819 2:110391111-110391133 AAGGGGGACAGCGTGGCTGGAGG + Intergenic
937597962 2:123692602-123692624 TGGTGGGACAGGATGGCTGGAGG - Intergenic
938120417 2:128629128-128629150 AGGGAGGAGGGCAGAGCTGGTGG - Intergenic
938483213 2:131679384-131679406 GGGGAAGCCAGCAGGGCTGGAGG + Intergenic
939208334 2:139137988-139138010 AGAGAGGATAGCATTGCTTGGGG + Intergenic
939318048 2:140578463-140578485 AAGGAGGCCAGGGTGGCTGGAGG - Intronic
940336242 2:152530899-152530921 TGGGAGTACAGCAAGACTGGAGG + Intronic
940798742 2:158109066-158109088 AAAGAGGAGAACATGGCTGGAGG - Intronic
941022786 2:160426838-160426860 AGGGAGGGGAGCATGTCAGGGGG + Intronic
942957156 2:181787026-181787048 ATGGAGAGCAGCATGGCTGGAGG - Intergenic
944580070 2:201124704-201124726 AGGGGGAACAGAATGGCTAGGGG + Intronic
944948949 2:204724855-204724877 GGGGAAGACAGGATGGCTGTGGG + Intronic
945309471 2:208294651-208294673 AGGTGAGACAGAATGGCTGGAGG + Intronic
945465328 2:210162916-210162938 AGGTAGGATAGAATGGCTAGAGG - Intronic
945874514 2:215264291-215264313 AGGGAGGACAGGGTTGATGGTGG + Intergenic
945992222 2:216405707-216405729 AGTGAGGCCGGCTTGGCTGGAGG - Intergenic
945994774 2:216426814-216426836 AGGAAGGACAGCATGGGGTGAGG - Intronic
946417715 2:219548898-219548920 AGGGATGACAGCCTGGAAGGGGG + Intronic
946433329 2:219636929-219636951 GGGGAGGACAGCATGGGAGGGGG + Intronic
947710447 2:232310818-232310840 AGGGAGGGCAGCAAGGCCTGGGG + Intronic
948023651 2:234758251-234758273 AGGGAGGCCAGTGTGGCTGGAGG - Intergenic
948080577 2:235202328-235202350 AGGGCGGACACCATGCCTGGCGG - Intergenic
948464573 2:238146025-238146047 AGGGAGGACACCTGGGCTGTGGG - Intronic
948668220 2:239549555-239549577 AGGGAGGTCTGGAAGGCTGGAGG - Intergenic
948803218 2:240442118-240442140 AGGGAGGACACCGTGGAGGGAGG - Intronic
948983208 2:241505530-241505552 AGGGAGTAGAGCAGGGCGGGAGG - Intronic
949073513 2:242040816-242040838 GGTGAGGACAGCATGGATGAGGG + Intergenic
1169022566 20:2340650-2340672 AGGCCGGACAGCATGGGCGGGGG - Exonic
1169040624 20:2492213-2492235 AAGGAGGCAAGCAAGGCTGGGGG - Intronic
1169043067 20:2511718-2511740 AGGGAGGAAAGCAGGGCGAGGGG - Intronic
1169147039 20:3259539-3259561 ATGGAGGACTGAATTGCTGGTGG + Exonic
1169236812 20:3936265-3936287 AGGGAGGAGAGCAGGACAGGTGG + Intronic
1170369442 20:15632794-15632816 AAGGAGGACAGCAGGGGAGGAGG - Intronic
1171486659 20:25490744-25490766 AGGGTGGAGAGCAAGGCTGTTGG + Intronic
1171968527 20:31548938-31548960 ACGGAGGAGGGCATGGCTGTGGG - Intronic
1171975392 20:31591397-31591419 AGGAAGCACCACATGGCTGGTGG + Intergenic
1172233623 20:33354191-33354213 AGGGAGTCCAGCCAGGCTGGTGG + Intergenic
1172781754 20:37440507-37440529 ATGGAGGAGAGGCTGGCTGGAGG + Intergenic
1173466016 20:43282018-43282040 AGGAAGGTCATCATGGCTGTGGG - Intergenic
1173466235 20:43283906-43283928 AGAGAGGACAGCATCTCAGGTGG - Intergenic
1173851078 20:46218736-46218758 AGGGAGGGCAGCAGGCGTGGGGG + Intronic
1173929861 20:46809554-46809576 AGGGAGGAGAGCAAGTATGGAGG + Intergenic
1174278344 20:49419934-49419956 GGGGAGGCCAGCATGGCTGGAGG - Intronic
1174401449 20:50278139-50278161 AGGGAAGAGGGCATGGGTGGGGG - Intergenic
1174401524 20:50278482-50278504 GAGGAAGCCAGCATGGCTGGAGG - Intergenic
1175256815 20:57652709-57652731 GGAGAGGGCAGCAGGGCTGGCGG + Intronic
1175257021 20:57653664-57653686 GGGCTGGTCAGCATGGCTGGTGG - Intronic
