ID: 1102574581

View in Genome Browser
Species Human (GRCh38)
Location 12:113848230-113848252
Sequence CAGGCTAAAGAGTGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102574577_1102574581 -9 Left 1102574577 12:113848216-113848238 CCACTTTTCATTATCAGGCTAAA 0: 1
1: 0
2: 2
3: 22
4: 225
Right 1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG 0: 1
1: 0
2: 0
3: 32
4: 398
1102574576_1102574581 -6 Left 1102574576 12:113848213-113848235 CCTCCACTTTTCATTATCAGGCT 0: 1
1: 0
2: 1
3: 13
4: 223
Right 1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG 0: 1
1: 0
2: 0
3: 32
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102574581 Original CRISPR CAGGCTAAAGAGTGGGGAGA AGG Intronic
900293952 1:1939348-1939370 CAGAAGAAAGAGCGGGGAGAGGG + Intronic
900751043 1:4397708-4397730 GAGGGAAAAGAGTGAGGAGAGGG - Intergenic
900968453 1:5975894-5975916 CAGCCCAGAGAGTAGGGAGATGG + Intronic
901189658 1:7401869-7401891 CAGCCTAGAGGGTGGGGAGTGGG - Intronic
901756673 1:11445339-11445361 CAGGCTAGTGGGTGGAGAGAAGG + Intergenic
902205800 1:14867225-14867247 AAGGCAAAAGAGGAGGGAGAGGG - Intronic
902208995 1:14891305-14891327 CAGGGTAAAGGGTGGGAAGGGGG - Intronic
902730381 1:18365076-18365098 AAGGGAAAAGAGTGGGGTGAGGG + Intronic
902875938 1:19340856-19340878 CAGTGGAAAGAGTGGGTAGAGGG + Intronic
903459461 1:23510240-23510262 CAGGCTAAGGAGAGAGAAGAAGG - Intronic
903535952 1:24066498-24066520 CAGGCTGAAGAGTGCTAAGAAGG + Intronic
903619665 1:24688824-24688846 CAGGATAAAAGGTGGGGAGGAGG - Intergenic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905303931 1:37004826-37004848 CGGTCTCAAGAGTGGGAAGAGGG - Intronic
905510954 1:38519737-38519759 CAGGCTGAAGGGAGAGGAGAAGG + Intergenic
905693471 1:39958909-39958931 CAGGCAGAAGGGTGAGGAGAAGG + Intronic
906074314 1:43041007-43041029 CCAACTACAGAGTGGGGAGATGG - Intergenic
906324252 1:44834442-44834464 CTGGCAAAAGAGTGGGGAGTAGG - Intronic
907038148 1:51235027-51235049 CACGCTAAGGACTGGGGAAAAGG - Intergenic
909038970 1:70627897-70627919 CAGGCAAACAAGTGGAGAGATGG - Intergenic
909882950 1:80903396-80903418 CTGGCTAATGAGTAGGTAGAAGG - Intergenic
910460203 1:87441028-87441050 CAGACTAAAGATGGGTGAGAAGG - Intergenic
910610318 1:89134224-89134246 CCAGCAAAACAGTGGGGAGAGGG - Intronic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913076432 1:115344204-115344226 CAGGTGAAGGAGTAGGGAGAAGG - Intergenic
914317439 1:146527296-146527318 CAGACTAAAGATGGGTGAGAAGG - Intergenic
914496917 1:148206064-148206086 CAGACTAAAGATGGGTGAGAAGG + Intergenic
915308963 1:154997672-154997694 CAGTGTAAAGACTGAGGAGAGGG + Intergenic
915632150 1:157160991-157161013 CAGGCTCAGGACTGGGGACAGGG - Intergenic
915675231 1:157523725-157523747 CAGGGCAGAGAGTGGGGAGCAGG - Intronic
915889913 1:159763772-159763794 CAGGGTAAAAGGTGGAGAGAGGG - Intergenic
916030685 1:160875251-160875273 CAGGATAGAGAATGGGGACAAGG + Intergenic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916845386 1:168644998-168645020 AAGGCCAGAGAATGGGGAGAGGG + Intergenic
916882347 1:169032173-169032195 CAGGCTACAGTGTGCTGAGATGG - Intergenic
917238164 1:172917144-172917166 CAGGCAAAGGAGAGAGGAGAAGG - Intergenic
917509162 1:175655959-175655981 CAGGCTCAAGTGTAGGGATAGGG + Intronic
917659493 1:177164016-177164038 GTGGCTAGGGAGTGGGGAGAAGG + Intronic
918048834 1:180956940-180956962 AAGGCTGAGGAGTGGGGAGAGGG - Intergenic
918703596 1:187635574-187635596 TAGGCTGCGGAGTGGGGAGATGG - Intergenic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
921036941 1:211388835-211388857 CAGGGTTAAAGGTGGGGAGAGGG + Intergenic
921760145 1:218903694-218903716 CTGGCCAGAGGGTGGGGAGAGGG + Intergenic
923191378 1:231623780-231623802 CAAGATAAGGGGTGGGGAGAAGG + Intronic
924311112 1:242744107-242744129 CAGGCAACAGAGTAGGGAGATGG + Intergenic
