ID: 1102574861

View in Genome Browser
Species Human (GRCh38)
Location 12:113849926-113849948
Sequence CTGGGAGACTGGAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 785
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 719}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102574850_1102574861 23 Left 1102574850 12:113849880-113849902 CCTTGGCCTCTGGTTTCTACTGA 0: 1
1: 0
2: 2
3: 24
4: 250
Right 1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG 0: 1
1: 0
2: 4
3: 61
4: 719
1102574849_1102574861 24 Left 1102574849 12:113849879-113849901 CCCTTGGCCTCTGGTTTCTACTG 0: 1
1: 0
2: 4
3: 23
4: 304
Right 1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG 0: 1
1: 0
2: 4
3: 61
4: 719
1102574852_1102574861 17 Left 1102574852 12:113849886-113849908 CCTCTGGTTTCTACTGAGGTGAA 0: 1
1: 0
2: 2
3: 12
4: 160
Right 1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG 0: 1
1: 0
2: 4
3: 61
4: 719

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102574861 Original CRISPR CTGGGAGACTGGAGGAAAGA GGG Intronic
900167257 1:1248694-1248716 CTGGGAGGCTGGAGCAAGGGAGG + Intergenic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
901469045 1:9442986-9443008 CAGGGAGACAGGAGGAAAGCAGG + Intergenic
901802915 1:11719561-11719583 CTGGGCGAGTGGAGGCAAGGGGG - Intronic
901852630 1:12025681-12025703 CCGCGAGGCTGGAAGAAAGACGG - Intronic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
903629155 1:24753447-24753469 CTAGGAGACATGGGGAAAGATGG + Intronic
903759052 1:25685030-25685052 CTAAGAGACTGGATGAAAGGAGG + Intronic
903862433 1:26372852-26372874 CTGGGAGACGAGAGCAAGGAAGG + Intronic
904208288 1:28869187-28869209 CTGGGAGCCGGGAGGAGTGACGG + Intergenic
904311547 1:29632685-29632707 CTGGGAGGCTGGGGGACTGAGGG - Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904801951 1:33099283-33099305 CTGGGTACCTGGAGGAAGGAGGG - Intronic
904826730 1:33277971-33277993 CTGGGAAAATGCAGGAGAGAAGG - Intronic
904890283 1:33774421-33774443 CAGGGAATCTGAAGGAAAGAAGG + Intronic
905031044 1:34884924-34884946 CTGGGAGACAGGAGGAGAGAGGG - Intronic
905341296 1:37279691-37279713 GTGGGAGACTGGAGGATGGAAGG - Intergenic
905446356 1:38030598-38030620 GAGGGGGACTGGAGGAAAGCTGG - Intergenic
905689843 1:39934933-39934955 GTGGGAGACTGGAGTGGAGATGG + Intergenic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906141729 1:43537757-43537779 CTGGGAGACAGGAAGAAATTTGG + Intronic
906146452 1:43563547-43563569 CTGAGAGACTGGAGGGAAACTGG + Intronic
906553446 1:46687011-46687033 GTGGGAGATGGGAGGAGAGAGGG + Intronic
906683636 1:47748460-47748482 CTGGGAGGCTGGAGAGATGAGGG + Intergenic
906752369 1:48277185-48277207 TTGGGAGGCTGGAGCCAAGATGG + Intergenic
908319782 1:62967874-62967896 CTAGGAGCAGGGAGGAAAGAGGG - Intergenic
908720388 1:67119269-67119291 ATTGGAAACTGGAGGAAAGGTGG + Intronic
909912604 1:81279303-81279325 CTGGAAGGATGCAGGAAAGATGG - Intergenic
910333229 1:86099785-86099807 GTGGGAGACAGGTGGAAACAGGG - Intronic
910461538 1:87452977-87452999 ATAGGAGAGTGGTGGAAAGATGG + Intergenic
912714318 1:111971647-111971669 TTGGCAGACAGGTGGAAAGATGG - Intronic
912789365 1:112636728-112636750 GTGGGAGAGTGAAAGAAAGAAGG - Intronic
912806462 1:112760384-112760406 CGGGCAGAGGGGAGGAAAGAAGG + Intergenic
912961636 1:114201249-114201271 CTGGCAGACTAGAGGAAGTATGG + Intergenic
913385490 1:118254078-118254100 GTGGGAGAGAGGATGAAAGAAGG - Intergenic
914318753 1:146539284-146539306 ATAGGAGAGTGGTGGAAAGATGG + Intergenic
914495605 1:148194073-148194095 ATAGGAGAGTGGTGGAAAGATGG - Intergenic
914838130 1:151225325-151225347 CTGAGAGACTAGTGGAAACAGGG - Intronic
915251207 1:154590035-154590057 CTGGGACACTAGATGTAAGAAGG - Intronic
915282821 1:154834272-154834294 CTGAGAGCCTGGAGGAAGGCTGG + Intronic
915734696 1:158077420-158077442 GGGGGAGCCTGGAGGAAGGAGGG + Intronic
916977710 1:170099426-170099448 TTGGGAGGCAGAAGGAAAGAAGG - Intergenic
917071879 1:171160157-171160179 CTTGGAGATTAGAAGAAAGATGG + Intronic
917269789 1:173259884-173259906 CAGGGAGAATGGAACAAAGATGG + Intergenic
917606796 1:176639541-176639563 CAGGGAAAATGGAAGAAAGACGG - Intronic
917626948 1:176855904-176855926 GAGGGAGACTGGAAGGAAGAAGG + Intergenic
917891192 1:179439822-179439844 ATGGGAGACTGGAGGAACCCAGG - Intronic
917964525 1:180169958-180169980 CTGGGAGAGAGGAGGAATGTGGG + Intronic
918126979 1:181592768-181592790 ATGGGAGAGTTGGGGAAAGAAGG - Intronic
919362334 1:196610727-196610749 CTGGGATGCTGGAGGTTAGAGGG + Intergenic
919500374 1:198330705-198330727 CAGGGATGCTGGAGGAAAGGTGG - Intergenic
919631859 1:199967053-199967075 CAGGGAGAATGAAGCAAAGAAGG + Intergenic
919845646 1:201640493-201640515 CTGGGAGACAGGGGGAAAAGTGG - Intronic
920068792 1:203287899-203287921 AAGGGAGACAGGAGGAAAGGAGG - Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
