ID: 1102574142

View in Genome Browser
Species Human (GRCh38)
Location 12:113845215-113845237
Sequence CAGAGTCACCAGGGCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 363}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102574142_1102574148 1 Left 1102574142 12:113845215-113845237 CCTTCACTGCCCTGGTGACTCTG 0: 1
1: 0
2: 4
3: 31
4: 363
Right 1102574148 12:113845239-113845261 CCCCCACGCTGCTCTTGAAGGGG 0: 1
1: 0
2: 3
3: 4
4: 142
1102574142_1102574145 -1 Left 1102574142 12:113845215-113845237 CCTTCACTGCCCTGGTGACTCTG 0: 1
1: 0
2: 4
3: 31
4: 363
Right 1102574145 12:113845237-113845259 GTCCCCCACGCTGCTCTTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 112
1102574142_1102574146 0 Left 1102574142 12:113845215-113845237 CCTTCACTGCCCTGGTGACTCTG 0: 1
1: 0
2: 4
3: 31
4: 363
Right 1102574146 12:113845238-113845260 TCCCCCACGCTGCTCTTGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102574142 Original CRISPR CAGAGTCACCAGGGCAGTGA AGG (reversed) Intronic
900648885 1:3721434-3721456 CAGAGTCACCAGGGCTGCTGAGG + Intronic
901204285 1:7485018-7485040 CAGAGTCACCAGGGCAGGCATGG - Intronic
901430720 1:9212810-9212832 CAGAGCCACCATAGCAGTCAGGG - Intergenic
902573026 1:17359151-17359173 CAGTGTCAGGAAGGCAGTGAAGG - Intronic
903384653 1:22918448-22918470 TAGGGTGACCAGGGCAGGGATGG - Intergenic
903435227 1:23344202-23344224 GAGACTCACCAGGGCAGAGCGGG + Exonic
904003832 1:27353132-27353154 CAAAGGTCCCAGGGCAGTGAGGG + Intronic
904366694 1:30015585-30015607 CAGAGTCACCTGGGAAGAGAAGG + Intergenic
904921414 1:34011084-34011106 CACAGTGACCAAGGCTGTGAAGG - Intronic
905001086 1:34670713-34670735 CAGTTTCACCAGGGAAGTAAAGG - Intergenic
906660013 1:47575266-47575288 CTGAGTGACCTGGGCAGAGAAGG + Intergenic
907294341 1:53439793-53439815 CAAAGTCACCAGGGTGGTGAAGG - Intergenic
907501286 1:54883435-54883457 CACAGCCACCAGGGGAGAGATGG - Intronic
907718839 1:56952712-56952734 CAAGGTCACCTGGGCAGTAAGGG - Intronic
909712890 1:78672759-78672781 CAGAGGCACAGGTGCAGTGATGG - Intergenic
910432738 1:87175087-87175109 AAGAGTCACTTGAGCAGTGAAGG + Intergenic
910475254 1:87598915-87598937 CTGAGACACCAGGGCAGTGCTGG + Intergenic
912508225 1:110171193-110171215 CCCAGTCACCAGGGCCCTGATGG - Intronic
915748260 1:158181672-158181694 CAGCTTCACCAGGGACGTGAAGG + Exonic
916487529 1:165272723-165272745 CAGAGTACCCAGAGCAGTCAGGG + Intronic
916584284 1:166136732-166136754 CAGAGTCACCGGCCCAGTTAGGG - Intronic
917228637 1:172812289-172812311 AAGACTCACCAGGGCAGAAAAGG + Intergenic
920380561 1:205532386-205532408 CAGAGCCACAAGGGCTGGGAAGG - Intronic
920514500 1:206574716-206574738 CAGACCCACCACAGCAGTGAAGG - Intronic
921329663 1:214022938-214022960 CAGAGTCACCAGGGTAGAAGGGG - Intronic
921562700 1:216677364-216677386 AAGAGCCACCAGGGCTGTGGTGG + Exonic
923462900 1:234222566-234222588 CAGACTCACCAAGGCGGTGCTGG - Intronic
923575718 1:235157272-235157294 CAGACTGACCAGAGCAGGGAAGG + Intronic
1062956794 10:1545753-1545775 CAGAGGCAGAAGCGCAGTGAGGG + Intronic
1062995238 10:1859292-1859314 AAAAGTCTCCACGGCAGTGAAGG - Intergenic
1063052601 10:2468895-2468917 CAGAGTCCCAGGGGCAGTGAGGG - Intergenic
1063167895 10:3480390-3480412 CAGAGTCACATGGCCAATGAGGG - Intergenic
1063411684 10:5841080-5841102 CCGCGTCACCAGGGCAGTCGTGG - Intronic
1064290409 10:14028799-14028821 CAGGGACATCAGGGCAGTGATGG + Intronic
1064592841 10:16912593-16912615 CAGAGACCCCAGTGAAGTGAGGG + Intronic
1065590305 10:27256569-27256591 TGGAGTGCCCAGGGCAGTGAGGG + Intergenic
1065840862 10:29699839-29699861 CAGTGTCCTCAGGGCATTGATGG + Intronic
1067693648 10:48520238-48520260 CACAGTCATCAGGGCCTTGAGGG + Intronic