1175278683 20:57788376-57788398 AAAGAGGCCAGCGTGGCTGGAGG - Intergenic
1175339499 20:58219092-58219114 GGGGAGGAGAGTATGGCAGGAGG - Intronic
1175540046 20:59742757-59742779 AGGGAGAGCAGCGTGGGTGGAGG + Intronic
1175643933 20:60655405-60655427 GTGGAGGTCAGAATGGCTGGTGG - Intergenic
1175869073 20:62199016-62199038 AGGGAGGATTTCAGGGCTGGGGG - Intronic
1176093387 20:63328817-63328839 AAGGAGGACAGGAGGGCGGGAGG - Intronic
1176292273 21:5052572-5052594 AGGGAGGAATGGATGGATGGAGG - Intergenic
1176364918 21:6026921-6026943 AAGGAGGCCAGCGTGGTTGGAGG - Intergenic
1176949713 21:15030691-15030713 AGGGAGGAAAACATGGAAGGAGG + Intronic
1177638573 21:23817178-23817200 AGGGAGGAGAGGATGGGAGGAGG - Intergenic
1178376376 21:32070881-32070903 AAGGAGGACAGCGGGGGTGGTGG + Intergenic
1178467084 21:32858738-32858760 AGGGAGGGCCTGATGGCTGGGGG - Intergenic
1179480444 21:41673351-41673373 CGGGAGGACAGCAGGGCCGGCGG + Intergenic
1179518706 21:41927921-41927943 AGGGAGGAGAGTGTTGCTGGGGG - Intronic
1179529961 21:42011313-42011335 CGGGAGGAAAGCCTCGCTGGCGG + Intergenic
1179609961 21:42543834-42543856 AGGGAGGACAGGAGGACGGGAGG - Intronic
1179758600 21:43511624-43511646 AAGGAGGCCAGCGTGGTTGGAGG + Intergenic
1179818407 21:43922544-43922566 AGAGAGGCCTGCATGGCAGGGGG + Intronic
1179864987 21:44211086-44211108 AGGGAGGAATGGATGGATGGAGG + Intergenic
1179957841 21:44751141-44751163 AGGGAGCAAAGCCTGGCAGGAGG + Intergenic
1180018396 21:45102883-45102905 AGAGAGGACAGCATGGAAGTGGG + Intronic
1181523049 22:23460255-23460277 AGGGAAGCCCCCATGGCTGGAGG + Intergenic
1181599358 22:23940190-23940212 AGGGAAGTCAGGAAGGCTGGAGG + Intergenic
1181609149 22:24001113-24001135 AGGGAAGTCAGGAAGGCTGGAGG - Intergenic
1182085490 22:27558328-27558350 AGGGAGAAGGGCACGGCTGGGGG + Intergenic
1182143565 22:27982942-27982964 AGGGAGGAGCTCCTGGCTGGGGG + Exonic
1182442196 22:30371089-30371111 AGGGAGGGCAGCAAGGAAGGGGG + Intronic
1183154400 22:36063921-36063943 ATCAAGGACAGCATGACTGGAGG - Intergenic
1183429122 22:37755218-37755240 GTGGTGGGCAGCATGGCTGGAGG + Intronic
1183498472 22:38163827-38163849 TGGGAGGACTGAATGGATGGAGG + Intronic
1183771151 22:39927173-39927195 AGTGGGGATAGCATGGCCGGGGG - Intronic
1183936839 22:41267486-41267508 AGGGAAGAGGGCAGGGCTGGTGG - Intronic
1184103375 22:42353416-42353438 AGGGAGGACAGGAAGGAGGGTGG + Intergenic
1184147020 22:42617714-42617736 AGTGAGGCCAGTGTGGCTGGAGG - Intergenic
1184195438 22:42924601-42924623 AGGGTGGACAGCAGTGGTGGCGG - Intronic
1185029812 22:48436290-48436312 AGAGGGGACAGCAGGGATGGGGG + Intergenic
1185085773 22:48740257-48740279 TGGGAGGACGGCAGGGCAGGAGG + Intronic
1185290297 22:50021925-50021947 ATGGAGGACTGCATGTCAGGTGG - Intronic
949453034 3:4208235-4208257 AGGTGGGACAGGATGGCTAGAGG - Intronic
949730841 3:7110965-7110987 GGGGAAGACAGAATGGGTGGAGG + Intronic
949792603 3:7809608-7809630 AGGGAGGGGAGCGTGGCTGTTGG - Intergenic
949879731 3:8651927-8651949 AGGGAGGAGAGATTGGCAGGAGG - Intronic
949984031 3:9525015-9525037 AGGTGGGACAGCATGGCTAGAGG + Intronic
950126536 3:10513356-10513378 AAGGAGGCCCGGATGGCTGGGGG + Intronic
950126871 3:10514959-10514981 GGGGAGGTCAGGAAGGCTGGGGG - Intronic
951360239 3:21716454-21716476 ACAGAGGCCAGCATGGGTGGAGG - Intronic
951580806 3:24160438-24160460 AGGCAGGAAAACATGGCGGGAGG + Intronic