921163499 1:212489345-212489367 GTGGGAGTCTGGAAGAATGAGGG - Intergenic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
921592134 1:217016509-217016531 GTTGGAGAATGAAGGAAAGAAGG - Intronic
921841152 1:219830021-219830043 CTGGGAGAATGGAGGCGGGAAGG - Intronic
922549366 1:226482675-226482697 CTGAGATACAGGAGCAAAGAGGG + Intergenic
923185046 1:231563608-231563630 ATCTGAGACTGGAGGATAGAAGG + Intronic
923258051 1:232238941-232238963 TTGAGAGGCAGGAGGAAAGAAGG + Intergenic
923448672 1:234096273-234096295 CTGGGAGAGCCGAGGAAAAAGGG - Intronic
924219825 1:241862415-241862437 GCGAGAGACTGGAGTAAAGATGG - Intronic
1063001900 10:1932482-1932504 TAGGGAGAGTGGGGGAAAGAGGG + Intergenic
1063365204 10:5486388-5486410 CAGGGAGACTGAAGGAAGAAGGG + Intergenic
1063701939 10:8393597-8393619 TTGGTTCACTGGAGGAAAGATGG + Intergenic
1064262474 10:13797213-13797235 CTGGGAGTGTGGTGGAAAGGCGG - Intronic
1064352891 10:14592919-14592941 CTGGAAGCCTGGGGGAAAGTAGG - Intronic
1064909354 10:20383572-20383594 ATTGGAAACTGGAGGAAAGGCGG + Intergenic
1065478252 10:26164522-26164544 CTGGGAGACTTGGAGAAAGCAGG + Intronic
1065973589 10:30823889-30823911 GTGGGAGAACAGAGGAAAGATGG - Intronic
1067415314 10:46097877-46097899 CTGGGAAACTGGAGGGAGGTAGG - Intergenic
1067777374 10:49173341-49173363 CTGGGAGATAGGAGCAGAGAAGG + Intronic
1068288968 10:54976940-54976962 CTGTGAGGCTGGAAGAAAGGTGG + Intronic
1068347321 10:55798785-55798807 CTGAGAGACAAGAGGACAGAAGG - Intergenic
1068650454 10:59516900-59516922 CTGGGAGAATGAAGGAGGGAAGG - Intergenic
1068665817 10:59674848-59674870 CTGGGAGTGTGGGGGCAAGATGG + Intronic
1069581955 10:69572510-69572532 CTGGGAGACTGGGGAGTAGAGGG + Exonic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1070341084 10:75499031-75499053 CTGGGAACCTGGAGGCAGGAGGG + Intronic
1070516643 10:77214255-77214277 ATGGGAGGTTGGAGGAGAGAAGG - Intronic
1070961392 10:80502467-80502489 CAGAGACACTGGAGGAAAGCTGG + Intronic
1071087197 10:81876750-81876772 CTGGGAGACTTGGGGAAAGGAGG + Intronic
1071746391 10:88424316-88424338 CTGGAAGACTGGATGAAGCAAGG + Intronic
1071977188 10:90967026-90967048 GTGGGAGAGAAGAGGAAAGATGG - Intergenic
1072231468 10:93417553-93417575 ATGGGAGCCTGGAGGAAGAAGGG - Intronic
1072813863 10:98485875-98485897 CTTGGAGACTGCAGAAGAGAAGG + Intronic
1073053076 10:100681668-100681690 TTTGGAGACTGGACAAAAGAGGG - Intergenic
1073173552 10:101534533-101534555 CTGGGAGAGTGGGAGAAGGAAGG - Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073993255 10:109287920-109287942 CAGGGAGGGTGGAGGAAAGTGGG - Intergenic
1074910584 10:117905066-117905088 CTAGGAGACTGGGGCAGAGATGG + Intergenic
1074983992 10:118641477-118641499 CTGGGAGACCAGAGGAAGGGAGG + Intergenic
1075152535 10:119947292-119947314 GTAAGAAACTGGAGGAAAGAAGG + Intergenic
1075162275 10:120034710-120034732 GTGGGAGAGTGGGGGAAAGAGGG + Intergenic
1075345764 10:121680988-121681010 CTGGGATAGGGGAGGAGAGAAGG + Intergenic
1075407786 10:122206083-122206105 CTGGGGGGCGGGGGGAAAGAGGG + Intronic
1076239439 10:128892778-128892800 CTGGGAGAATGGAACTAAGATGG + Intergenic
1076830528 10:132992199-132992221 CTGTGAGCCTCGAGGACAGAGGG + Intergenic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077359430 11:2134184-2134206 GGGGAAGACGGGAGGAAAGAAGG - Intronic
1077483667 11:2828462-2828484 CTGGGAAGCAGGAGGACAGATGG + Intronic
1077498767 11:2899470-2899492 CAGGCTGACTGGAGGAAGGAAGG - Exonic
1077714634 11:4569143-4569165 GTGGGAGAGCGGCGGAAAGAGGG + Intergenic
1077781640 11:5336450-5336472 CTGGGAAACAGGAGGATTGATGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078044382 11:7899981-7900003 ATGGGAGACTGGAGGAACCCAGG - Intergenic
1078158318 11:8817646-8817668 CTGGCAGACTGAAGGAGAGGGGG - Intronic
1078561597 11:12377672-12377694 GTGGGAGACTTGGGGACAGAAGG - Exonic
1078852401 11:15176863-15176885 CTGGGAAGCTTCAGGAAAGAAGG - Intronic
1079064538 11:17277485-17277507 CTGGGAGAGGGAGGGAAAGAAGG + Intronic
1079099821 11:17534167-17534189 CCGGGAGGCTGGAGGAGAGAGGG - Intronic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1079864408 11:25717053-25717075 CTGGAAGATGGGAGGAAAGGAGG - Intergenic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080319362 11:30988542-30988564 CTGGGAGGCTGGAGAAGAGTGGG - Intronic
1080858758 11:36135000-36135022 CAGGGAAAATGGAGAAAAGAAGG - Intronic
1081506954 11:43727791-43727813 CTGGCAAAGTGGAGGAAAAAAGG - Intronic
1082001511 11:47395735-47395757 CAGGGAGGCAGGAGGAAGGAGGG - Intergenic
1083177592 11:60961041-60961063 CTGAGAGACTTGAGGGCAGAAGG + Intergenic
1083335720 11:61920463-61920485 CTGGGAGCCTGGCTGAAACACGG - Intergenic
1083776309 11:64895816-64895838 CTGGCAGACAGAAGGAAGGATGG - Intronic
1083894912 11:65615038-65615060 GGGGAAGACTGGAGGACAGACGG + Intronic
1085025010 11:73231235-73231257 CTGGGAGTCTTGGTGAAAGAAGG + Intronic