1068171858 10:53404387-53404409 CAGAGGCACAGGTGCAGTGATGG + Intergenic
1068663535 10:59648209-59648231 CAGGGTCATCAGAGCAGAGAGGG - Intergenic
1069745589 10:70713016-70713038 GAGAGTGCCCAGGGCAGTGGCGG + Intronic
1069832003 10:71287311-71287333 CAGGGTCACCCTGGGAGTGATGG - Intronic
1071305200 10:84293530-84293552 CAGGGACAACAGGGCAGAGAAGG - Intergenic
1072001639 10:91201030-91201052 CTGAGACACCAGGGAGGTGATGG + Intronic
1074450982 10:113559552-113559574 CAGAGTCGCCTGGGCACTGGAGG + Intronic
1074970465 10:118532382-118532404 CAGAGGCATGAGGGCAGGGATGG + Intergenic
1075445279 10:122508781-122508803 CGGAGTCCCCAGGGCTGTGTGGG - Intronic
1075834738 10:125443955-125443977 AAGAGACACCAGGGCAGCAATGG - Intergenic
1076795292 10:132795240-132795262 CAGTGTCTCCAGGGCAGGGCTGG + Intergenic
1078374894 11:10785546-10785568 CAGAGTCACCGTGGCTGGGAAGG + Intergenic
1079111473 11:17607626-17607648 CCCAGCCGCCAGGGCAGTGAGGG + Intronic
1082003951 11:47409578-47409600 CAATGTCCCCAGGGCACTGAGGG - Intronic
1083514380 11:63243047-63243069 CAGAGAAAGCAGGGGAGTGAGGG + Intronic
1083654068 11:64220582-64220604 CAGAGGCATCAGGGCCGTGGGGG - Exonic
1083990338 11:66242718-66242740 CAAAGTCACCAGCCCAGTGCTGG + Intronic
1084362504 11:68677898-68677920 CACAGAGCCCAGGGCAGTGAAGG + Intergenic
1084464217 11:69312944-69312966 CACAGTGACCAGGGCACAGAAGG - Intronic
1084670333 11:70603128-70603150 CAGAGCCAGTAGGGCTGTGAGGG - Intronic
1085588005 11:77729679-77729701 CAGAGTCACAAAGTCTGTGATGG - Intronic
1086767611 11:90717710-90717732 CAGAGTTTCCAGGGCAAGGATGG + Intergenic
1088901274 11:114119505-114119527 CAGTTTCACCAGGACAGTGCTGG - Intronic
1089155661 11:116400304-116400326 CACAGTCAGCAGGGCACTGCAGG + Intergenic
1090416343 11:126543199-126543221 CAGAGAGACTAGGGCAGTAATGG - Intronic
1090534389 11:127624865-127624887 CACCTTCACCAGGGCAGTGGAGG + Intergenic
1091362328 11:134987467-134987489 GAGGGTCACCAGGGCTGTGAGGG - Intergenic
1091692309 12:2605526-2605548 CAAAGTCACATGGGAAGTGATGG - Intronic
1092923946 12:13257166-13257188 CAGGGGCCCCGGGGCAGTGAAGG - Intergenic
1093806909 12:23445654-23445676 AATAGTCACCTGGACAGTGAGGG + Intergenic
1094068980 12:26391974-26391996 CCCAGGCACCAGGGCAGTGGAGG + Intronic
1094081085 12:26536687-26536709 CAGATACACCAGGCCAGTGTTGG + Intronic
1095038617 12:37419974-37419996 CAGGGCTACCAGGGCAGTGGAGG - Intergenic
1096589952 12:52651549-52651571 CAGAGTCACCTTGTCAATGAAGG + Exonic
1096994356 12:55829641-55829663 CGGGGTCACCAGGGAAGAGACGG + Intronic
1098979709 12:76943046-76943068 CAGAGTGTCCAGAGCACTGAGGG - Intergenic
1099182403 12:79483542-79483564 CAGAGGCACCTGGGCACAGAGGG + Intergenic
1100160913 12:91859635-91859657 CAGAGTCCCAATGGCAGTAAGGG + Intergenic
1100284779 12:93154873-93154895 CTGAGTCACGAAGGCAATGAAGG - Intergenic
1100397669 12:94199020-94199042 CAGAGTAAACAGGGCTGTGAAGG + Intronic
1100889678 12:99110997-99111019 CAGTGTGATAAGGGCAGTGATGG - Intronic
1101692306 12:107093528-107093550 CAGAGTCACCCGGGCAGCCTCGG - Exonic
1101837308 12:108304474-108304496 CAGAGAGACCAGGGCAGAAAAGG - Intronic
1102567443 12:113805814-113805836 CAGACTCTACAGTGCAGTGAGGG + Intergenic
1102574142 12:113845215-113845237 CAGAGTCACCAGGGCAGTGAAGG - Intronic
1102718926 12:114999700-114999722 CAGGGTCAGCAGGGTGGTGAGGG - Intergenic
1104955985 12:132466066-132466088 CAGAGGCCCCAGGGGAGGGAGGG - Intergenic
1104963780 12:132500103-132500125 CAGAGTCTAGAGGGCAGTGCCGG - Intronic
1106102835 13:26709325-26709347 CAGAGTCGCCAGGGCAGCCTCGG - Intergenic
1106252597 13:27994132-27994154 CTCAGTCACCCGGCCAGTGAAGG - Intergenic
1106604951 13:31220122-31220144 CAGAATCTCTAGGGCAGTGGTGG + Intronic