1063872088 10:10428658-10428680 CAAGGAAAAGAGTGGGAAGAGGG - Intergenic
1064186508 10:13166698-13166720 AAGAGTAAAGAGTGGGGAGTGGG + Intronic
1064231182 10:13529856-13529878 GAGGGTAAAGAGTCGGGGGATGG + Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1070150769 10:73803528-73803550 CAGGCTAAAGGTTGGGGGGAGGG - Intronic
1070216325 10:74385478-74385500 AATGCTAAGGAATGGGGAGAAGG + Intronic
1070530723 10:77335074-77335096 CAGGCACAGGAGTGTGGAGAAGG + Intronic
1070799701 10:79238064-79238086 CAGGCTACCGAGCGGGGAGGGGG - Intronic
1071713297 10:88070804-88070826 CAACCAAAAAAGTGGGGAGAGGG - Intergenic
1071930662 10:90466087-90466109 CAGGGTAAAGGGTTGGGTGAAGG + Intergenic
1072280842 10:93863854-93863876 CAGGATAAAGAATGGGAAGAAGG - Intergenic
1072974256 10:100043962-100043984 CAGGCTGAAGAGGAAGGAGAGGG + Intronic
1073618696 10:105024651-105024673 CAGGGTAATGAGTGGGGAATGGG - Intronic
1075038320 10:119087742-119087764 CAGACTACAGAGTGGGAGGAGGG - Intergenic
1076351274 10:129816503-129816525 CAGGCTACAGGGTGCGGAGATGG - Intergenic
1076446321 10:130516629-130516651 CAGAGGACAGAGTGGGGAGAAGG + Intergenic
1077973784 11:7224412-7224434 CAGACTAAAAAGTTGGGAGGAGG + Intergenic
1078733926 11:14002509-14002531 AGGGCTGAAGACTGGGGAGATGG + Intronic
1079370756 11:19849957-19849979 CGTGCTAAAGAGTATGGAGAGGG - Intronic
1080315505 11:30943359-30943381 CAGAATAAAGAGGGGGGAAAAGG - Intronic
1080677686 11:34442773-34442795 AAGGCTCAAGAGCGTGGAGAAGG + Intronic
1080959584 11:37142745-37142767 CAGGCTGTAGAGTAGGGAGAGGG - Intergenic
1081140278 11:39489716-39489738 AATGCTATAGAGTGAGGAGAGGG - Intergenic
1081179090 11:39965760-39965782 CAGGCTTAAGAGTGGGGGGTGGG - Intergenic
1082717445 11:56632023-56632045 CAGGAAGAAGAATGGGGAGATGG + Intergenic
1083246328 11:61430476-61430498 AAGACTAAAGAACGGGGAGAAGG - Intronic
1083495943 11:63053128-63053150 CGGGCAAGAGAGAGGGGAGAAGG - Intergenic
1084156426 11:67315607-67315629 CAGGGTATAGAGTGAGGAGGAGG - Intergenic
1084167471 11:67382560-67382582 CAGGCTTATTACTGGGGAGATGG - Intronic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1086263018 11:84963419-84963441 CAGTCTATAGAGTGGGCAAATGG - Intronic
1086514384 11:87594965-87594987 CAGGGTGAAGAGTGAGGGGAGGG + Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1087966109 11:104418009-104418031 AAGGCTGAAGAATGGGGACATGG + Intergenic
1088178349 11:107080448-107080470 GAGGGTAAAGGGTGGGAAGAGGG - Intergenic
1089329244 11:117678275-117678297 CAGGCTACAGGGTGGGGTGGCGG + Intronic
1089678678 11:120107499-120107521 GAGGCAAAGGAGTGGGGAGGGGG - Intergenic
1090661104 11:128882219-128882241 CAGCCAAAAGAAGGGGGAGATGG + Intergenic
1090836159 11:130455612-130455634 CAGGCTGCAGGGTTGGGAGAGGG + Intronic
1091344050 11:134840878-134840900 GAGGCTGGAGAGTGTGGAGACGG - Intergenic
1092936970 12:13373284-13373306 GAGGCTGAAGAGTGGACAGACGG - Exonic
1094533544 12:31300349-31300371 CAGGCAAAAGAGTGGGATGGGGG + Intronic
1095961041 12:47834545-47834567 AAGGCTGAAGAGTGGGGTGGAGG + Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096789804 12:54037614-54037636 CAGGGTGGAGAGGGGGGAGAGGG - Intronic
1097018694 12:56005051-56005073 GAGGCTAATGGGTGGGGAAAGGG - Exonic
1097583486 12:61486892-61486914 GAGGGTAGAGAGTGGGGGGAGGG + Intergenic
1097617408 12:61899490-61899512 CAGGCAAGAGAGAGGAGAGAGGG + Intronic
1098519207 12:71416735-71416757 GAGGTTGAAGAGTAGGGAGAGGG + Intronic
1098596680 12:72280423-72280445 CTGGCAAAACAGTGGGGAAATGG + Intronic
1099324527 12:81197480-81197502 AGGTCTGAAGAGTGGGGAGAGGG - Intronic
1099617969 12:84963029-84963051 CATGGAAAAGTGTGGGGAGAGGG + Intergenic
1100280185 12:93111150-93111172 CAGGTTCAAGGGTGGGGAAATGG + Intergenic
1100531599 12:95466555-95466577 CAGACTAAAGAGTGTTGAGGAGG - Intergenic