1085278362 11:75314269-75314291 CTGGGAGGCTGGAGTCAAGAGGG + Intronic
1085315021 11:75539592-75539614 CTGGGAGATTGGAGGGCAGGGGG + Intergenic
1085334311 11:75679256-75679278 CTGGGAGATGGGAGGCCAGAAGG + Intergenic
1085728461 11:78975722-78975744 CTCAGATACTGGAGGAATGATGG + Intronic
1086075906 11:82851869-82851891 CAGGGAGAGAGGAGGTAAGAAGG - Intronic
1086076710 11:82862473-82862495 CTGGGAGACTGGAGCAGCGCTGG - Intronic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1086474239 11:87153360-87153382 TTTGAAAACTGGAGGAAAGAAGG - Intronic
1087347601 11:96991457-96991479 CTGGGAGACAGTAGGTAATATGG - Intergenic
1088970062 11:114766052-114766074 CTAGGAAACTGGAAGAAACATGG - Intergenic
1089057105 11:115594549-115594571 ATGGGAGAAAGTAGGAAAGAGGG + Intergenic
1090451237 11:126808186-126808208 CTGGGAGCATAAAGGAAAGAGGG + Intronic
1090609529 11:128457869-128457891 CTGGGAGACTTTGGGAAAAATGG - Intergenic
1090715399 11:129426213-129426235 CTAGGAGAGAGGAGGACAGAGGG - Intronic
1090729105 11:129554421-129554443 ATTGGAAACTGGAGGGAAGATGG + Intergenic
1090849021 11:130555130-130555152 GTGGAAGACTGGATTAAAGATGG + Intergenic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091275670 11:134347786-134347808 CTGGGACACTGGTAGATAGATGG - Intronic
1091308588 11:134557002-134557024 CTGAGAGACAGGAGGGGAGAAGG + Intergenic
1091322224 11:134659837-134659859 CTTAGAGGCTGGAGGACAGATGG + Intergenic
1091342184 11:134824469-134824491 CTGGGAGACTGCAGAGATGAAGG + Intergenic
1091583671 12:1803914-1803936 CTGGCAGGCTGCATGAAAGAAGG + Intronic
1091783094 12:3226094-3226116 AGGGGAGACTGGGGGAAAGGAGG + Intronic
1091883503 12:3999209-3999231 CTGAGTGACTGGAGAAGAGAAGG + Intergenic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1092217861 12:6695242-6695264 CTGAGAGACTGGGAGAAGGAAGG + Intronic
1092483107 12:8878498-8878520 AAGGGAGAAGGGAGGAAAGAGGG + Intronic
1092795199 12:12103975-12103997 CTGGGTGACTGGGTGACAGAGGG + Intronic
1092954247 12:13534928-13534950 CTGGGAGACTGGTGGATGAAAGG - Intergenic
1093344617 12:18025307-18025329 CAGGGAGAATGGAGCAAAGTTGG + Intergenic
1094040307 12:26114607-26114629 GTGGGAGACTGGAGCAGGGAAGG + Intergenic
1095217809 12:39569756-39569778 CTGGGGGAGTGGAGCCAAGAGGG - Intronic
1095279791 12:40336530-40336552 GGGGGAGAAAGGAGGAAAGAAGG + Intronic
1096177954 12:49535380-49535402 GTTGGGGGCTGGAGGAAAGATGG + Intergenic
1096361428 12:50991118-50991140 CTGGTAGACAGGGAGAAAGAGGG + Intronic
1096454655 12:51774949-51774971 CTTGGAACCTGGAGGAAAAAAGG - Intronic
1096567452 12:52493220-52493242 GTGAGAGGCTGGAGGAGAGAGGG + Exonic
1096606140 12:52767910-52767932 CTCAGAGGCTGGAGGAAGGATGG + Intergenic
1096670713 12:53196821-53196843 CTGGGAGAGGAGAGGAATGAAGG + Intronic
1096804542 12:54132464-54132486 CAGGGAGGCTTGAGGAAGGAGGG - Intergenic
1097160951 12:57046428-57046450 CTGGGAGGCTCAAGGGAAGAGGG + Intronic
1097246624 12:57610968-57610990 CCCGGGGCCTGGAGGAAAGAAGG + Intronic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1099424483 12:82505353-82505375 CTGGCAGACAGGAGGCAGGAAGG + Intergenic
1100240316 12:92704520-92704542 TTTGCAGAGTGGAGGAAAGAGGG - Intronic
1100391005 12:94146894-94146916 CTGGAAGGCTTAAGGAAAGAAGG - Intergenic
1100544999 12:95593251-95593273 CCTGCAGATTGGAGGAAAGATGG - Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1100725764 12:97406825-97406847 TTGGGACACAGGAGAAAAGATGG - Intergenic
1101183178 12:102242248-102242270 ATGGGAGAGGGGAAGAAAGAAGG - Intergenic
1101212488 12:102548597-102548619 GTGGGAGACAGTTGGAAAGAAGG + Intergenic
1101349557 12:103916206-103916228 ATGGGAGGCTCGGGGAAAGATGG - Intergenic
1102559579 12:113752736-113752758 ATGGGAGAGAGGAGGAAAGAAGG + Intergenic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1102678433 12:114674108-114674130 CAGGGAAACTGGACGAAAGGTGG + Intronic
1104383787 12:128331084-128331106 CTGGGGGGCAGGGGGAAAGAGGG - Intronic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1104770222 12:131356867-131356889 GAGGGACAGTGGAGGAAAGAGGG + Intergenic
1105024237 12:132838042-132838064 CTGGGAGAGTGGAGCAATGCTGG - Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105285033 13:18996495-18996517 CAGGAAGACAGGAGGACAGAAGG + Intergenic
1105520153 13:21124216-21124238 CTGGAACCCTGGAGGCAAGAGGG + Intergenic
1105912093 13:24878687-24878709 CTGGGAGACAGGCAGAAAGGGGG - Intronic
1105950575 13:25225924-25225946 GTTGGAGGCTGGAGGAGAGAAGG + Intergenic
1105981834 13:25524934-25524956 CTGAAAGACGGAAGGAAAGAAGG - Intronic
1106144840 13:27041242-27041264 CAGGGAGACTGCAGGGCAGATGG - Intergenic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1107023559 13:35776781-35776803 CAGTGAAACTGAAGGAAAGAGGG - Intronic
1107600091 13:42004364-42004386 CATGGAGACAGGAGGGAAGAAGG - Intergenic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1108481868 13:50880997-50881019 CTTGCAGAGTGGAGGATAGATGG + Intergenic