951614230 3:24523407-24523429 ATGGAGGAAAGAATGGCTGCAGG + Intergenic
951978975 3:28545031-28545053 GGGAAGTCCAGCATGGCTGGGGG - Intergenic
952299656 3:32093169-32093191 AGAGAGAACAGCATGGGTGAAGG - Intergenic
952873791 3:37925036-37925058 AAGGAGGACAGTTTGGCTGGTGG - Intronic
952952907 3:38538892-38538914 AGGCAGGGCAGGAGGGCTGGTGG - Intronic
953477388 3:43217365-43217387 AGGGAGGAGGGCAGAGCTGGGGG - Intergenic
953787345 3:45921194-45921216 AGGGACAAGAGCATGACTGGAGG + Exonic
953910222 3:46889029-46889051 AGAGAGGGCAGCAGGGGTGGGGG + Intronic
953925277 3:46979573-46979595 AGGGCGGAGAGCCTGGCAGGAGG - Intronic
954076082 3:48182001-48182023 AGGGAAAACAGCATAGATGGTGG - Intronic
954265674 3:49469166-49469188 AGGGAGGAAACCATGGCTGGTGG + Intronic
954498034 3:50983330-50983352 AGGGAGGACCTGAAGGCTGGGGG + Intronic
954696713 3:52431302-52431324 AAAGAGGACAGGCTGGCTGGAGG + Intergenic
955930861 3:64055498-64055520 AGGAAGAACAGCATGGATGAAGG - Intergenic
959234887 3:103707684-103707706 TGGGAGGATAGCATGGATGTGGG + Intergenic
960009049 3:112813346-112813368 AGAGAGGACAGCATGGATGAAGG - Intronic
960513341 3:118576444-118576466 AAGGCAGACAGGATGGCTGGGGG - Intergenic
961043825 3:123695219-123695241 AAGGAGGACACCATGCCTGCAGG - Intronic
961077506 3:123995612-123995634 AAGATGGCCAGCATGGCTGGAGG - Intergenic
961134927 3:124501580-124501602 AGGCAGGGCAGCCTGGCTGCAGG + Intronic
961307073 3:125965673-125965695 AAGATGGCCAGCATGGCTGGAGG + Intergenic
961317751 3:126052185-126052207 TGGGAGGACACCCTGCCTGGTGG - Intronic
961412707 3:126734285-126734307 GGGGAGGGAAGCATGGCTGTGGG + Intronic
961546482 3:127637561-127637583 GAGGAGGAGAGCAAGGCTGGTGG + Intronic
961628017 3:128276928-128276950 CAGGAGGTCAGCAGGGCTGGAGG + Intronic
961736561 3:129005394-129005416 AAGGAGGCCAGAGTGGCTGGAGG + Intronic
961742564 3:129041960-129041982 AGGTGGGACAGGATGGCTGAAGG - Intergenic
962290011 3:134127166-134127188 AGGGAGGAGAGAATGAATGGTGG + Intronic
962379274 3:134884086-134884108 ATGGAGGCCAGAATGGGTGGTGG - Intronic
962776639 3:138667244-138667266 AGGAATGACAGCAGGGCTGGAGG + Intronic
963300051 3:143587512-143587534 AAGGAGGCCAGCATGGCTGGAGG + Intronic
963825689 3:149950852-149950874 AGGTGGGACAAGATGGCTGGCGG + Intronic
964623807 3:158739877-158739899 AGAGAGGGCAGCAGGGCTTGTGG - Intronic
967095781 3:186176077-186176099 AGGGAGGTGAGCTTGGGTGGGGG + Intronic
967215175 3:187203616-187203638 AGGGAGCACAGCAAAGCAGGAGG + Intergenic
967258113 3:187613775-187613797 AGGAAGGAGAGCATAGCTGAAGG + Intergenic
967649882 3:191973483-191973505 AGGGAGGACCTAAAGGCTGGGGG - Intergenic
968573759 4:1355523-1355545 GGGGGGGACAGCCTGACTGGTGG - Intronic
968601500 4:1512062-1512084 AGGGAGGAGAGGAAGGGTGGGGG + Intergenic
968663664 4:1809509-1809531 AGGGAGGACAGCAAAGAGGGTGG - Intergenic
969468881 4:7374781-7374803 AGGGAGCACAAGATGGCTGTGGG - Intronic
969702647 4:8776181-8776203 GGGGAGGACAGCAGGGGAGGGGG + Intergenic
969854441 4:9987865-9987887 AGTGAGGCCAGCCTGGCTGGAGG + Intronic
970689947 4:18611522-18611544 AGGGAGGAAGGGATGGATGGAGG + Intergenic
971560754 4:28077354-28077376 AAGGAGGCAAGCCTGGCTGGGGG + Intergenic
972351942 4:38244228-38244250 AGGGAGGGCAGGAGGGCAGGAGG - Intergenic
973598989 4:52522273-52522295 TGAGATGACAGCCTGGCTGGGGG + Intergenic