1108503829 13:51091544-51091566 CAGAGTCACCCTGACACTGATGG - Intergenic
1108980634 13:56508357-56508379 CAAAGTCACCCAGGCAGTGAGGG - Intergenic
1112673249 13:101666276-101666298 GAGAATCACCAGGGCAGAAAAGG - Intronic
1113355479 13:109576071-109576093 AGGAGGGACCAGGGCAGTGATGG - Intergenic
1113672074 13:112182368-112182390 CAGACTGCCCAGGGCTGTGAGGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1114663528 14:24366110-24366132 CAGAGTCATCAGGGGAATGAGGG + Intronic
1116438303 14:44920243-44920265 CAGAGTAACCAGATAAGTGATGG + Intergenic
1117334502 14:54745351-54745373 CAGAGTCAAGAGGGCATTCAGGG - Intronic
1117656910 14:57964752-57964774 CACAGGCACCATGGCAGTGAAGG + Intronic
1118001566 14:61527891-61527913 CAGAGTCTCCCAGGCAGAGAAGG - Intronic
1118279651 14:64417047-64417069 CAGAGTCCTCAGGGCAGTCAAGG - Intronic
1118455800 14:65945028-65945050 AAGAGATACCAGCGCAGTGATGG + Intergenic
1122120799 14:99552435-99552457 CAGAGTCAGCAGGTCTGTGCTGG + Intronic
1122626519 14:103087954-103087976 CCCAGTCCCCAGGGCAGGGATGG - Intergenic
1127044085 15:55007767-55007789 CAGAGTCACATGGTTAGTGAAGG + Intergenic
1127258548 15:57310927-57310949 CAGAGAAGCCATGGCAGTGAGGG - Intergenic
1127579731 15:60327441-60327463 CAACGTCACAGGGGCAGTGATGG - Intergenic
1128861500 15:71077909-71077931 CTCATTAACCAGGGCAGTGAGGG - Intergenic
1129692851 15:77723649-77723671 CAGGCTCAGCAGGGCAGGGAGGG + Intronic
1130383592 15:83392658-83392680 CAGAGTCACCAGGTCAAGGCAGG + Intergenic
1131109801 15:89758248-89758270 CAGAGACCCCAGGGGAGGGAGGG - Intergenic
1132636438 16:952128-952150 CAGTGTCACCAGGGCAGGGCAGG - Intronic
1132756248 16:1486865-1486887 CAGAGACTCCCTGGCAGTGAGGG - Intronic
1135958368 16:26975529-26975551 CAGAGACAAAAGGGAAGTGAAGG - Intergenic
1136000922 16:27292026-27292048 CAGTGTCAGCAGGGTACTGAAGG + Intergenic
1136355938 16:29744860-29744882 CAGGGCCCACAGGGCAGTGAGGG + Exonic
1136543125 16:30939848-30939870 CAGAGTCATGAGGGCAGGGAGGG + Intronic
1137769481 16:51004573-51004595 CAGCCTCACGAGGGCAGTGCAGG - Intergenic
1138124234 16:54425735-54425757 AAGCCTCACCCGGGCAGTGATGG - Intergenic
1138339684 16:56280567-56280589 CAGAGTGGACAGGGCAGGGAGGG + Intronic
1138452585 16:57102498-57102520 CAGAGAGACCATGGTAGTGACGG - Intronic
1138551823 16:57752690-57752712 CAGAGGGCCCAGGGCAGGGAGGG - Intronic
1139544528 16:67644078-67644100 CAGTGTCTCCAGGGCTGAGAGGG - Intergenic
1139545560 16:67648110-67648132 CACAGTGTCCAGGGCAGTGTCGG - Exonic
1139968330 16:70757997-70758019 CAGTGTCACCTGGGTAGAGAAGG + Intronic
1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG + Intronic
1141614343 16:85202173-85202195 CAGGGTTGCCTGGGCAGTGAGGG + Intergenic
1141615674 16:85208128-85208150 CAAAGTCACCAGGCCATTCAAGG - Intergenic
1141781962 16:86168514-86168536 GGGAGACACCAGGACAGTGATGG - Intergenic
1142197228 16:88744519-88744541 CAGAGACCCCTGGGCAGGGAGGG + Intronic
1142979517 17:3663569-3663591 CAGAGGCCCCAGGCCAGGGATGG + Exonic
1143322452 17:6076912-6076934 CACAGCTAGCAGGGCAGTGATGG - Intronic
1143691696 17:8572677-8572699 CAGAGTCACCATGGTAATGGTGG + Intronic
1143807878 17:9444367-9444389 AAGATTCACTAGGGCAGAGAGGG - Intronic
1144634724 17:16897756-16897778 CAGGACCACCAGGGAAGTGATGG - Intergenic
1144955992 17:19019164-19019186 CAGAGACCCCAGGGCAGGGAAGG + Intronic
1145924118 17:28633185-28633207 GTGAGTGACCAGGGCACTGAGGG - Intronic
1146164722 17:30578593-30578615 CAGGACCACCAGGGAAGTGATGG - Intergenic
1147745191 17:42690596-42690618 CAGAGTGCCCAGGGCAGAGGTGG + Intronic
1148115616 17:45172919-45172941 GAGACTCCCCAGGGCAGAGAGGG - Intergenic
1148907310 17:50919656-50919678 CAAAGTCACCTGGCCAGTCAGGG + Intergenic