1111989620 13:95103720-95103742 ATGGGAGACTGTCAGAAAGATGG - Intronic
1112114603 13:96338439-96338461 CTTGGAGACAGAAAGAAAGAAGG - Intronic
1112338894 13:98536867-98536889 CTGGGCGGCTGGAGGACAGGCGG - Intronic
1112338903 13:98536900-98536922 CTGGGCGACTGGAGGACAGGCGG - Intronic
1112739021 13:102453345-102453367 TTGGGAGACTGAAGGGAGGAAGG + Intergenic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1113530464 13:111020724-111020746 CTGGGGGACAGGAGGAGGGAGGG - Intergenic
1113837248 13:113336512-113336534 CTGGGAGACTGAAGAACAGGGGG + Intronic
1114419537 14:22569642-22569664 CTGGGAGGATGGAGAAAATAAGG + Intronic
1114963860 14:27931736-27931758 AAGAAAGACTGGAGGAAAGAAGG - Intergenic
1116689396 14:48085325-48085347 CGGGGAGAATGGAAGCAAGAGGG + Intergenic
1117166706 14:53041769-53041791 ATGAGAGTCTGGAAGAAAGAAGG + Intronic
1117743784 14:58846596-58846618 CTGAGAGACTGAGAGAAAGAAGG + Intergenic
1118026227 14:61771789-61771811 CTTTGAAACTTGAGGAAAGAAGG + Intronic
1118780487 14:69004549-69004571 CAGGGAGACTGGACCAAAGTGGG - Intergenic
1118879623 14:69815313-69815335 ATGGGAGACTGGAGGAACCCAGG + Intergenic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1121464301 14:94104534-94104556 CTGGGAGACATGAATAAAGAAGG - Intergenic
1121566117 14:94910445-94910467 CTGGGAGCCTGAAGGGGAGAGGG - Intergenic
1122108586 14:99480236-99480258 CGGGGTGACGGGAGGAAGGAAGG + Intronic
1122299201 14:100722526-100722548 CATGGAGCCTGGAGGAAAGTGGG - Intergenic
1122316486 14:100828493-100828515 CAGGGAGAGGGGAGGAGAGAAGG - Intergenic
1122646023 14:103194730-103194752 CTGGGTCACTGGAGAAAACATGG + Intergenic
1122646817 14:103200093-103200115 CTTGGAGGTTGGAGGCAAGATGG + Intergenic
1123683560 15:22781567-22781589 CCGTGAGACTGGAAGCAAGATGG - Intronic
1123926700 15:25120004-25120026 CTGTGAGGCTGTAGGAAAGCTGG - Intergenic
1124335763 15:28855937-28855959 CCGTGAGACTGGAAGCAAGATGG - Intergenic
1125372785 15:38996186-38996208 CTGGTAGACTGAAGGAATGCAGG + Intergenic
1125404971 15:39342487-39342509 CTGGAAGAGTGGAGGAAAAGGGG - Intergenic
1125680420 15:41527071-41527093 ATGGGAGACAGGAGGTAAAAGGG + Intronic
1125883829 15:43213995-43214017 CTGGGAAACTGACGGAAACATGG - Intronic
1125933346 15:43615603-43615625 CTGGGAGACTGGAGAGCAGTAGG + Exonic
1125946444 15:43715065-43715087 CTGGGAGACTGGAGAGCAGTAGG + Intergenic
1126062070 15:44792444-44792466 TTTGGAGATTGGAGTAAAGATGG + Intergenic
1126381009 15:48046919-48046941 CAGGGAGCGTGGAGGAAGGAAGG + Intergenic
1126567213 15:50113035-50113057 CTGGGCAGCTGGAGGAGAGAAGG - Intronic
1127164859 15:56233587-56233609 CTGCCAGACTGATGGAAAGAAGG + Intronic
1127209345 15:56757144-56757166 CTGGGAGAGTGGAGAAAAATGGG + Intronic
1127996123 15:64153919-64153941 CTGGGAGCTGGGAGGAAACAGGG - Exonic
1128198483 15:65782384-65782406 CTGAGAGAATGAACGAAAGAGGG - Intronic
1128251235 15:66165674-66165696 CTGGGAGACAGGAGAAATGAGGG - Intronic
1128737582 15:70061954-70061976 CTGGGAAAGTGGAGAAGAGAAGG - Intronic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129464442 15:75716044-75716066 GTGGGAGGGAGGAGGAAAGAAGG + Intergenic
1129465232 15:75721125-75721147 CCGAGAGACAGAAGGAAAGAAGG + Intergenic
1129480864 15:75824436-75824458 GTGGGAGACTGGAGGAGGGGAGG + Intergenic
1129608316 15:77035485-77035507 CTGGGAACAGGGAGGAAAGAGGG - Intronic
1129720804 15:77876968-77876990 GTGGGAGGGAGGAGGAAAGAAGG - Intergenic
1129956195 15:79638772-79638794 CTTGGATACTAGAGGATAGAGGG + Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1131185473 15:90270397-90270419 CTGGCAGAAGGGAGGAGAGAAGG - Intronic
1131442498 15:92469530-92469552 CTGTGAGACAGCAGGAAAGGAGG + Intergenic
1131812338 15:96185564-96185586 CTGGGAGACAGGAGAAAGCATGG - Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132777337 16:1602480-1602502 CTGGGAGACTGGAGAAGTGACGG - Exonic
1132817520 16:1839287-1839309 CTGTGAGACTACAGGAATGAAGG + Exonic
1132862944 16:2080403-2080425 GTGGGTGACTGGCAGAAAGATGG - Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133332312 16:4982234-4982256 CTGGGAGCCAGGAGGGAAGGGGG + Intronic
1133504057 16:6393039-6393061 CTGGGACACTGGAGTAAATGGGG + Intronic
1133520694 16:6553711-6553733 TTGGAAGAATGGAGGAGAGAAGG + Intronic
1133974627 16:10591773-10591795 CTGGGAAGCTGGAGAAATGACGG + Intergenic
1134099146 16:11439396-11439418 CTGGGAGATGGGCAGAAAGAAGG - Intronic
1135355624 16:21766825-21766847 CTGGGAGACTCCAGGTAAAAGGG - Intergenic
1135454113 16:22582970-22582992 CTGGGAGACTCCAGGTAAAAGGG - Intergenic
1135889585 16:26345176-26345198 CCTGGAGACTGGAGGGAACATGG + Intergenic
1136504685 16:30695413-30695435 GTGGGAGAGAGGAGGGAAGATGG - Intergenic
1137428897 16:48402407-48402429 GAGGTAGACTGGGGGAAAGACGG - Intronic