974340426 4:60608037-60608059 AGGTGGGACAGGATGGCTGTGGG - Intergenic
975733494 4:77359632-77359654 AGGAAGGACAGGATGGCTGTGGG - Intronic
976723886 4:88196979-88197001 AAATAGGACAGGATGGCTGGAGG - Intronic
976837098 4:89386949-89386971 AGTGAGGAGAGCATGGATTGGGG + Intergenic
977461575 4:97332662-97332684 AGGAAGGACAGACAGGCTGGAGG - Intronic
977641176 4:99359856-99359878 AGGCAGGCCAGCAGTGCTGGGGG - Intergenic
977917985 4:102614611-102614633 TGTGAGGACAGCAGGCCTGGTGG - Intronic
978153831 4:105467377-105467399 AAGGAGGCCAGGATGGCAGGAGG + Intronic
979006687 4:115307814-115307836 AGGATGGAAAGTATGGCTGGAGG - Intergenic
981577754 4:146222870-146222892 CCAGAGGACAGAATGGCTGGCGG + Intergenic
982033166 4:151321180-151321202 AGGAAGGATAGCTTGGGTGGGGG - Intronic
982161310 4:152572705-152572727 AGGGAAGACAGGATGGCTAATGG + Intergenic
982215687 4:153080947-153080969 CTGAAGGCCAGCATGGCTGGAGG + Intergenic
982332017 4:154191543-154191565 GGGTGGGGCAGCATGGCTGGTGG + Intergenic
982478928 4:155885164-155885186 AGGCAGGACACCAAGGCAGGTGG + Intronic
982702568 4:158672466-158672488 AGGCAGGACAGCTTGGCTAGCGG - Exonic
983352159 4:166603450-166603472 AGGAAGGACAGAATGGCTAGAGG - Intergenic
983522383 4:168723256-168723278 AGGGAAGACAGAATGACTGTAGG + Intronic
983642856 4:169959488-169959510 AGGCAGGACAGCATTAATGGAGG + Intergenic
983784567 4:171715527-171715549 AGGGAGGGCCTCAAGGCTGGGGG + Intergenic
984148910 4:176101218-176101240 AGGTGGGACAGGATGGCTGAAGG - Intronic
985031603 4:185795982-185796004 AGACAGGACAGTAGGGCTGGGGG - Intronic
985576315 5:675035-675057 GGGGGGTACAGTATGGCTGGGGG + Intronic
985605019 5:853750-853772 ATGGAGGACAGCAAGCCGGGGGG + Intronic
985605085 5:854006-854028 ATGGAGGACAGCAAGCCAGGGGG + Intronic
985605162 5:854297-854319 ACGGAGGACAGCAAGCCAGGGGG + Intronic
985605252 5:854683-854705 ATGGAGGACAGCAAGCCGGGGGG + Intronic
985605476 5:855555-855577 ATGGAGGACAGCAAGCCGGGGGG + Intronic
985804764 5:2034743-2034765 CTGTAGGCCAGCATGGCTGGAGG + Intergenic
985938872 5:3118340-3118362 AGGAAGCACAGCAGTGCTGGGGG - Intergenic
986100877 5:4609946-4609968 AGGGAGTTCAGTAAGGCTGGAGG - Intergenic
986161312 5:5231948-5231970 AGGTAGGAAAGCACAGCTGGAGG - Intronic
987137458 5:14913147-14913169 AGGCAGCTCAGCCTGGCTGGAGG - Intergenic
987150476 5:15034538-15034560 TGTGAGGTCAGCAGGGCTGGAGG + Intergenic
987271331 5:16312521-16312543 AGGGAGGAGAAAATAGCTGGTGG + Intergenic
987284376 5:16441230-16441252 AGGGAGGACACCATAACTAGGGG - Intergenic
988558588 5:32260163-32260185 AGGGAGGTCAGTATGGCCAGAGG + Intronic
988699297 5:33657332-33657354 AGGGAGGAGATCCAGGCTGGTGG + Intronic
989257024 5:39376943-39376965 AGAGAGGAGTGCATGGATGGGGG + Exonic
990317853 5:54601065-54601087 AGGGAGGACGGGAGGGATGGAGG - Intergenic
990639142 5:57762177-57762199 AGGGAGGACCTGAAGGCTGGGGG + Intergenic
991776614 5:70091361-70091383 GAGGAGAACAGGATGGCTGGTGG - Intergenic
991855901 5:70966808-70966830 GAGGAGAACAGGATGGCTGGTGG - Intergenic
991869916 5:71099581-71099603 GAGGAGAACAGGATGGCTGGTGG - Intergenic
992033385 5:72746761-72746783 AGGTGGGACAGGATGGCTAGAGG - Intergenic
992484549 5:77181709-77181731 CGGGAGGTCAGGGTGGCTGGGGG + Intergenic
994052685 5:95380597-95380619 AAGGGGGCCACCATGGCTGGAGG + Intergenic
994094757 5:95838877-95838899 GGGGAGGACAGCATGGAAGAGGG + Intergenic