1149317708 17:55454074-55454096 CAGTGTCAGCTGGGCAGCGATGG + Intergenic
1149454465 17:56776801-56776823 CCGAGTGAGCAGGGCAGTGCTGG - Intergenic
1149662234 17:58340110-58340132 CAGAGTCTACAGAGGAGTGAAGG - Intergenic
1152279944 17:79379296-79379318 CTGAGTCCCCAGGGCAGGCAAGG - Intronic
1152431093 17:80248621-80248643 CAGAGCCTCCATGGCAGGGAAGG - Exonic
1152760253 17:82103814-82103836 CACAGTCCCCGGGGCAGGGAGGG + Intronic
1153761965 18:8340096-8340118 CACAGTGACCAGGCCAGGGAGGG + Intronic
1153763263 18:8351905-8351927 CAGGTTCACCAGGGCAGCCAGGG - Intronic
1154002438 18:10493895-10493917 CAAGGTCTCCAGGCCAGTGAGGG + Intergenic
1154493155 18:14936593-14936615 GAGGGACACCAGGGCTGTGAGGG + Intergenic
1156139932 18:34095604-34095626 CAGAGTCACATGTGGAGTGAGGG + Intronic
1156361566 18:36388623-36388645 CAGGGTCTCCTGGGCAGGGATGG + Intronic
1157581004 18:48774130-48774152 CAGAGTAACCCAGGCACTGATGG - Intronic
1158933856 18:62346861-62346883 CAGTGTCACAAAGGCAGTCAGGG - Intronic
1160066781 18:75583095-75583117 CAGGCCCACCAGGGCAGTGCCGG + Intergenic
1160126943 18:76184064-76184086 AAGACTCACCAGGACAGAGAAGG + Intergenic
1160369179 18:78357111-78357133 CAGAATCTGCAGGTCAGTGAAGG + Intergenic
1160403483 18:78628678-78628700 CAGGGTCACCAGGCCTGAGATGG - Intergenic
1160847085 19:1171425-1171447 CAGAGTCCCCAGGGCAGCGCTGG + Intronic
1161422483 19:4183518-4183540 CAGAGGGCACAGGGCAGTGAGGG + Intronic
1162034011 19:7929565-7929587 CACAGAAACCAGGGCAGTGCTGG - Intronic
1162265742 19:9572496-9572518 CAGAGTTTCCAGGGCTGGGATGG - Intronic
1162385320 19:10357501-10357523 CAGAGTGACCAGGGCAGCGATGG - Intronic
1163497606 19:17655815-17655837 CAGGGTCAGCAGGGCTATGATGG - Intronic
1163999246 19:21082235-21082257 CAGAGGACACAGGGCAGTGAAGG - Exonic
1164701042 19:30284514-30284536 CTGAGTCACCTGGTGAGTGATGG - Intronic
1165396874 19:35569304-35569326 CAGAGTGGTCAGGGCTGTGATGG - Intergenic
1165431730 19:35776775-35776797 CAGAGTGATCAGAGCTGTGAAGG + Intronic
1165893815 19:39130038-39130060 CAGAGAGGCCAGGGCTGTGAAGG + Intronic
1166101223 19:40572485-40572507 CAGAGTTATCAGGGCTGTAATGG + Intronic
1166200139 19:41232098-41232120 CAGAGTGGCCAGGGCTGGGATGG - Intronic
1166610897 19:44195284-44195306 GAGATTCACCAGAGCAGAGAAGG + Intergenic
1166664348 19:44669830-44669852 CAGAGTGATCAGGGCTGGGATGG - Intronic
1168713700 19:58515439-58515461 CAGAGGCCCCAGGGTAGTGCTGG - Intronic
1202698905 1_KI270712v1_random:148046-148068 CAGAGTGTCCAGAGCAATGAGGG + Intergenic
925346640 2:3176475-3176497 GAGGGTCCCCAGGGCAGTGGTGG + Intergenic
926192808 2:10741411-10741433 CTGAGTCACCAGGGGAGGCAGGG + Intronic
926678222 2:15644552-15644574 AAGAGTCACAAGTGCAGTGATGG + Intergenic
929795599 2:45056085-45056107 CAGAGTCACAAGGGTAGGGTGGG - Intergenic
929845960 2:45527750-45527772 CACAGTCACCATGGTAGTAAAGG + Intronic
929893908 2:45941518-45941540 CAGAGAAAGCAGGGCCGTGAAGG + Intronic
929993919 2:46813115-46813137 CAGAGTCACCCAGCTAGTGAGGG + Intergenic
930842987 2:55868443-55868465 CAGAGACACTGGGGCAGTGTGGG + Intronic
932741614 2:74295196-74295218 GAGACTCAGGAGGGCAGTGATGG + Intronic
932888066 2:75564943-75564965 CTGAGTCACCAGCTGAGTGAAGG + Intronic
933708280 2:85307374-85307396 CAGAGTCTGAAGGGCAGTGGAGG + Intronic
934684880 2:96313678-96313700 CACAGTCACCAGTGCATGGAGGG - Intergenic
934714298 2:96534699-96534721 GAGAGACACCAGGACACTGAGGG + Intergenic
936145546 2:109978361-109978383 CAGATTCACCTGGGAAGGGAAGG + Intergenic
936199140 2:110393117-110393139 CAGATTCACCTGGGAAGGGAAGG - Intergenic
936890210 2:117360357-117360379 CAGAGTCACAGTTGCAGTGATGG + Intergenic