1137708575 16:50551120-50551142 ATGGGAGGGAGGAGGAAAGAGGG + Intronic
1137804265 16:51288625-51288647 CTGGAAGGCTGGTGGAAGGATGG - Intergenic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1139428148 16:66895796-66895818 CTGGGACAGGGGAGGACAGATGG - Intergenic
1139955523 16:70691302-70691324 CAGGGAGACTGGAGGTCACAGGG + Intronic
1140187033 16:72783642-72783664 TTGGAAGGATGGAGGAAAGATGG + Exonic
1140245453 16:73244349-73244371 CTTGGAGGATGGAGGAGAGAAGG - Intergenic
1140347601 16:74229024-74229046 CTAGGTGACTAAAGGAAAGAGGG + Intergenic
1140393225 16:74606509-74606531 CTGGGAGTGAGGAGCAAAGAGGG + Intronic
1140907834 16:79424688-79424710 CTGTGAGACTGTTGGAAAGATGG + Intergenic
1141015891 16:80449078-80449100 CTTGGTGACTGCAGGAAAAAAGG + Intergenic
1141068685 16:80934061-80934083 CTGGGAAACTGGATGAACGGTGG - Intergenic
1141270232 16:82532969-82532991 AGGGGAGACTGGAAAAAAGAAGG - Intergenic
1141400285 16:83741348-83741370 CTGTAAAACTGTAGGAAAGAAGG - Intronic
1141525941 16:84611954-84611976 CTGGGAGCCTGGAGCAATCAGGG - Intronic
1141725129 16:85782881-85782903 CAGGGAGAATGCAGGAAAGGAGG - Intronic
1142667956 17:1473248-1473270 CTGGGGGACTGGGTCAAAGAAGG + Intronic
1143178904 17:4972372-4972394 CTGGGACACCAGAGGAAAGCTGG + Exonic
1143765235 17:9133397-9133419 CTGGGAGCAAGGAGGAGAGATGG - Intronic
1144028600 17:11300406-11300428 CTCGGATTCTGAAGGAAAGAGGG - Intronic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1145231636 17:21177509-21177531 TGGGGACACTGGAGGAAAGCAGG - Intronic
1145735989 17:27232021-27232043 CTGGGATACTGTAGGGCAGAAGG + Intergenic
1145769006 17:27479114-27479136 CAGGGAGACAGGAGCACAGAGGG - Intronic
1146261945 17:31427701-31427723 ATGGGAGGCTGGAGGGTAGAGGG + Intronic
1147186804 17:38717499-38717521 CCAGGAGGCTGGAGGAGAGAGGG - Exonic
1147369165 17:39980028-39980050 TTGGGAGTGTTGAGGAAAGAGGG - Intergenic
1148204161 17:45769167-45769189 CTGGGAGACAGGGGGAAGCATGG + Intergenic
1148356166 17:46977402-46977424 TGGGGACACTGGAGGAGAGAAGG - Intronic
1148463679 17:47851838-47851860 CTGGGAGAGGGGAGGAGAGGAGG - Intronic
1148552453 17:48558597-48558619 CTGGGAGGCTGGAGGACGGAGGG + Intronic
1148564568 17:48625458-48625480 CCGGGAGAGAGGGGGAAAGAGGG + Intronic
1148627204 17:49078776-49078798 CTGGGAGGCTAGAGGTAAGATGG - Intergenic
1148647745 17:49229089-49229111 CTTGGAGACTGAAAGAAACAAGG - Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1149568644 17:57656750-57656772 CTGGGGAACTGGAGGAAACTAGG - Intronic
1149580110 17:57743949-57743971 CTGGGAGACTGGCCGCAGGAAGG - Intergenic
1150158704 17:62875544-62875566 CTGGGAGCCAGGATGACAGATGG + Intergenic
1150824367 17:68461731-68461753 CTGGGACAATGGAGCCAAGAGGG + Intergenic
1151124464 17:71829992-71830014 CCTGGATACTGGGGGAAAGATGG - Intergenic
1151758502 17:76088016-76088038 CAGGGAGAGGGGAGGAAGGAGGG - Intronic
1152050860 17:77975453-77975475 CTGGGCAACTGGTGGAAAGATGG + Intergenic
1152350569 17:79781943-79781965 CTGAGAGACAGGAAGAAAGGGGG - Intronic
1152426547 17:80221275-80221297 CTGGGAGAGTTGAGGATGGAGGG + Intronic
1152738326 17:82008228-82008250 GTGGGAGACTGCAGGGTAGACGG + Intronic
1153332043 18:3883412-3883434 CTGGGAGACAGGAGGAAGAAAGG - Intronic
1153345850 18:4025022-4025044 ATGGGAGGCAGGAGGACAGAGGG - Intronic
1153968933 18:10207057-10207079 ATGGAAGTCTGGAGGAAAGGTGG + Intergenic
1154076202 18:11204163-11204185 CTGGGAGACAGGAATGAAGAGGG + Intergenic
1154344804 18:13532849-13532871 TTGGGAGCCTGGAGGACGGAAGG - Intronic
1155357208 18:24964750-24964772 CTGGGAGGCTAGAAGCAAGATGG + Intergenic
1156018914 18:32577580-32577602 CTGGGAGACTTGAGTGTAGATGG - Intergenic
1156326733 18:36080231-36080253 CTGGGAGACCTGAAGACAGATGG + Intergenic
1156813595 18:41281698-41281720 CTGTGAGACTGGAGCAAATTTGG - Intergenic
1156939801 18:42753420-42753442 GAGGGAGACTGGCAGAAAGATGG + Intronic
1157002936 18:43549142-43549164 CTGGAAGAAGGGAGGAGAGAAGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1157574394 18:48733866-48733888 CTGAGAGACTGGGGGAAGGGAGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158386558 18:56999753-56999775 CAAGGAGACAGGAGGAAGGATGG + Intronic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1160088960 18:75808114-75808136 CTGGGAGACTGGTGGCAAGGTGG - Intergenic
1160211006 18:76879687-76879709 CAAGGAGACTGGAGGAATAAAGG - Intronic
1160923212 19:1530147-1530169 CTGGGACACTGGGGATAAGAGGG - Intronic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161238473 19:3209220-3209242 CTGCCAACCTGGAGGAAAGAGGG - Exonic
1161326344 19:3665995-3666017 CTGGGAGAATGCAGGGAACATGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161651866 19:5490657-5490679 CTGGGTGATTAGAGAAAAGAGGG - Intergenic
1162550725 19:11356988-11357010 CTGGGAGAATGGATGCAAGCAGG + Intronic
1163360272 19:16841603-16841625 CTGAGAGCCTGGAGGCAAGCAGG - Intronic