1101492412 12:105221966-105221988 GAGGCTAGAGAGTGGGGTGGAGG + Intronic
1101580463 12:106037615-106037637 GAAGATAAAGAGTGGGGAGTGGG - Intergenic
1101862618 12:108495306-108495328 CAGGTCAAAGACTGGGGAGCTGG + Intergenic
1102074363 12:110048254-110048276 CAGGGGATAGAGTGGGGAGATGG - Intronic
1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG + Intronic
1102893510 12:116580349-116580371 CAGGTTAGAGTGTGGAGAGATGG - Intergenic
1103134659 12:118497376-118497398 CTGGCTGCAGTGTGGGGAGATGG - Intergenic
1103900151 12:124299501-124299523 CAGGGGAAAGGGTGGGAAGAGGG - Intronic
1104160688 12:126177336-126177358 CAGGGAAAAGGGTGGGAAGAGGG + Intergenic
1107629499 13:42328752-42328774 GTGGCTAGAGAGTGGTGAGAGGG - Intergenic
1107671658 13:42752637-42752659 CAGGCTAAAGGGTGGGAATGTGG - Intergenic
1107743126 13:43475297-43475319 CAGCCTAAGCAGTGTGGAGATGG + Intronic
1107952240 13:45474039-45474061 CAGGCTCATTTGTGGGGAGAAGG + Intronic
1108853854 13:54768964-54768986 AAGACAAAAGAGTGGGAAGAAGG - Intergenic
1109031835 13:57200168-57200190 CAGTCTAAAGAGGAGGGAGGAGG - Intergenic
1109230026 13:59745208-59745230 AAGGCAAAAGAGAAGGGAGATGG + Intronic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1112710232 13:102119323-102119345 CAGACTATATCGTGGGGAGAGGG + Intronic
1112907038 13:104435445-104435467 CAGGCTAAAGTCAGGGGAGCAGG + Intergenic
1114161118 14:20168792-20168814 GAGGATAAAGAGGAGGGAGATGG + Intergenic
1114319698 14:21536924-21536946 CCGGGTAGAGAGTTGGGAGAGGG + Exonic
1114618228 14:24079802-24079824 CAGGCTAAGGGGAGGGCAGATGG - Intergenic
1116624945 14:47252728-47252750 CTGGCAAAGGAGTGAGGAGAAGG + Intronic
1117838262 14:59830101-59830123 AGGGCTAAACAATGGGGAGAAGG - Intronic
1119199894 14:72744487-72744509 CAGGCTGGAAAGTGGGGAGCTGG - Intronic
1119424009 14:74524323-74524345 CAGTCCAGAGAGTGGGGAGTAGG - Intronic
1119426209 14:74535997-74536019 GAGGCTGAAGAGTGGAGATACGG + Exonic
1119733221 14:76964363-76964385 CAGGGTATAGAGTGAGAAGATGG + Intergenic
1120033840 14:79673123-79673145 CAGGCTGAAGAGAGGGGAAAGGG + Intronic
1120917290 14:89721250-89721272 CAGCTTAAGGAGAGGGGAGAGGG - Intergenic
1121588053 14:95077458-95077480 CAGGCTCAAGTGTGGGCAGACGG - Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121791674 14:96704079-96704101 GAGGCTGGAGAGTGGGGAGCTGG + Intergenic
1123998717 15:25736735-25736757 AAGGCTTAGGAGTGGGGGGAAGG + Intronic
1124004651 15:25786063-25786085 CAGGGAGAAGTGTGGGGAGAAGG + Intronic
1124196206 15:27632097-27632119 AAGGCACAAGATTGGGGAGAAGG - Intergenic
1125067744 15:35510629-35510651 CAAGGTGAAGAGTGGGGAGTTGG - Intronic
1126901390 15:53318237-53318259 CAGGCTAAAGGCTGGGGTGCAGG + Intergenic
1128088843 15:64905382-64905404 CAGGCTAAAGACTTGGGCCATGG - Intronic
1128520575 15:68372165-68372187 CAGACTCAAGAATGGAGAGAAGG - Intronic
1128874369 15:71190150-71190172 CAGGCTACAGAGAGATGAGAGGG - Intronic
1128927193 15:71668457-71668479 CAGGTAAAAGGGAGGGGAGAAGG + Intronic
1129165618 15:73775487-73775509 GAGGCTGAGGAGTAGGGAGAGGG + Intergenic
1129298704 15:74613508-74613530 CAGGCTGCAAAGTGTGGAGAGGG + Intronic
1129322801 15:74783936-74783958 CAGGCTACAGACTGGGGACATGG + Intronic
1129785139 15:78304760-78304782 CAGGATAACCAGTGGGCAGAGGG + Intergenic
1129987976 15:79935465-79935487 CAGGGCAACAAGTGGGGAGAAGG + Intergenic
1130991720 15:88879629-88879651 CCAGCTAACGAGTGGGGAGCTGG - Intronic
1132037172 15:98494082-98494104 CAGGCCAAAGTAAGGGGAGAAGG + Intronic
1132053024 15:98626261-98626283 CAGGCTTGGGAGTGGGGACAGGG - Intergenic
1133595888 16:7291451-7291473 CAGCCTTAATAGTTGGGAGATGG + Intronic
1135658097 16:24269121-24269143 CAGGCTAAAAGGTGGATAGATGG - Intronic
1136033913 16:27524135-27524157 CAGGCTATACAGTGGGAAGCGGG + Intronic
1136856257 16:33661066-33661088 TAGGCTGAGGAGTGGGGATAGGG - Intergenic