938787026 2:134639186-134639208 CAGAATCAACACGGGAGTGAAGG + Intronic
938797650 2:134731730-134731752 CAGACTCACTAGTTCAGTGATGG + Intergenic
939409825 2:141810297-141810319 CTGAATCATCAGGGCAGTCAGGG + Exonic
939688992 2:145234578-145234600 CAGGGTCAGCAGGGAAGTGAAGG + Intergenic
939871885 2:147535025-147535047 CAAGGTCACCCAGGCAGTGATGG - Intergenic
940854054 2:158716112-158716134 CAAAGCCTCCAGGGAAGTGAGGG + Intergenic
941006116 2:160248818-160248840 CAGGCTCACCAGGGCAGAGAGGG + Intronic
941525618 2:166603180-166603202 CTGAGTCAACAGGCCAGTAAGGG - Intergenic
943918029 2:193663205-193663227 CAGAGCCAGAAGAGCAGTGAAGG + Intergenic
944879567 2:203998381-203998403 CAGAATCAACAGCCCAGTGAAGG - Intergenic
945151860 2:206800181-206800203 TAGAGCCAACATGGCAGTGAGGG - Intergenic
945362305 2:208906690-208906712 AAGGGTCACCAGGGAAGTGGGGG - Intergenic
946054442 2:216888531-216888553 CAGGGTCAACATGGCAGTTAAGG + Intergenic
946863121 2:224018932-224018954 TAGAGTCACTGGGGCAGTGCAGG - Intronic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
948333215 2:237187573-237187595 CAGAGTCACAAGAGCACTGATGG - Intergenic
948813952 2:240500166-240500188 GAGAGTCACCCCAGCAGTGAGGG - Intronic
948899712 2:240950156-240950178 CAGGGTCAGCAGAGCAGGGAGGG - Intronic
948981637 2:241497707-241497729 CAGGGTGAGCAGGGCAGTGCAGG + Intronic
1168952188 20:1810163-1810185 CTGAGTGAGAAGGGCAGTGATGG - Intergenic
1170794004 20:19530904-19530926 CAGAGTCACCTGACCAGTGCAGG + Intronic
1170816752 20:19720615-19720637 CAGTGTCCCCAGGGGAGTGGGGG + Intronic
1173145709 20:40522346-40522368 CATATTCACCATGGCAGGGATGG - Intergenic
1173582437 20:44157129-44157151 CAGAGTCACCACTACAGTGTCGG - Intronic
1174349993 20:49960285-49960307 AAGACTCACCAGGGCAGAAAAGG - Intergenic
1175025110 20:55893767-55893789 CAGAGTAAAGAGGGCAGTGTGGG - Intergenic
1175149515 20:56922114-56922136 AGGAGTCAGCAAGGCAGTGAAGG - Intergenic
1175287198 20:57844829-57844851 CTGAGTTCTCAGGGCAGTGAGGG + Intergenic
1175442641 20:59002223-59002245 CCCAGCCACCTGGGCAGTGAGGG - Intronic
1175659185 20:60797583-60797605 CCGAGTCAGCAGGGCAGAGCAGG - Intergenic
1175928141 20:62480826-62480848 CAGAGACCCCAGGGCAGGGAAGG + Intergenic
1176259138 20:64170031-64170053 AAGAGACACGAGGGCAGTGAGGG - Intronic
1176385299 21:6136052-6136074 CAGAGCCCCCTGGGCAGTGACGG + Intergenic
1177997207 21:28115969-28115991 CAGAGACACCAGCACAGGGAGGG + Intergenic
1179255520 21:39712242-39712264 CAGAAGCTCCAGGGCAGTGCGGG + Intergenic
1179738174 21:43402200-43402222 CAGAGCCCCCTGGGCAGTGACGG - Intergenic
1181339617 22:22167124-22167146 CACTGACACCAGGGCAGGGAGGG - Intergenic
1182609365 22:31533732-31533754 AAGAGCTACCAAGGCAGTGAAGG - Intronic
1183750170 22:39715592-39715614 CAGCGTCACTGGGGCAGGGATGG - Intergenic
1183992634 22:41608586-41608608 CAGAGTGAAGGGGGCAGTGATGG + Intronic
1184092268 22:42299027-42299049 GAGAATAACCATGGCAGTGATGG + Intronic
1184559684 22:45254869-45254891 CAGAATCAGCAGGGCTGTTATGG - Intergenic
950250291 3:11459591-11459613 CAGAGCCAACAGGGAAGTAATGG + Intronic
952933549 3:38377829-38377851 CAGAGTCACAAGGTCATAGATGG + Intronic
954395959 3:50293437-50293459 CAATGTGACCAGGGCAGCGATGG - Exonic
954982437 3:54758698-54758720 GAGATTTAGCAGGGCAGTGAAGG - Intronic
955113822 3:55976387-55976409 GTGAGTCATCAAGGCAGTGATGG - Intronic
956578247 3:70780112-70780134 CAGAGTCACAAGGCTAGGGAAGG + Intergenic
956726239 3:72158731-72158753 CAGAGTCCTCAGAGCATTGAGGG + Intergenic
959302375 3:104619349-104619371 GAGAGTCACCAGGGCAGTGTAGG - Intergenic
959476651 3:106820916-106820938 CCGAGTCAGCAGGGCAGGGCAGG + Intergenic
959965281 3:112347103-112347125 CAGAGGCACTAGGGCAGTTTTGG - Intronic