1163826706 19:19528211-19528233 CCTGGGGACTGGGGGAAAGAAGG + Intronic
1164073268 19:21788877-21788899 ATGGGAGACTGGAGGAACCCAGG - Intergenic
1164232580 19:23303164-23303186 CATGGAGAATGGAGGAAAGCAGG - Intergenic
1164357967 19:27464373-27464395 CTGGGAGAATGGAGCCAAGTTGG + Intergenic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1164532666 19:29060059-29060081 ATGGGAGACTGGAGAAGGGAGGG + Intergenic
1164609130 19:29620488-29620510 CAGGGAGGCAGGAGGAAAGTTGG - Intergenic
1164714837 19:30383964-30383986 CTGGCAGAGTGGAAGAAGGAAGG - Intronic
1165189327 19:34049329-34049351 CTGGGTGACTCCAGGAAGGAAGG + Intergenic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165445237 19:35853178-35853200 CTGGGAGAGTGTGGGAGAGAGGG + Intronic
1165654908 19:37524711-37524733 CTGGGAGCCTGTGGGAAATATGG + Intronic
1165868545 19:38954027-38954049 CTAGAAGACAGGAGGAAGGAGGG + Intronic
1166158049 19:40930131-40930153 CCAGGAGAGTGGAGGAGAGAGGG + Intergenic
1166166916 19:40997160-40997182 CCAGGAGAGTGGAGGAGAGAGGG + Intronic
1166301395 19:41913748-41913770 CGGGGAGACTGGAGTGAGGAGGG - Intronic
1166543795 19:43622625-43622647 CGGGGGGCCTGGAGGAGAGATGG + Exonic
1167166522 19:47803131-47803153 CCTGGAGAATGGAGGGAAGAGGG + Intronic
1167471024 19:49676659-49676681 GGGGGAGTCTGGAGGAAAAAGGG - Intronic
1167734819 19:51287556-51287578 ATAAGAGACTGGGGGAAAGAGGG - Intergenic
1167739017 19:51312692-51312714 ATGGGAGGATGAAGGAAAGACGG + Intronic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
1167826594 19:51979020-51979042 ATGGGAGACTGGAGGAACCCAGG + Intronic
1168173995 19:54609545-54609567 CCGGGAGGGTGGAGGACAGATGG - Intronic
1168362974 19:55758363-55758385 GTGGGAGACTGGAGGTCAGGTGG - Intergenic
1168363929 19:55768363-55768385 GTGGGAGACTGGAGGTCAGGTGG - Intergenic
1168616247 19:57839337-57839359 CTGGGAGCCTGCAGTAAAGCAGG - Intronic
1168618414 19:57856738-57856760 CTGGGAGCCTGGAGCAAAGCAGG - Intronic
1168620624 19:57876705-57876727 CTGGGAGCCTGCAGTAAAGCAGG + Intronic
1168625088 19:57911869-57911891 CTGGGAGCCTGGAGCAAAGCAGG + Intronic
925978083 2:9155093-9155115 GTGGGAGATTGGAGGGAGGAAGG + Intergenic
927421981 2:22943337-22943359 CTGGCAGAAAGGAGGAAGGAGGG - Intergenic
927445533 2:23157794-23157816 CAGGGAGACACGAAGAAAGAGGG - Intergenic
927791743 2:26015604-26015626 AGGGGAGCCTGGAGGAAAGAAGG + Intergenic
927894709 2:26774338-26774360 CCGGGAGACAGGAGGTAGGAGGG - Intronic
928885505 2:36143707-36143729 CTGTGAGACTGGGGGCAACAGGG - Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929018334 2:37524666-37524688 GTGGGGGACAGGTGGAAAGATGG + Intergenic
929630080 2:43450931-43450953 CTGGGGCACTGGAGGAAAAGGGG + Intronic
929897135 2:45971165-45971187 CTGGGAGAAAGGAGGAATCAGGG - Intronic
930289891 2:49480872-49480894 CTAGGAGAGTGGAGCCAAGATGG + Intergenic
930802729 2:55459597-55459619 CTTGGAGGTTGGAGGCAAGATGG - Intergenic
930873633 2:56190825-56190847 CTGGGGTAGGGGAGGAAAGAAGG - Intronic
931797873 2:65729076-65729098 CTGAGTGACAGGAGGAGAGAAGG + Intergenic
931847923 2:66223524-66223546 CTGGGAGGGAGGAGGAAAAAAGG + Intergenic
931995060 2:67831806-67831828 TTGGGAGACAGGTGGGAAGATGG - Intergenic
932453970 2:71834468-71834490 CTGGGAGACTGGAGGAGGGTGGG + Intergenic
932604996 2:73159285-73159307 CTGGGAGACGGGAAGAAGGGAGG + Intergenic
932974382 2:76579971-76579993 ATGGGAGAATGGAAGAAAGGAGG + Intergenic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
935009787 2:99123086-99123108 CTGAAAAACTGGAGGTAAGAAGG - Intronic
935384393 2:102485779-102485801 CTTGGGGGCTTGAGGAAAGAGGG - Intronic
935943724 2:108267971-108267993 CTGGGACACTGGAGGCACTAAGG - Intergenic
936133805 2:109871534-109871556 GTGGGGGACTGGAGTAAGGAAGG - Intergenic
936210892 2:110499951-110499973 GTGGGGGACTGGAGTAAGGAAGG + Intergenic
936435420 2:112501054-112501076 GTGGGGGACTGGAGTAAGGAAGG + Intronic
936548256 2:113411698-113411720 CCAGGGGACTGGAGAAAAGAAGG + Intergenic
936572976 2:113631681-113631703 CTGGAAGACAGGATGAAGGAGGG - Intronic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
937055931 2:118936854-118936876 TTGGGGGATTGGAGGAAATAGGG - Intergenic
937066902 2:119024272-119024294 CTGGGAGACAGGCAGACAGATGG + Intergenic
937477615 2:122229189-122229211 CTGGGAGGGTGGAGGAAGGGAGG + Intergenic
937513940 2:122631051-122631073 CCTGGAGTTTGGAGGAAAGATGG + Intergenic
939038145 2:137157422-137157444 ATGGGGGACTGGAGCAAAGCCGG + Intronic
940074568 2:149726757-149726779 AAGGGAGAATGGAAGAAAGAGGG + Intergenic
941161488 2:162040542-162040564 CTTGGAGACTGGGGGAAGGAAGG + Intronic
941724643 2:168848261-168848283 CTGGGAGACAGAAGGGCAGACGG + Intronic
941851943 2:170191696-170191718 CTGGGAGATTGGGGGAAGGGTGG + Intronic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
942150750 2:173074540-173074562 CTGGATGACTGGAAGAATGATGG - Intergenic