1137016069 16:35376682-35376704 GAGGTTAAGGAGTAGGGAGATGG + Intergenic
1137609642 16:49810032-49810054 CAGGCCAAAGAGTGGGGAAGGGG - Intronic
1138027915 16:53537273-53537295 CGTTCTAAAGAGTGGGGAAAGGG + Intergenic
1138553108 16:57757815-57757837 CAGGGCAAAGAGTGGGCAGTGGG + Intergenic
1138594403 16:58022150-58022172 CAGGGAAAGGTGTGGGGAGAGGG + Intergenic
1138939704 16:61775512-61775534 CATGATCAAGAGTGGGTAGAAGG - Intronic
1140047216 16:71448910-71448932 CAGTGTAAAGAGTGTGGAAAAGG - Exonic
1140484279 16:75281645-75281667 CAGCCTCCAGGGTGGGGAGAGGG - Intergenic
1140816426 16:78625241-78625263 GAGGCTAAAGAGTGGGGCTGGGG - Intronic
1203117842 16_KI270728v1_random:1509544-1509566 TAGGCTGAGGAGTGGGGATAGGG - Intergenic
1143047014 17:4089676-4089698 CAGGCTACAGTGTGTGGAGGAGG - Intronic
1143047023 17:4089742-4089764 CAGGCTACAGTGTGTGGAGGAGG - Intronic
1143047071 17:4090144-4090166 CAGGCTACAGTGTGTGGAGGAGG - Intronic
1143047088 17:4090277-4090299 CAGGCTACAGTGTGTGGAGGAGG - Intronic
1143047097 17:4090343-4090365 CAGGCTACAGTGTGTGGAGGAGG - Intronic
1143047105 17:4090410-4090432 CAGGCTACAGTGTGTGGAGGAGG - Intronic
1143206039 17:5139653-5139675 CAGGCTGAACACTGCGGAGAGGG + Exonic
1143476046 17:7204567-7204589 GATGGCAAAGAGTGGGGAGAGGG + Intronic
1143495486 17:7309962-7309984 GAGGCTGAAGACTGGGGAGCAGG - Intronic
1143590114 17:7880200-7880222 CAGACAGAAGAGAGGGGAGAGGG + Intronic
1145864179 17:28229407-28229429 TAAGATAATGAGTGGGGAGAGGG - Intergenic
1146296361 17:31653660-31653682 CAGGATACGGAGAGGGGAGAGGG - Intergenic
1146375136 17:32288764-32288786 CAGGAAATGGAGTGGGGAGAGGG - Intronic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1147918323 17:43901425-43901447 CAGGGAAAAGTGTGGGCAGAAGG + Intronic
1147926665 17:43950842-43950864 TAAGATAATGAGTGGGGAGAGGG + Intergenic
1148071959 17:44913874-44913896 AAGGCTGAGGAATGGGGAGAAGG - Intronic
1148219297 17:45850585-45850607 CATGCTAGAGAGTGGGGTGGGGG - Intergenic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1151945550 17:77318106-77318128 CAGACCAGGGAGTGGGGAGATGG - Intronic
1152247370 17:79192083-79192105 CAGGATCAAGAGGGAGGAGACGG - Intronic
1152260664 17:79265179-79265201 CAGGCTGAAGGGTGGTGAGAGGG - Intronic
1153170220 18:2307869-2307891 CAGGAGCAAGAGTGGGAAGAAGG - Intergenic
1153748252 18:8202494-8202516 TATGCAAAAAAGTGGGGAGAGGG + Intronic
1153861656 18:9216253-9216275 TAGGCTGAAGAGAAGGGAGAAGG - Intronic
1155944730 18:31835586-31835608 AAAGCTAGAGAGTTGGGAGATGG - Intronic
1155978632 18:32158273-32158295 CAGGCTGGAGAGTGGAGAGCGGG + Intronic
1157729505 18:49991224-49991246 CAGGCAAAAGCATGGGGAGCTGG + Intronic
1157852166 18:51065311-51065333 AAGGGTAAAGGGAGGGGAGATGG - Intronic
1158121702 18:54055734-54055756 TTGGTTAAAGGGTGGGGAGATGG + Intergenic
1158435227 18:57430641-57430663 CAGGCTTGAGAGAGGGGAAAGGG - Intergenic
1158881320 18:61782143-61782165 CATGCCAAAGTGTGGGGAGGGGG - Intergenic
1162283420 19:9718733-9718755 TAGGCTGCTGAGTGGGGAGATGG - Intergenic
1162494930 19:11018299-11018321 CAGCCTAGAGACTGAGGAGAGGG - Intronic
1165080897 19:33305455-33305477 CCGGCTGGAGAGTGGGGTGAGGG + Intergenic
1165711259 19:38012491-38012513 CAGGCCAGAGTGTGGGGTGAGGG + Intronic
1166052741 19:40270093-40270115 GAGGCTGAAGAGAGTGGAGAGGG - Intronic
1166852257 19:45766534-45766556 CAGGTTCAATAGTGGGGAGGTGG + Exonic
1166976901 19:46610101-46610123 CTAGCTAAAGGGTGGGGAGAGGG + Exonic
1167925816 19:52820438-52820460 CGATCTAAAGATTGGGGAGAAGG - Intronic
1167930002 19:52856416-52856438 CGATCTAAAGATTGGGGAGAAGG - Intronic
1167937810 19:52922208-52922230 CAATCTAAAGATTGGGGAAAAGG - Intergenic
1168287538 19:55342113-55342135 CAGGCTAAGGAGAGGGCCGAGGG - Intronic
1168581239 19:57557452-57557474 TAGGGTAATGAGTGGGGAGAGGG - Intronic
925500822 2:4502688-4502710 CAGTCAGAAGAGTGGGGAAATGG + Intergenic