960534563 3:118802313-118802335 CAGAGTAATCAGGGCTGGGAGGG + Intergenic
961176853 3:124842795-124842817 CAGACTCACCAGGGCAGGTCTGG + Intronic
965003802 3:162990189-162990211 CCGAGGCATCAGGGCAGAGATGG + Intergenic
965004273 3:162998346-162998368 AAGATTCACCAGGGCAGAAAGGG + Intergenic
965169916 3:165249888-165249910 AAGACTCACCAGGGCAGAAAAGG + Intergenic
966930549 3:184672878-184672900 TAGGGTGACAAGGGCAGTGATGG + Intronic
967246374 3:187491224-187491246 ATGGGTCACCAGGGAAGTGAGGG - Intergenic
968004186 3:195228245-195228267 CAGTGTAAACAGGGCAGTCAGGG - Intronic
968448021 4:662254-662276 CAGAATCACCAGGGTTGTGCAGG + Intronic
968456120 4:700894-700916 CAGAGTCCACAGGGCAGGGACGG - Intergenic
968581476 4:1397309-1397331 CTCAGTCACCAGGGAAGAGATGG + Intergenic
968616128 4:1578724-1578746 CACCGTCACCAGGGAAGGGAGGG + Intergenic
968771939 4:2512967-2512989 CAGAGTCAGGAGGCCAGGGACGG + Intronic
968816676 4:2825039-2825061 CAGAGCAGGCAGGGCAGTGAAGG + Intronic
969623572 4:8291236-8291258 CAAAGCCACCAGGACTGTGAAGG - Intronic
970423391 4:15925727-15925749 GAGAGTCCGCAAGGCAGTGACGG - Intergenic
975235731 4:71993816-71993838 AAGACTCACCAGGGCAGAAAAGG - Intergenic
977390727 4:96406926-96406948 CACAGTCAGCAGGGAAGTGTGGG - Intergenic
978316206 4:107440265-107440287 TAGAGTTACCATGGCTGTGATGG - Intergenic
978493026 4:109329137-109329159 CATAGACACCAGGGATGTGAGGG + Intergenic
979121998 4:116914877-116914899 GAGATTCACCAGGACAGTAAAGG - Intergenic
979812799 4:125060676-125060698 CAGTCTTACCAGGGCAGGGAAGG - Intergenic
981911602 4:149987776-149987798 CAAAGTCACAAGGACAGAGAAGG + Intergenic
983917840 4:173311616-173311638 CAGAGTCACAAGGACAGTGTGGG + Intronic
985799246 5:1992961-1992983 CAGAGTCATGGGAGCAGTGATGG + Intergenic
986163339 5:5250924-5250946 CAGAGTCCTCGGGGCAGTCAGGG + Intronic
986360341 5:6971877-6971899 CAGACCCACCAGGACAGAGATGG - Intergenic
986477038 5:8145062-8145084 GACAGTCACTAGGGCAGAGATGG - Intergenic
986539543 5:8829149-8829171 CAGAGGCACAAGTGCAGTGCTGG + Intergenic
987319958 5:16759297-16759319 CACTGTCACCAGGACAGTCAGGG + Intronic
988213702 5:28243866-28243888 TAGAGTCTCCAGGGGGGTGATGG - Intergenic
997106413 5:131024243-131024265 CAGAACCACCAGGGCAGTCTTGG - Intergenic
997429595 5:133828217-133828239 CAAAGACACCAGGGCTGGGAAGG + Intergenic
997782776 5:136676632-136676654 AAAAGTCCCCATGGCAGTGATGG + Intergenic
998359703 5:141574073-141574095 CAGAGTCACCAGGTAAAGGAGGG + Exonic
998485479 5:142498256-142498278 CAGTGAGACCAAGGCAGTGAGGG + Intergenic
999112540 5:149134520-149134542 CTGAGTCACCAGGTCAGTTATGG + Intergenic
999119206 5:149196025-149196047 CAGAGGCCCCAGAGAAGTGAGGG + Intronic
999179484 5:149659051-149659073 CTGAGTGACCAGGTCAGCGATGG - Intergenic
999475743 5:151897242-151897264 CAGATTCACCAGGGTGGAGAGGG - Intronic
1000345639 5:160311829-160311851 GAGAGTGACAAGGGCAGGGAGGG + Intronic
1001929753 5:175664536-175664558 CTGAGACCCCAGGGCAGTGGGGG + Intronic
1002454354 5:179337840-179337862 CAGAGTCAGCTGGGAGGTGAAGG - Intronic
1002454376 5:179337939-179337961 CAGAGTCAGCTGGGAGGTGAAGG - Intronic
1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG + Intergenic
1002863247 6:1097940-1097962 AAGCGTCCCCAGTGCAGTGATGG - Intergenic
1003182198 6:3801522-3801544 CAGAATGACCAGGGCAGAGAGGG + Intergenic
1004164249 6:13241677-13241699 CAGACTCACCAGGAGAGGGAAGG - Intronic
1004613644 6:17269212-17269234 CAGAGTCACTGGGGGGGTGATGG - Intergenic
1005583509 6:27254501-27254523 CACAGTGATCAGGGCTGTGATGG - Intronic
1005793536 6:29332393-29332415 AAGATTCACCAAGGAAGTGAGGG + Intergenic