994210769 5:97085412-97085434 AGGCAGGACAGCAGTGCTGGGGG + Intergenic
994246979 5:97489256-97489278 AGGGAAGCCAGCAGGGCTGAGGG - Intergenic
995502481 5:112822964-112822986 AGGAAGGAAAGCATGGCCAGAGG - Intronic
996106505 5:119510813-119510835 TGGGAAGACAGCATGGCAGAGGG - Intronic
996924571 5:128809328-128809350 ACGTGGGACAGGATGGCTGGAGG + Intronic
997713203 5:136023350-136023372 GGGGAGCAGAGCAAGGCTGGGGG + Intergenic
998378934 5:141710260-141710282 AGAGGGGGCAGCATGGGTGGAGG + Intergenic
999275757 5:150329019-150329041 AGGGAGGTCAGTGTGGCAGGCGG - Intronic
999300940 5:150489991-150490013 GGCGAGAACAGCATGGCTGAAGG + Intronic
999311283 5:150553738-150553760 GGGGAGGAGAGCCTGGCCGGGGG + Exonic
1000066372 5:157696016-157696038 AGAGAGGAAAGCATTGCTTGAGG - Intergenic
1000641851 5:163712268-163712290 AGGGAGGCCAGTGTGGCTAGAGG + Intergenic
1001807463 5:174600053-174600075 AGAAAGAACAGGATGGCTGGAGG + Intergenic
1001854510 5:174999387-174999409 AGGAAGAACAGCCTGGGTGGTGG - Intergenic
1001953107 5:175829921-175829943 AGGGAGGACCTGGTGGCTGGTGG - Intronic
1002201758 5:177532710-177532732 AGGGCGGTCAGGATGGCAGGTGG - Intronic
1002399399 5:178983194-178983216 GGGGATGATAGCATGGCTGGGGG - Exonic
1002443473 5:179276021-179276043 AAGGAGGTCAGCAGGGCTGTGGG + Intronic
1002447154 5:179296601-179296623 AGGAAGGACCGCAAGGCAGGTGG + Intronic
1002641533 5:180632900-180632922 AGGGAGGGCTGCATGGCCAGAGG + Intronic
1002867144 6:1131509-1131531 GGGAAGGACAGCTGGGCTGGAGG - Intergenic
1002991254 6:2241105-2241127 TAGGAGGACAGCATGGTTTGGGG + Intronic
1003183190 6:3809304-3809326 AAGCTGTACAGCATGGCTGGAGG + Intergenic
1003242711 6:4358589-4358611 GGGGAGGCCAGCCTGGCTGTAGG - Intergenic
1004251749 6:14028642-14028664 GGTGAGGACAGCATTCCTGGGGG + Intergenic
1004620084 6:17324252-17324274 AGGGAGGACAGCCTGAATGATGG + Intergenic
1005714272 6:28532102-28532124 ATGGAGGACAGAAGGGATGGAGG + Intronic
1005954795 6:30656363-30656385 TCGGGGGACAGCATGGGTGGAGG - Intronic
1006101582 6:31689172-31689194 TGGGATGAGAGCATGGGTGGTGG - Intronic
1006366424 6:33618858-33618880 TGGGAGGACAGCAAGACTTGAGG + Intergenic
1006852096 6:37106034-37106056 AAGGATGACAGCATGGGTAGAGG + Intergenic
1006929222 6:37677797-37677819 AGGAAGGACAGCATTTCTGGGGG + Intronic
1007640571 6:43335951-43335973 AGTGAGGAAAGCATGGTTGCGGG + Intronic
1007712714 6:43834892-43834914 AGGGAGGGCTGCCTGGCTGCTGG - Intergenic
1007765692 6:44158607-44158629 AGTGAGGACAGCCAGGCTGGTGG + Intergenic
1009566208 6:65313999-65314021 AGCAAGGTCAGCAAGGCTGGAGG - Intronic
1009617139 6:66024257-66024279 AGGTAGGCCAGAAGGGCTGGAGG + Intergenic
1009989411 6:70823367-70823389 AGGTGAGACAGGATGGCTGGAGG + Intronic
1010194465 6:73225398-73225420 TGGGAGCACAGCATGGCCGTGGG - Exonic
1010300231 6:74251658-74251680 AGTGGGGACAGAATGGCTGCAGG - Intergenic
1010661892 6:78581107-78581129 AGAGGGGACTGCAAGGCTGGAGG + Intergenic
1011015160 6:82746391-82746413 CGGGAGGAGGGCCTGGCTGGTGG - Intergenic
1011641244 6:89418218-89418240 AGGGAGGAAAGCAGGGAGGGAGG + Intergenic
1011903539 6:92332119-92332141 AGGGAGAACATCATGGATAGGGG + Intergenic
1012300726 6:97584733-97584755 AGGGAGGACAAGATGGAGGGAGG - Intergenic
1012910866 6:105116387-105116409 AGGGAGGACAGGGCAGCTGGAGG - Intronic
1012942033 6:105425666-105425688 AGGGTGGAGGGCATGGATGGAGG + Intergenic