925582046 2:5420689-5420711 CAGGCTCTACAGTGGGGAGCTGG + Intergenic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
927974330 2:27326671-27326693 AAGGCTAGGGAGTGGGCAGAAGG + Exonic
928196486 2:29220087-29220109 CAGGCTATAGAATGTGGATATGG + Intronic
932312884 2:70758381-70758403 CTGGATAAAAGGTGGGGAGAGGG + Intronic
932793203 2:74673566-74673588 CTGGCTGAACGGTGGGGAGAGGG + Exonic
933312806 2:80681939-80681961 CAGGGTAAAGAGAGGTGAGAAGG + Intergenic
933452954 2:82480031-82480053 CAGGCAGAAGAGTGGAGAAAAGG + Intergenic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
934675105 2:96244232-96244254 CAGGGTAAAGGGTGGGAAGGGGG + Intergenic
935182184 2:100701187-100701209 CTGGTTAATGAGTGGGGAGAGGG - Intergenic
935725211 2:106018122-106018144 CAGGGCAAGGAGTGGGGAGTGGG + Intergenic
936518194 2:113195805-113195827 CAGTCCAAAGACAGGGGAGAGGG - Intronic
937107514 2:119331651-119331673 CAGGCCACAGGGCGGGGAGAGGG - Intronic
937458916 2:122068613-122068635 CAGGTTAGAGAGTTGGAAGATGG - Intergenic
937524838 2:122755549-122755571 CAGAATAAAGAGTTCGGAGAGGG + Intergenic
939018998 2:136936665-136936687 CAGGAGAAAGGGTGGGAAGAGGG + Intronic
939190455 2:138911641-138911663 CTGGCTAAAGAGTTTAGAGATGG + Intergenic
939740319 2:145898424-145898446 CATGTTAAAGGGTGGGGAGACGG + Intergenic
940390650 2:153129106-153129128 CAGGCTAAACAGTGTCCAGAAGG - Intergenic
942528262 2:176879669-176879691 CAGCCTGAAGCGAGGGGAGAAGG - Intergenic
942617488 2:177809097-177809119 CAGGCTGAAGAGAGGGGAGTGGG + Intronic
943482493 2:188437920-188437942 GAGGGTAGAGAGTGGGAAGAGGG + Intronic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943740955 2:191408526-191408548 CAAGCAAATTAGTGGGGAGAGGG + Intronic
944886424 2:204066995-204067017 CAGGCTTCACAGTGGAGAGAAGG + Intergenic
945831694 2:214795135-214795157 CTTGCTACAGAGTGGGGACAGGG + Intronic
946012114 2:216573727-216573749 AAGGTTAAAGACTGGGCAGAGGG - Intronic
946639882 2:221772950-221772972 GAGGATAAAGGGTGGGGACAAGG + Intergenic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
1168850369 20:972548-972570 CAGGCTTAAGAGTGGAGCCATGG + Intronic
1168980302 20:1998072-1998094 CCTGCTGAAGAGTTGGGAGAAGG + Intergenic
1169093324 20:2874228-2874250 CAGCCTCAACAGTTGGGAGAGGG - Intronic
1169271849 20:4206171-4206193 CAGCTTAAACAGTGGTGAGAGGG - Intergenic
1169878772 20:10324747-10324769 CATGCTAAAGTGAGGGGAGAAGG + Intergenic
1169929641 20:10818575-10818597 CAGGCAAGAGAGTGTGCAGAGGG + Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1172173942 20:32961110-32961132 CAGGGAACAGAGTGGGGAGCGGG - Intronic
1172793314 20:37520931-37520953 CAGGCCAGGGACTGGGGAGAAGG + Intronic
1172807710 20:37624477-37624499 CGGGCTGAAAACTGGGGAGATGG - Intergenic
1173433263 20:43010200-43010222 CAGGCTGATGATTGGGGGGATGG - Intronic
1174492975 20:50915780-50915802 GAGGCTAAAAAGGGGGGTGAGGG + Intronic
1175656120 20:60772635-60772657 TAGGCTGGAGAGTGGAGAGAAGG - Intergenic
1177058791 21:16343985-16344007 CAGCATAATGAGTAGGGAGAAGG + Intergenic
1177764870 21:25446027-25446049 CAGGGTAGAGGGTGGGAAGAAGG + Intergenic
1178163764 21:29948490-29948512 CAAGAACAAGAGTGGGGAGATGG - Intergenic
1178514991 21:33239163-33239185 CCAACTAAACAGTGGGGAGAGGG - Intronic
1178977340 21:37231378-37231400 CAGGCTACAGAGGTGGGAGACGG + Intronic
1179788900 21:43744213-43744235 CAGGCTAGGGAGTGGGGGGAGGG + Intronic
1180577313 22:16790551-16790573 GAGGCTACAGAGTGGGAGGAAGG + Intronic
1180988006 22:19916982-19917004 CAGGCTTGCCAGTGGGGAGAAGG - Intronic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1183043151 22:35198381-35198403 CAGGGTGAAGAAGGGGGAGAGGG - Intergenic
1183953841 22:41367732-41367754 CAGGGTGCAGAGTGCGGAGAGGG + Intronic
1184090480 22:42290545-42290567 CAGGCCACACTGTGGGGAGAGGG - Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