942181402 2:173384355-173384377 CTGGAAGACTGGAAGGATGAAGG - Intergenic
942409758 2:175696488-175696510 CTAAGAGAATGGAGGAAAGAAGG + Intergenic
942808696 2:179969228-179969250 CAGGGAGACTGTAGGAAAAGAGG + Intronic
943684618 2:190805327-190805349 GAGGGAGAGGGGAGGAAAGAAGG + Intergenic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
945859499 2:215104531-215104553 ACGGGACACTGGAGGAAACAGGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946437731 2:219669161-219669183 TAGGGACATTGGAGGAAAGAAGG - Intergenic
946905385 2:224411032-224411054 GTGGGAGCCTGGTGGAATGAAGG + Intergenic
947055287 2:226092738-226092760 CTAGTAGATTGGAGGTAAGAGGG - Intergenic
947212993 2:227724887-227724909 CAGGGAAGCTGGAGGAAACAAGG - Intergenic
947434446 2:230060836-230060858 CTCTGAGTCTGGAGGAAGGAGGG + Intronic
947546217 2:231012086-231012108 TTGGGAGTCTGGAGGAAAGGAGG + Intronic
947755501 2:232561063-232561085 CTTGGAGTTTGGAGGAAAGAAGG + Intronic
947956641 2:234197689-234197711 TTGGGAGACAGGAGGAAAACAGG + Intergenic
1168869826 20:1118738-1118760 TTCGGCGTCTGGAGGAAAGAAGG - Exonic
1169023606 20:2348832-2348854 CTGGGAGGCTGGAGCAATCAGGG + Intergenic
1169205703 20:3739443-3739465 GTGGGAGGCCGGAGGCAAGAGGG + Intronic
1169418827 20:5442778-5442800 CCAGGAGGCTGAAGGAAAGAAGG + Intergenic
1169549480 20:6687609-6687631 CTGGGTACTTGGAGGAAAGAGGG - Intergenic
1169557965 20:6769081-6769103 CAGGGAGAGGGGAAGAAAGAGGG - Intronic
1169826111 20:9770544-9770566 CTGGGTGAGTGTAGGCAAGATGG + Intronic
1170070166 20:12357915-12357937 CTGGGAAACTGGGGAAAAGGAGG + Intergenic
1170453441 20:16509896-16509918 CCGGAAACCTGGAGGAAAGAAGG - Intronic
1171145315 20:22776283-22776305 CTGGGAGTCTGGAGGCATGGTGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171311970 20:24151878-24151900 CTGTGAGACTCAAGGAAGGAAGG - Intergenic
1171967588 20:31542191-31542213 CTGGGGGATTGGAGGAAGGCAGG + Intronic
1172156643 20:32830477-32830499 CTGGGACACTGGAAGAAAGATGG - Intronic
1172478421 20:35256007-35256029 GTAGGAGTTTGGAGGAAAGAGGG + Intronic
1172865693 20:38095384-38095406 ATGGGAGACTGGGGGAAGGGAGG + Intronic
1173047033 20:39522327-39522349 CTGGGAGACTGATGACAAGAAGG + Intergenic
1173179738 20:40796781-40796803 CTGGGATCCTGTAGGAAAGAAGG - Intergenic
1173326006 20:42034388-42034410 GAGGGAGAGAGGAGGAAAGAGGG + Intergenic
1173896558 20:46555461-46555483 CTTGGTGACTGCAGGAAGGAGGG - Intergenic
1174287338 20:49482717-49482739 CTGGGAGCCTGGTGGAGAGGTGG - Intergenic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1175365636 20:58453539-58453561 CTGGGAAACAGGAGGAAAAGTGG - Intergenic
1175371697 20:58496793-58496815 ATGGGAGAGTGGAGGAAGGCCGG + Intronic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175807613 20:61838473-61838495 ATGGGAGCCTTGAGGGAAGAAGG - Intronic
1178521387 21:33290727-33290749 CTGCCAGACTGGAAGAAGGACGG - Intronic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1179372960 21:40824123-40824145 GTGGGAGGCTGGGGGACAGAGGG - Intronic
1179597943 21:42455670-42455692 CTGGGAGAGGGAAGGAGAGAGGG + Intergenic
1179603194 21:42495020-42495042 CTGGGAGAAAGTAGTAAAGAGGG + Intronic
1180675069 22:17581214-17581236 CCTGGAGACTGGAGGGAAGGGGG - Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181266413 22:21633440-21633462 CTGGAAGTCAGGAGGAAACAAGG - Intronic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182166309 22:28177847-28177869 TTGGGGGAGTGGAGGACAGATGG + Intronic
1182457299 22:30460143-30460165 CTGGGGGACAGATGGAAAGAGGG + Intronic
1183467670 22:37987819-37987841 CAGGGAAACTGGAGGTAGGAGGG - Intronic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184654681 22:45935159-45935181 CTGTCAGCCTGGAGGAAGGATGG - Intronic
1184900836 22:47445507-47445529 CAGGCAGACAGGAGGACAGACGG - Intergenic
1184990019 22:48161071-48161093 CAGGCAGGCTGGAAGAAAGAGGG + Intergenic
1185255013 22:49827260-49827282 CGGGGAGACGGGCGGGAAGACGG - Intronic
1185427213 22:50779193-50779215 CTGGAAGACAGGATGAAGGAGGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949631628 3:5934524-5934546 GTGGGAGACTGGGGGAGGGATGG - Intergenic
949660530 3:6273022-6273044 ATGGGAGGCTGGAGCCAAGATGG - Intergenic
950146826 3:10656122-10656144 CTGGGAGTTTGGAGGAGGGAAGG + Intronic
950290864 3:11783244-11783266 CTGGGAGACTGGAGAAAAAGTGG - Intergenic
950494681 3:13326665-13326687 CTGGGAGACTTAAGCAAAGAAGG - Intronic
950623723 3:14228706-14228728 ATGGGAGACTGGAGGAACACAGG + Intergenic
951537903 3:23756336-23756358 CAGGGAGACTGGAGGCAGGTGGG - Intergenic
952078804 3:29731910-29731932 ATGGGAGACAGAGGGAAAGATGG - Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952131662 3:30371059-30371081 TTGGGAGAATGCAGGAAAGAGGG - Intergenic
952175609 3:30859224-30859246 CTGGGAGGCTGGGGGGAAGCAGG + Intronic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