1013274924 6:108574982-108575004 GGGGAGGACTGTGTGGCTGGAGG + Intronic
1014190806 6:118494564-118494586 AGGCGGGACAGGATGGCAGGAGG - Intronic
1014743763 6:125175630-125175652 AGAGAGGACAATATGCCTGGAGG + Intronic
1015356893 6:132287900-132287922 AGTGAAGACAGGAAGGCTGGAGG - Intergenic
1015573593 6:134647460-134647482 AGGAAGAACAGAATGGATGGTGG + Intergenic
1015984116 6:138868850-138868872 AAAGAGGACAGCATGGCTATAGG + Intronic
1016172922 6:141041759-141041781 AGGCAGGCCAGCAGTGCTGGGGG + Intergenic
1016385528 6:143527354-143527376 AGGGAGGTGAGTATGGCTGGAGG - Intergenic
1016441984 6:144094137-144094159 AAAGAGGCAAGCATGGCTGGAGG - Intergenic
1016723049 6:147324731-147324753 GGGGAGGACAGCAGGGGTGAAGG - Intronic
1017464489 6:154681791-154681813 AGGGAGCATAGCATGATTGGTGG - Intergenic
1017646351 6:156543067-156543089 TGGGAAGACAGCCTGGCTGGAGG - Intergenic
1017669529 6:156756697-156756719 AGGGAGGACAGAAGGGAGGGAGG + Intergenic
1017676495 6:156819902-156819924 GTGGAGGCCAGCATGGTTGGAGG + Intronic
1018333595 6:162760612-162760634 ACGGAGGTCAGTGTGGCTGGAGG + Intronic
1018638781 6:165887997-165888019 AAGGAGGCCAGCATGACTGAAGG - Intronic
1018677772 6:166237258-166237280 AAGGAGGAAAGCAGGGTTGGAGG + Intergenic
1018943732 6:168329654-168329676 AGAGAGCACAGCATGGAGGGAGG - Intergenic
1019183783 6:170209207-170209229 AGGGAGTAAAGCAGGGCAGGAGG - Intergenic
1019588283 7:1816308-1816330 AGGGAAGCCCCCATGGCTGGAGG - Intronic
1019707564 7:2503803-2503825 ATGGAGGAAGGCAGGGCTGGGGG - Intergenic
1020787875 7:12592270-12592292 AGGGAGGACAGCTTGACTGATGG + Intronic
1021331768 7:19346953-19346975 AGATGGGACAGGATGGCTGGAGG + Intergenic
1021607236 7:22420357-22420379 AGGGAGAACACCATGGATTGAGG - Intronic
1022098160 7:27153660-27153682 GGGGAGGTGAGTATGGCTGGAGG - Intergenic
1022374665 7:29802403-29802425 AAGCAGGGCAACATGGCTGGAGG + Intergenic
1022510911 7:30934308-30934330 AGAGAGGCCAGCAGGGATGGCGG - Intergenic
1023196372 7:37643997-37644019 ATGCAGGTGAGCATGGCTGGTGG - Intergenic
1023259474 7:38344395-38344417 AGGGAGGAAAGGATGGATGGAGG + Intergenic
1023259932 7:38348720-38348742 AGGGAGGAAAGGATGGATGGAGG + Intergenic
1023260915 7:38357879-38357901 AGGGAGGAAAGGATGGATGGAGG + Intergenic
1023835839 7:44066669-44066691 AGGTAGGCCAGCAGGGATGGAGG - Intronic
1023876032 7:44286828-44286850 AAGGAGGAAGGCATGGCTGGGGG + Intronic
1024281387 7:47722330-47722352 AGTGAGGACAGCATGGCCGGAGG - Intronic
1024526393 7:50353500-50353522 AAGGGTGACAGCATGGCAGGAGG - Intronic
1024675864 7:51637567-51637589 AGGGAGGAGACCAGGCCTGGGGG + Intergenic
1026870447 7:73847859-73847881 AGGGAGGGGAGAATGGCTTGTGG + Intergenic
1027138126 7:75638986-75639008 AGGGAGGGCGCCAGGGCTGGGGG + Intronic
1029893838 7:103960245-103960267 AGGATGGACAGTATGTCTGGAGG - Intronic
1031159207 7:118145720-118145742 AGGCAGCTCAGCCTGGCTGGAGG + Intergenic
1032315694 7:130836519-130836541 AGTGAGGACAGCATGGATTGGGG - Intergenic
1032695125 7:134329198-134329220 AAGGGGCTCAGCATGGCTGGAGG - Intergenic
1032833030 7:135648002-135648024 AGGGAGGACAGGAGGGTAGGTGG - Intronic
1033216269 7:139495768-139495790 AGGGTAGATAGCAGGGCTGGAGG + Intergenic
1034162279 7:149002402-149002424 AGGGAGGGCACGATGGTTGGGGG + Intergenic
1034313999 7:150112826-150112848 GGGGAAGACAGCATGCCAGGAGG - Intergenic