949659484 3:6261485-6261507 CAGGCTAAAGAGTGCAGTGTAGG - Intergenic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
950112193 3:10426430-10426452 CAGGCTGAAGACTGGGGAGCTGG + Intronic
950625389 3:14242827-14242849 CACACTGGAGAGTGGGGAGAGGG + Intergenic
950886583 3:16367734-16367756 CAGGTTGAAGAGTGGGGTGACGG + Intronic
951518520 3:23588929-23588951 CAGTCAAAAGAGGGGAGAGATGG - Intronic
951734568 3:25850010-25850032 CAGACTCCAGAATGGGGAGATGG + Intergenic
953237644 3:41120294-41120316 GAGGCTGGGGAGTGGGGAGAAGG - Intergenic
953644591 3:44742334-44742356 CAGGCCCAGGAGTGGGGAAAGGG + Intronic
953662345 3:44900344-44900366 CAGACTCAAGAGTGGTCAGACGG - Intronic
953876550 3:46670006-46670028 CAGGGCAAAGCGTAGGGAGAGGG - Exonic
954133070 3:48569879-48569901 CAGGGGAGAGCGTGGGGAGAAGG - Exonic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
956142661 3:66161392-66161414 CAGGGTCAAGATTGGTGAGAGGG - Intronic
957311358 3:78523573-78523595 AAGGATAAAAAGTGGTGAGATGG + Intergenic
957435438 3:80168939-80168961 CAGGCAAGAGAGTGGGGGCAGGG + Intergenic
957511587 3:81195535-81195557 TAGGGTATAGAGTGAGGAGATGG + Intergenic
958454989 3:94319665-94319687 CAGGCTAAAGAGCAGTTAGAAGG + Intergenic
959519444 3:107308665-107308687 CAAGCTCCAGAGCGGGGAGAGGG - Intergenic
959734043 3:109637363-109637385 GAGGCTGAAGAGTGGGAGGAGGG - Intergenic
960329597 3:116342278-116342300 TAGTCTAAAGAGTGGGGTAATGG - Intronic
960527411 3:118725582-118725604 CAAGCTAAAAAGGGAGGAGAGGG + Intergenic
960583599 3:119301152-119301174 AGGTCTAAAGAGTGGGCAGAAGG - Intronic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
960941859 3:122940107-122940129 CAGGCTGGACTGTGGGGAGAGGG - Intronic
961384928 3:126517934-126517956 CAGGCTTCACAGTGGGGAGGGGG + Intergenic
962169241 3:133083185-133083207 CAGGCTGAGGAGTGGGGCGGCGG - Intronic
962479432 3:135785782-135785804 CAGGGGACAGAGTGGGGAGGTGG + Intergenic
964101940 3:152997380-152997402 CTGGCCAAAGAGTTTGGAGAGGG - Intergenic
965482093 3:169231316-169231338 CAGGCTAAATACTGGGGATAAGG + Intronic
967779275 3:193418558-193418580 CTGGCTAGAGAGTGGGGTGTTGG - Intronic
968640777 4:1713355-1713377 CAGCCAAAAGAGTGGGCAGTGGG + Intergenic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
969723765 4:8907446-8907468 CAGGCTCCAGAATGGGAAGATGG - Intergenic
969873403 4:10118287-10118309 AAGGCAAAGGCGTGGGGAGAGGG + Intergenic
970006261 4:11413639-11413661 CAGGGTATAGGGTGTGGAGAGGG + Intronic
970406094 4:15765796-15765818 CAGGATAAAGACTTGGGGGAAGG - Intergenic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
974901896 4:68009736-68009758 CAGGACATGGAGTGGGGAGAAGG - Intergenic
975267762 4:72391325-72391347 CAAGCTACAGAGTTGAGAGATGG + Intronic
975570851 4:75816261-75816283 TAGGTTAAAAAGTGGGGGGAGGG - Intergenic
976136612 4:81944454-81944476 CAGGCTAAAGAATGGCCACATGG + Intronic
976200133 4:82569877-82569899 CAGGGTAAAGACTGGGCAGTTGG - Intergenic
977578142 4:98696458-98696480 CAGGCTGGGGAGTGGGAAGAGGG + Intergenic
981821013 4:148887657-148887679 CAGGCTAGAGTGGGGAGAGAGGG + Intergenic
983408220 4:167359970-167359992 CTGCCTAAAGTGTGGGGAGCAGG - Intergenic
985071800 4:186172937-186172959 CAAGAGAAACAGTGGGGAGAGGG - Intergenic
987590301 5:19916493-19916515 CAGGTTAGAAAGTGTGGAGAAGG - Intronic
988355320 5:30166400-30166422 CAGGAGAAAGGGTGGGTAGAGGG - Intergenic
989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG + Intergenic
989579290 5:43017034-43017056 CAGTCTGAAAAGTGAGGAGATGG + Intergenic
989749952 5:44881432-44881454 CAGGTTAATGAGTGGTGAGCTGG - Intergenic
990879505 5:60523569-60523591 CAAGATAAAGAGTAGAGAGATGG - Intergenic
991045582 5:62219013-62219035 TAGGCTGAGGAGTGGGGATAGGG + Intergenic