1005829225 6:29657228-29657250 CAGAGGCAGCTGGGCAGAGAGGG - Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006334885 6:33415268-33415290 CAGAGTTACCAGGGCAGCAGCGG + Exonic
1006374183 6:33662788-33662810 CAGAGTCAAAAGGCCAGAGAGGG + Intronic
1006390498 6:33755380-33755402 CAGTGTCCCCAAGGCAGTGCCGG + Intergenic
1006729458 6:36225351-36225373 CAGACTCACCAAGGCAGGGTAGG - Exonic
1007359004 6:41342071-41342093 CACAGGCACCAGGGCAATGGGGG - Exonic
1008600559 6:53089798-53089820 AAGATTCACCAGGGCAGAAAAGG + Intronic
1009307041 6:62103361-62103383 CAAAGTCCAGAGGGCAGTGAGGG + Intronic
1009973621 6:70650879-70650901 CAGTGTCAGTAGGGCATTGAAGG - Intergenic
1011511060 6:88101351-88101373 TAGAGTCCCCATGGCGGTGATGG + Intergenic
1011814811 6:91176569-91176591 CATAGCCACCAGGGCAAGGATGG + Intergenic
1012247275 6:96939656-96939678 CAGAGAGCCAAGGGCAGTGAAGG + Intronic
1016307304 6:142697480-142697502 CTGACTCAGGAGGGCAGTGATGG - Intergenic
1016838578 6:148504225-148504247 ATGAGCCATCAGGGCAGTGATGG + Intronic
1017022666 6:150152775-150152797 GAGAGTCACCAGGGCTGCAAAGG - Intronic
1017758790 6:157552326-157552348 CAGAGTCGGCAGGGCAGGGCAGG + Intronic
1019127080 6:169847820-169847842 GAGATTCACCAGAGGAGTGATGG + Intergenic
1019488606 7:1300785-1300807 CAGAGGCACAGAGGCAGTGATGG + Intergenic
1019557530 7:1640133-1640155 CAGGGTCTCCAGTGCAGTGGTGG + Intergenic
1020654177 7:10910044-10910066 CTAAGTCACCAGGGCTGTGCTGG + Intergenic
1021378066 7:19933162-19933184 CAGACTCAGCAGAGCTGTGATGG + Intergenic
1021613345 7:22478694-22478716 CAGAGTCATCACTGCAGTAATGG + Intronic
1021754857 7:23842239-23842261 CAGAGTCACAAGTACAGTGCTGG - Intergenic
1022564321 7:31382322-31382344 CTGCTTCACCAGGCCAGTGAAGG - Intergenic
1024310498 7:47964844-47964866 CTGAGTAACCAAGGCAGTGGCGG + Exonic
1027421755 7:78023678-78023700 CAGTTTCACCAGGGTAGTGGTGG - Intronic
1028017703 7:85736121-85736143 CAGAGTCACAAGTGTAGTGCTGG + Intergenic
1029577475 7:101412884-101412906 CCGTGTCACCAGGGCAATGGGGG + Intronic
1030472688 7:109986629-109986651 TAGAGTCACATGGGCAGTTAGGG - Intergenic
1032487766 7:132300823-132300845 CAGGGTCCCCAGGGGAGTGCTGG + Intronic
1032692419 7:134302068-134302090 CACAGACACCAGGGCAATGGAGG + Exonic
1032723987 7:134574457-134574479 CAGAGTCAGAAAGGCAGAGAAGG - Intronic
1032901276 7:136311402-136311424 CTTAGTGACCAGGGCAATGAAGG - Intergenic
1033445538 7:141418552-141418574 AAGGGTCACCATGGAAGTGAAGG - Intronic
1034206461 7:149320074-149320096 GAGATTCACCAGGGCAGAAAAGG - Intergenic
1034571330 7:151958804-151958826 GAGAGTCAGCAAGGCAGAGAAGG + Intronic
1034824730 7:154251389-154251411 CAGAGTCAACAAGGCTGTGCAGG + Intronic
1035037381 7:155904037-155904059 CAGGGACACCAGGGGAGGGATGG + Intergenic
1035559675 8:594951-594973 CAGGGGCAGCTGGGCAGTGAGGG + Intergenic
1035683582 8:1507407-1507429 CAGCGCCAGCGGGGCAGTGAAGG - Intronic
1036656109 8:10678522-10678544 CAGGGTCACTGGGGCAGTGCAGG - Intronic
1037808818 8:22073857-22073879 CAGAGTCACCTGGCCAGAGATGG + Intronic
1038455811 8:27671239-27671261 CAGGGTCACCAGGCCAGCGGGGG + Exonic
1039719890 8:40151884-40151906 CAGAGTGAGCAGGGCAGAGTGGG - Intergenic
1041337244 8:56800254-56800276 CAGAGTCAGCCAGGCAGAGAGGG + Intergenic
1041394738 8:57378915-57378937 CCAGGTCACCAGGCCAGTGAGGG + Intergenic
1042626539 8:70764222-70764244 CAGAGTAAAGAGGGCAGAGAAGG - Intronic
1042663739 8:71183403-71183425 CAAAGTCACAAAGGCAGTAAAGG - Intergenic
1043448337 8:80341023-80341045 CAGAGTAACCAGAGATGTGAAGG + Intergenic
1044107523 8:88229640-88229662 CAGAGGCACCCAGTCAGTGAAGG + Intronic
1044625529 8:94232621-94232643 CAGAATTCCCAGAGCAGTGAGGG + Intergenic
1047256835 8:123220202-123220224 TACAGTCACCAAGGCAGTCAGGG + Exonic