1034574777 7:151987597-151987619 AGTGAGGAGAGCAAGACTGGGGG + Intronic
1034584204 7:152074853-152074875 AGGTATGACAGGAAGGCTGGAGG + Intronic
1034605102 7:152305436-152305458 AATGAGGTCAGCATGGCTGAAGG + Intronic
1034792900 7:153987966-153987988 GGGGAAGACAGCATGCCAGGAGG + Intronic
1034872256 7:154695118-154695140 AGGGAAGACTACAGGGCTGGCGG + Intronic
1034879392 7:154751819-154751841 TGGGAGGGCTGCATGGCCGGTGG + Intronic
1035023578 7:155812660-155812682 AGGGAGGAGCGCATGTCTTGTGG + Intergenic
1035314298 7:157988634-157988656 AGGGAGCACAGGGGGGCTGGAGG + Intronic
1036279349 8:7386350-7386372 AGGGAGGAAAGCAGGGAGGGAGG - Intergenic
1036342165 8:7925522-7925544 AGGGAGGAAAGCAGGGAGGGAGG + Intergenic
1036566253 8:9940785-9940807 AGAGAGGTCTGCATGACTGGAGG - Intergenic
1036824639 8:11966538-11966560 TGGGAAGACAGGATGGCTGTGGG + Intergenic
1037017404 8:13925625-13925647 AGGTAAGACAGGATGGCTAGAGG + Intergenic
1037262395 8:17023433-17023455 AAGGAAGACAGCATGGAAGGTGG + Intergenic
1037578494 8:20230479-20230501 AGGGTGGTCAGCATGGCAGCTGG + Intergenic
1038914011 8:32000033-32000055 ATGGATGTCAGCATGGCTAGAGG + Intronic
1040003693 8:42600254-42600276 AGGCAGGCCAGCAGTGCTGGGGG + Intergenic
1040440649 8:47438110-47438132 AGGCAGCTGAGCATGGCTGGGGG + Intronic
1040480222 8:47818953-47818975 AGGGAGGGCAGGAAGGCTGCGGG - Intronic
1041095510 8:54344971-54344993 AGGGAGGCCAGCTTGCCTGGTGG + Intergenic
1041114389 8:54520530-54520552 GGGGTGCACAGCATGCCTGGAGG - Intergenic
1041381607 8:57258872-57258894 AGGGAGGACCGCAGGGCCAGAGG + Intergenic
1042520351 8:69704920-69704942 AGGGAGAACAGCTTGGAGGGAGG + Intronic
1042748593 8:72133996-72134018 AGGGAGGACAGCCTGATTGATGG + Intergenic
1042898269 8:73694795-73694817 AGGGAGGAGAGCACGGCTATTGG + Intronic
1043414678 8:80034420-80034442 AGCAAGGGAAGCATGGCTGGGGG - Intronic
1044108423 8:88240353-88240375 AGAGAGGATAGCATGAGTGGTGG + Intronic
1044371187 8:91412842-91412864 AAGGACCACAGCATGGCTTGGGG + Intergenic
1046260314 8:111758943-111758965 AGGTAGGCCAGCAGTGCTGGGGG + Intergenic
1046949438 8:120005735-120005757 AGTGAGCACAGGATGGATGGGGG + Intronic
1047096774 8:121634426-121634448 AGGGGAGAGAGCATGGCAGGGGG - Intronic
1047338638 8:123958839-123958861 AGGGAGGAGAGCAGTGCAGGGGG + Intronic
1048529420 8:135234098-135234120 AGGGAGGGAGACATGGCTGGAGG - Intergenic
1048586026 8:135775065-135775087 AGGGGACACAGCATGCCTGGAGG + Intergenic
1048817131 8:138344364-138344386 AGTGAGGCCACCATGGCTGCTGG - Intronic
1048878008 8:138851962-138851984 AGAGAGGACAGCATAGCAGGTGG + Intronic
1049145788 8:141000712-141000734 GGGGAAGACAGAAAGGCTGGGGG - Intronic
1049193477 8:141302380-141302402 AGGGAGGGCAGCGGGGATGGGGG - Intronic
1049292345 8:141811063-141811085 AGGGAGGGCAGAGGGGCTGGAGG + Intergenic
1050160918 9:2718013-2718035 AGCGTGGACAGCAGGGCCGGAGG - Exonic
1050741583 9:8826468-8826490 AGGGAGGCCAGCAGGGCTGGAGG - Intronic
1052771635 9:32695759-32695781 GGAGAGGACCGCATGGCTGCAGG + Intergenic
1052790146 9:32867961-32867983 AGAGATGGCAGCATGGGTGGAGG + Intergenic
1053434023 9:38063418-38063440 AGGCTGGAGAGGATGGCTGGGGG - Intronic
1053435947 9:38074558-38074580 AGAGAGGACAGCATAACAGGAGG - Intergenic
1055449171 9:76415411-76415433 AGGTGGGACAGGATGGCTAGTGG + Intergenic
1056667978 9:88597168-88597190 AGGGAGGAAGGAAAGGCTGGAGG - Intergenic