992426952 5:76667681-76667703 GAGGCTGAAGAGAGGGGTGAAGG - Intronic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993948087 5:94138680-94138702 CAGGGAAAAGAGTGGGCAGGGGG - Intergenic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
997739842 5:136243892-136243914 GAGGATAAAGGGTGGGGAGGCGG - Intronic
997830555 5:137146058-137146080 CAGACTAAAGTCGGGGGAGAGGG + Intronic
998351659 5:141505837-141505859 CAGCCTAGAAAGTGGGGACAGGG + Intronic
999284398 5:150385636-150385658 CAAGTCACAGAGTGGGGAGAGGG - Intronic
1000616368 5:163432441-163432463 CAGGGTGAAGATTGGAGAGATGG - Intergenic
1001081073 5:168667905-168667927 CATGCTAATGACTGGGGTGAAGG + Intronic
1001222430 5:169913027-169913049 CTGTCTAATGAGTGTGGAGAAGG - Intronic
1001935256 5:175699091-175699113 AGGGCTGAAGTGTGGGGAGAAGG + Intergenic
1002104906 5:176875229-176875251 CAGGCTAAGGATGGGGGAGTGGG - Intronic
1002211483 5:177602051-177602073 CAGGGTAGAGACTGGAGAGATGG - Intronic
1007255879 6:40528380-40528402 CATGTTAAAGAGCTGGGAGAAGG - Intronic
1007620038 6:43206415-43206437 CAGGTAGCAGAGTGGGGAGACGG - Exonic
1008081209 6:47196129-47196151 GTGGCTAAAGAGTGGGTGGAAGG - Intergenic
1010255644 6:73754275-73754297 GAGCCTGAAGAGTGGGAAGAGGG + Intronic
1011041587 6:83035253-83035275 CAGGGTAAGGAGTGGGCAGCAGG - Intronic
1011806645 6:91079882-91079904 CAGGTGAAAGAGAGAGGAGATGG - Intergenic
1012246355 6:96930561-96930583 AAGGCAAAGGAGTGGGGAAAGGG - Intronic
1013011295 6:106122810-106122832 CTGGTTAAGGAGTGGGTAGAAGG + Intergenic
1013169126 6:107620267-107620289 CAAATTAGAGAGTGGGGAGAAGG - Intronic
1013650541 6:112190269-112190291 CAGGCTAAAGAGAGAGAAGGCGG - Intronic
1013954317 6:115822897-115822919 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1015547143 6:134372799-134372821 CAGGGTAAAAAGTGGGCTGATGG + Intergenic
1016464262 6:144310003-144310025 CAGGATAAAGTGGGTGGAGAGGG - Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018762262 6:166902790-166902812 CAGGGAGAAGAGTGTGGAGAAGG - Intronic
1020704459 7:11526696-11526718 CAGGAGAAAGAGAGGGGAAAGGG - Intronic
1022628227 7:32060296-32060318 AAGGGCACAGAGTGGGGAGAGGG - Intronic
1022633118 7:32104641-32104663 GAGGATACAGAGTGGGGAAATGG + Intronic
1022942195 7:35251754-35251776 CAAACTATAGAGTGGGGAGGGGG - Intronic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1024062227 7:45707738-45707760 TAGGCGAAACTGTGGGGAGAAGG + Intronic
1025171315 7:56759589-56759611 CAGGCTACAGAGCGGGGATGGGG - Intergenic
1025700552 7:63815898-63815920 CAGGCTACAGAGCGGGGATGGGG + Intergenic
1026524817 7:71144667-71144689 CAGGGCACAGAGTGAGGAGATGG + Intronic
1026794812 7:73359400-73359422 GAGGCTAATGAGAGGGGACACGG - Intergenic
1026806404 7:73431993-73432015 CAGCCTAGAGAGAGGTGAGAGGG + Intergenic
1028401039 7:90425710-90425732 CAGGCTAGGGATGGGGGAGAGGG + Intronic
1028465884 7:91151181-91151203 CAGCCTAAAGACTGGGGTGTGGG - Intronic
1029248225 7:99217931-99217953 AAAGCTAAAGAGTGGCGAGGTGG - Intergenic
1029295718 7:99538850-99538872 CATGTTAGAGAGTGGGGAAAAGG + Intergenic
1030785417 7:113654461-113654483 CAGCCTAAAGAGTAGGGATTGGG + Intergenic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031615402 7:123873630-123873652 TATCCTAAAGAGTGGGGTGAGGG + Intronic
1032021776 7:128410421-128410443 CACGTTAGAGAGCGGGGAGAGGG + Intergenic
1032937944 7:136755588-136755610 CAGGCTCAAGAATAAGGAGAAGG - Intergenic
1033779771 7:144654660-144654682 CAAGCTAGAAAGTGGGGGGAGGG - Intronic
1034052192 7:147995375-147995397 GAGGGAAAAGAGTGTGGAGAAGG - Intronic
1035972798 8:4270288-4270310 CAGTATAAAGACTGGGAAGAAGG - Intronic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1037429013 8:18790061-18790083 GAGGCTAGAGGGTGGGGAAAGGG + Intronic
1037898502 8:22674026-22674048 AAGGCCAAAGGGTGGGGAGTGGG - Intergenic
1038258217 8:25970517-25970539 GAGCCTGAAGAGTGGGGAGGGGG - Intronic