1048525939 8:135202482-135202504 CAGTCTCATGAGGGCAGTGATGG + Intergenic
1048636255 8:136299200-136299222 AAGAGTCTCCACAGCAGTGAAGG - Intergenic
1049072656 8:140368727-140368749 GAGAGTCAGGCGGGCAGTGAAGG - Intronic
1049462494 8:142736578-142736600 CAGAGTCACCAAGGCAAAGTTGG + Exonic
1049463352 8:142740064-142740086 GGGAGTAACCAGGGCAGTGGCGG - Intergenic
1049507601 8:143011926-143011948 CAGGGTCACCAGGGCAGCCCAGG - Intergenic
1049787968 8:144460216-144460238 CAGAGCCCCCAGGCCAGGGAGGG + Intronic
1050526320 9:6549680-6549702 CAAAGTCACCCTGGAAGTGATGG - Intronic
1050745761 9:8874218-8874240 CAGAGTCACCATGCAAGTTATGG - Intronic
1051196245 9:14565356-14565378 CAGAATCACCAGGGAAATAAAGG + Intergenic
1051281919 9:15449837-15449859 CTGAGCCACCAGGCCAGTCAGGG + Intronic
1051613356 9:18982541-18982563 CAGAGTCACCATGGCAGAAGGGG + Intronic
1052941312 9:34133687-34133709 CTGCGTCACCCGGGAAGTGATGG - Intergenic
1052963920 9:34324482-34324504 CTGAATCACCAGAGCAGTGGTGG - Intronic
1053196332 9:36121908-36121930 CAGAGGCACCAGGGCAGGGGAGG + Intronic
1054823078 9:69543308-69543330 CAGAGCCACAAGTGCAGTGCAGG - Intronic
1056395384 9:86176648-86176670 CAGAGGCTCAAGGGCAGTCAGGG + Intergenic
1058951778 9:109910724-109910746 CAGATGCAGCAGGGCGGTGAGGG + Intronic
1059347944 9:113645064-113645086 CTGAGTCTCCAGGGCAGGAAAGG + Intergenic
1059374468 9:113871555-113871577 CAGGATCACCCGGGTAGTGAGGG + Intergenic
1059833996 9:118129451-118129473 CAGAGGCACAGGGGCAGTGCTGG + Intergenic
1060086293 9:120705772-120705794 TAAAGTTACCAGGGCAGTCAGGG + Intronic
1060643145 9:125256088-125256110 AAGAGTCTCCAGGCAAGTGAGGG + Intergenic
1060919084 9:127407719-127407741 CAGGGTGTCCTGGGCAGTGATGG - Exonic
1061209045 9:129180196-129180218 GACAGGCACCAGGGAAGTGAAGG - Intergenic
1061219477 9:129241973-129241995 CAGACTCACCAGGGAAGGGGAGG + Intergenic
1061651652 9:132055075-132055097 CAGCGCTTCCAGGGCAGTGAGGG - Intronic
1061740240 9:132698328-132698350 AAGACTCACCAGGGCAGAAAAGG - Intergenic
1061904570 9:133690101-133690123 CTGAGTCACCAGTGCAGTCTAGG - Intronic
1062172131 9:135140669-135140691 CAGAGAAGCCAGGGCAGAGAAGG - Intergenic
1062197317 9:135281509-135281531 CAGGGACACCAGGTCAGGGAGGG - Intergenic
1062282818 9:135759572-135759594 CTCAGTCTCCTGGGCAGTGAGGG + Intronic
1062460285 9:136660060-136660082 CAGAGCGGCCAGGGCAGGGAAGG + Intronic
1187008998 X:15260858-15260880 CAGATTTTCCAGGGCACTGATGG - Intronic
1187520679 X:20011273-20011295 CAGATTGAGCAGGGCTGTGATGG + Intronic
1189066287 X:37812708-37812730 CAGAATCCTCAGGGCACTGAGGG + Exonic
1189226389 X:39416744-39416766 CAGAGTCTCCTGGGGATTGACGG + Intergenic
1191035680 X:56024489-56024511 CACAGACACCAAGGTAGTGAAGG + Intergenic
1193224144 X:78961672-78961694 CACAGTCAACAGGGGTGTGATGG + Exonic
1195244873 X:102986539-102986561 CAGAGCCACCATGGAAGGGAGGG - Intergenic
1196785696 X:119419758-119419780 CTGAGTCACTGGGGCAATGATGG - Intronic
1198327301 X:135586549-135586571 GAGAGCCACCAGGGCAGTGGTGG - Intergenic
1199101768 X:143809702-143809724 TAGAGACACCAGGACAGTGTTGG - Intergenic
1199241738 X:145554945-145554967 CAAAGTCACAGGTGCAGTGATGG + Intergenic
1199583217 X:149381802-149381824 CAGCTTCATAAGGGCAGTGAGGG + Intergenic
1199803022 X:151270210-151270232 CAGAGTCACCATGGCTGTGATGG - Intergenic
1200215085 X:154364739-154364761 CTGAGGCTCCAGGGCACTGAGGG - Intronic
1201680066 Y:16636079-16636101 CACAGACACCAAGGGAGTGAAGG + Intergenic
1201770648 Y:17614354-17614376 CAGAAAGACCAGGGCAGAGAGGG - Intergenic
1201830907 Y:18291632-18291654 CAGAAAGACCAGGGCAGAGAGGG + Intergenic
1201957206 Y:19638550-19638572 CAGAGGCACAAGTGCAGTGCGGG - Intergenic