1056959113 9:91106100-91106122 AGGGATGAAGGCATGCCTGGAGG + Intergenic
1057691247 9:97288532-97288554 AGGGAGCAAGGCAGGGCTGGTGG - Intergenic
1058225891 9:102362915-102362937 AGGGAGGACAGCTTTGCTTATGG + Intergenic
1058752017 9:108048615-108048637 GGGGAGGACAGCCCAGCTGGAGG + Intergenic
1058939350 9:109798944-109798966 ACGGAGGGCAGCAGGGCAGGTGG - Intronic
1060549699 9:124479114-124479136 AGGGTGGACCCCAAGGCTGGCGG + Intergenic
1061247625 9:129409064-129409086 TGAGAGGACAGCGAGGCTGGGGG - Intergenic
1061573695 9:131493128-131493150 AGGGAGGGCAGCAAGGCAGAGGG - Intronic
1061626999 9:131846618-131846640 AGTGTGGACATGATGGCTGGTGG - Intergenic
1061826350 9:133260680-133260702 AGTCAGGACAGTATGGCAGGTGG + Intronic
1061896725 9:133652164-133652186 AGGGAGGACACAGTGGCCGGGGG + Intronic
1062002229 9:134222115-134222137 GGAGGGGACAGCATAGCTGGAGG + Intergenic
1062041308 9:134405489-134405511 AGGCAGGACAGAATGGCAGACGG - Intronic
1185557770 X:1034863-1034885 AGGCAGGTCTGCATGGCTAGCGG + Intergenic
1186417517 X:9396574-9396596 TGGAAGGACATCAGGGCTGGTGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1186731506 X:12415372-12415394 GGGGAGGAGAGGATGGATGGAGG - Intronic
1187204110 X:17165747-17165769 AGGGAGGAGAGGTTGGGTGGTGG + Intergenic
1187375220 X:18746635-18746657 AGAGATGACAGCATGGGTGGAGG + Intronic
1188322138 X:28752733-28752755 ACAGAGGAGAGCATGGCAGGTGG + Intronic
1188659347 X:32739237-32739259 AGGGAGGACAGCATAGGTTCTGG - Intronic
1189355885 X:40309669-40309691 TGGGAAGACTCCATGGCTGGGGG - Intergenic
1190222406 X:48520855-48520877 AGGGAGCACAGCATGGATAAAGG + Intergenic
1190496818 X:51034244-51034266 AGGGCTGACAGCAGGGCTGGTGG + Intergenic
1190509151 X:51159693-51159715 AGGGCTGACAGCAGGGCTGGTGG - Intergenic
1191095678 X:56670913-56670935 AGAGAAGACAGGATGGCAGGAGG + Intergenic
1191601966 X:63018296-63018318 AAGGTGGGCAGCAAGGCTGGGGG + Intergenic
1191778800 X:64845663-64845685 AGGGAGGACAGCCTGGTTGATGG - Intergenic
1192249442 X:69399140-69399162 AGGGAGGCCAGGATGCCTGTGGG - Intergenic
1192441534 X:71178248-71178270 AGAGAGGACAGCATTCCAGGTGG + Intergenic
1192632645 X:72789266-72789288 AGGGAGGAAGGGATGGATGGGGG + Intronic
1192649064 X:72931535-72931557 AGGGAGGAAGGGATGGATGGGGG - Intronic
1192896553 X:75448319-75448341 AGGGAGTACAGAATGGATGGTGG + Intronic
1194205067 X:91002692-91002714 AGGGAGGGCATGAAGGCTGGGGG - Intergenic
1194467967 X:94256179-94256201 GGGGAGGGCAGCATTGCTGCAGG - Intergenic
1194573011 X:95575648-95575670 AGGTGGGACAGGATGTCTGGAGG + Intergenic
1195658789 X:107358677-107358699 AGGGAGGACTGGAAGACTGGAGG + Intergenic
1196892619 X:120305857-120305879 GGGGAAGACAGGATGGATGGTGG - Intronic
1197149955 X:123209090-123209112 TGGGAAGACAGCAAGGGTGGAGG + Intronic
1197635442 X:128909876-128909898 ATAGAGGACAGCATTGCTGTAGG + Intergenic
1197768015 X:130071511-130071533 AGGCAGGTCACCAGGGCTGGAGG + Intronic
1198835909 X:140804811-140804833 AAGGAGGACAGTTTGGCTGGAGG + Intergenic
1199699362 X:150364545-150364567 CGGGAGCACAGCGTGGCTGGGGG + Intronic
1199883494 X:151995687-151995709 AGGGAGGACAGCCTGGCTGATGG - Intergenic
1200278679 X:154758186-154758208 AGGGGTGACAGGATGGCTGGAGG - Intergenic
1200550895 Y:4577835-4577857 AGGGAGGGCATGAAGGCTGGGGG - Intergenic
1201458953 Y:14201436-14201458 AGGAAGGAAAGGAGGGCTGGAGG + Intergenic