1039747990 8:40449210-40449232 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1039823440 8:41153904-41153926 CATGCTAAAGAGTGCACAGAGGG - Intergenic
1040482271 8:47836914-47836936 CAGCCTAAACAGTGGGATGATGG - Intronic
1040883576 8:52234959-52234981 CAGGGGAAAGGGTGGGAAGAGGG + Intronic
1041715752 8:60930624-60930646 GAGGGTAAAGGGTGGGGGGAGGG - Intergenic
1043972873 8:86552072-86552094 CAGACTAAAGAGTTTGGAGAAGG + Intronic
1044189463 8:89297660-89297682 CAGGAACAAGAGAGGGGAGAAGG + Intergenic
1045258808 8:100553286-100553308 CAGCCAAAAGACTGAGGAGAGGG + Intronic
1046092877 8:109524249-109524271 CAGGGAAAAAACTGGGGAGAGGG - Intronic
1047066959 8:121295154-121295176 CAGTTTAAGGAGTGGGGATAGGG + Intergenic
1048590340 8:135815501-135815523 CAGGCTGTGGGGTGGGGAGAGGG - Intergenic
1048710150 8:137200960-137200982 TATGCTAAAGAGAGGGGAAAAGG + Intergenic
1048952242 8:139505844-139505866 GAGGCCAAAGAATGGGGAGAAGG + Intergenic
1049213354 8:141396687-141396709 GGGGCTACAGGGTGGGGAGACGG + Intronic
1049777004 8:144411034-144411056 CAGGGCAACAAGTGGGGAGAAGG - Intronic
1049824812 8:144661864-144661886 CAAGGTGAATAGTGGGGAGAGGG - Intergenic
1051622966 9:19070886-19070908 CAGACTGCAGAGTGGGAAGAAGG + Intronic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1052789965 9:32866208-32866230 CACTCTGAAGAGTGGGGAAAAGG - Intergenic
1052878542 9:33585543-33585565 CAGCCAAAAGATTGGGGAAAAGG - Intergenic
1053440203 9:38109727-38109749 CAGGCTGAAGAGAGGGCAGCTGG + Intergenic
1053497436 9:38558666-38558688 CAGCCAAAAGATTGGGGAAAAGG + Intronic
1053525227 9:38823155-38823177 GAGGATAAGGAGTGGGGAAATGG - Intergenic
1054197457 9:62047603-62047625 GAGGATAAGGAGTGGGGAAATGG - Intergenic
1054260715 9:62862668-62862690 CAGGGTGAAGAGTGGGCAGCAGG - Intergenic
1054640953 9:67541099-67541121 GAGGATAAGGAGTGGGGAAATGG + Intergenic
1054744316 9:68839398-68839420 GAAGGTAAAGAGTGGGGAGAAGG + Intronic
1056135126 9:83623375-83623397 CAGGCTGGAGGGCGGGGAGAGGG - Intronic
1056682695 9:88732966-88732988 GAGGCTAAGCAGTGGTGAGATGG + Intergenic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1057524592 9:95787133-95787155 CAGGATAAAGAGAGTGGAGGGGG - Intergenic
1057676907 9:97143144-97143166 CAGCCAAAAGATTGGGGAAAAGG + Intergenic
1059473152 9:114522553-114522575 CAAGCAAAGGAGAGGGGAGAAGG - Intergenic
1059916873 9:119113686-119113708 GAGGGTAGAGAGTGGGGGGAGGG + Intergenic
1060207421 9:121690422-121690444 CTGGCTAAGGGGTGGGGAGTTGG - Intronic
1061930485 9:133830280-133830302 CAGGCACAGGAGTGAGGAGAAGG - Intronic
1186418151 X:9401233-9401255 CAAGCCAAAGACTGGGCAGATGG + Intergenic
1187274432 X:17805636-17805658 CAGGCCAAGGTGTGGGTAGAGGG + Intronic
1187568282 X:20474723-20474745 CAAGATAGAGAGTGGGGAGGTGG - Intergenic
1189357985 X:40326037-40326059 CAGGAGCAAGAGAGGGGAGAGGG + Intergenic
1189843109 X:45103341-45103363 CAGGAAAAAGAGTTGGGGGAAGG - Intronic
1190339513 X:49285946-49285968 CAGGCCACAGAGAGGGGAGGAGG - Exonic
1192263934 X:69525706-69525728 AAGGGTTAAGAGTGGGGTGAGGG - Intronic
1192675826 X:73195251-73195273 GAGGATAGAGAGTGGGAAGAAGG - Intergenic
1192809713 X:74537245-74537267 GAGCCTCAAGAGTGGTGAGAAGG + Intergenic
1194932890 X:99910063-99910085 CAGACTATAGAGATGGGAGAAGG - Intergenic
1196196193 X:112840709-112840731 GAGGCGAAAGAGAGCGGAGATGG + Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1197180308 X:123528474-123528496 GAGGCTAGAGGGTGGGGAAAAGG - Intergenic
1197838273 X:130718323-130718345 CAGGCTACAGAGCAGGGTGACGG + Intronic
1197902779 X:131392147-131392169 CAGGAAAGAGAGTGGGGAGGGGG - Intronic
1198406410 X:136316959-136316981 GAGGCTAATGGGTGGGCAGATGG - Intronic
1199991970 X:152992590-152992612 CCTGGCAAAGAGTGGGGAGAGGG - Intronic
1201512892 Y:14784983-14785005 CAGGGCAGAGGGTGGGGAGAGGG + Intronic