953117975 3:40011377-40011399 CTAGGTCACTGAAGGAAAGAAGG - Intronic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953659564 3:44882273-44882295 CTGGGAGGCTGGAGGAATCCTGG - Intronic
954092142 3:48293634-48293656 GTGGGAGAACAGAGGAAAGAAGG - Exonic
954567644 3:51612003-51612025 CTGGGAGATGGAAGGAATGAGGG + Intronic
954837216 3:53480508-53480530 CTGGGAGATTAGAGGAAAAAGGG + Intergenic
956727967 3:72172091-72172113 CTGGGAGACGGGAGTCAAGATGG + Intergenic
956766929 3:72491959-72491981 CTGGGAGGATGGTGGAAAGAAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957914613 3:86672219-86672241 CTGGGGGACTGGGGGAAAGGAGG - Intergenic
958088388 3:88843164-88843186 CTGGAAGAGTGGAGGACAGGAGG + Intergenic
958096718 3:88955215-88955237 CTGGGCGACTGGGGAAATGAAGG - Intergenic
958932884 3:100226203-100226225 GTGGGAGGAGGGAGGAAAGATGG + Intergenic
959650702 3:108747962-108747984 CTGGGAGACAGGACGTAGGAAGG + Intronic
960223506 3:115145141-115145163 CTGGGAGACTACTGGAAAGATGG + Intronic
960332314 3:116377003-116377025 CTGGTAGACTGAAGAAAAGAGGG - Intronic
961324711 3:126103334-126103356 CTGGGAAACAGGTGGGAAGACGG - Intergenic
961411390 3:126723731-126723753 CTGTGACACCGGAGGAAATAGGG - Intronic
961500392 3:127328464-127328486 CTGGAAAATTGGAGGAAAGAGGG + Intergenic
961945647 3:130684241-130684263 CTGGGTGATTGCAGGTAAGATGG - Exonic
963364159 3:144313344-144313366 CTGGGTGTCTACAGGAAAGAAGG - Intergenic
963858141 3:150277652-150277674 TTGGGAGAGTGGAGAAAAGAGGG - Intergenic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
964620342 3:158714947-158714969 CTGGGAAACTGGAGAAGGGAAGG + Intronic
964731859 3:159876137-159876159 CAGGGAGACTGGAAGAATGGGGG - Intronic
965032386 3:163389229-163389251 CTGGGAGAACGGAGAATAGAAGG - Intergenic
965590517 3:170357232-170357254 CTGGGCGACTAGAGGAAGGAAGG + Intergenic
967305383 3:188053943-188053965 CTGGGATCCTGGAGAATAGAGGG - Intergenic
968122619 3:196136328-196136350 CTGGGAGACTGGAAGGGAGCCGG - Intergenic
968148562 3:196319622-196319644 CTGAAAGAATGGAGGCAAGAAGG + Intronic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
968987016 4:3880950-3880972 CGGGGAGACGGGAAGGAAGAGGG + Intergenic
969263933 4:6052079-6052101 GGGTGAGACTGAAGGAAAGAGGG + Intronic
969552110 4:7876958-7876980 CTGGAAGGCTGGAAGAAAGAGGG - Intronic
970024230 4:11604751-11604773 TTGGGAGACCGAAGGAAAGATGG + Intergenic
970510968 4:16781443-16781465 GAGGGAGTCTGGAGGACAGAAGG + Intronic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
973039534 4:45453225-45453247 CTGGGATAGTGGAAGAAGGAGGG - Intergenic
973844157 4:54893832-54893854 CTGGGATGCTGGGGGAATGATGG - Intergenic
974418357 4:61640468-61640490 GTGGGAAAATGGAGCAAAGAGGG - Intronic
974757387 4:66228104-66228126 CTGGAAGAATGGAGTCAAGAGGG + Intergenic
975572057 4:75827902-75827924 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
975683028 4:76895881-76895903 CTTGGTGTCTGGAGCAAAGAAGG - Exonic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
976676283 4:87707413-87707435 CTGGAAGACTTGAAGAAAAAAGG - Intergenic
978361516 4:107935313-107935335 CTGGGAGCCTGGAGGCAATTTGG + Intronic
978642797 4:110891332-110891354 CTGGAAGACTGGGGAAATGATGG + Intergenic
978722292 4:111924977-111924999 CTGGGTGACTGTAAGAATGAGGG + Intergenic
979132891 4:117070627-117070649 CAGGGATAATGGAGGCAAGAAGG - Intergenic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
979463568 4:121010403-121010425 CTGGGAAACTAGACTAAAGAAGG - Intergenic
981093754 4:140758157-140758179 GTGGGAGACAGGAGGGCAGAAGG - Intergenic
981591052 4:146361453-146361475 CTGGCAGACTTGTGGAAATAAGG - Intronic
981659057 4:147145165-147145187 ATGAGAGACTGAAGGAAAGGAGG + Intergenic
982073755 4:151718550-151718572 CTGAGAGGCTGGAGGCCAGAGGG + Intronic
982108088 4:152028768-152028790 CTGGAAGGCTGGTGGGAAGAAGG + Intergenic
983183684 4:164677428-164677450 CTGGGAGAATGGAGCCAAGTTGG + Intergenic
983266483 4:165513250-165513272 CTGGGAGACTGGAGGTGAAGTGG + Intergenic
984325117 4:178241727-178241749 CTCGGATCCTGGAGCAAAGATGG + Intergenic
984615918 4:181897112-181897134 CTGGCAGGCTGAAGGGAAGAAGG - Intergenic
984853664 4:184175070-184175092 CTGGGAGCCAAGAGGAGAGACGG - Intronic
985426938 4:189840492-189840514 CTTGGAGGCTAGAGGCAAGATGG - Intergenic
985426948 4:189840565-189840587 CTTGGAGGCTAGAGGCAAGATGG - Intergenic
985591160 5:766242-766264 CTGGGAGACAGGAGCAGACACGG + Intronic
985783979 5:1884822-1884844 GTGGGAGAGGGGAGGAAGGAGGG - Intronic
985962889 5:3316255-3316277 CTGGGGGACAGGAGGAGATAGGG - Intergenic
986056472 5:4142201-4142223 GTGGGTGACTGGAGGTAAGAGGG + Intergenic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
987949131 5:24653371-24653393 ATGGGAGACTGGAGGAACCCAGG + Intergenic
988609792 5:32713280-32713302 TTGGGGGACAGGTGGAAAGAAGG - Intronic
988658333 5:33237103-33237125 CTGGCAAAATGGAGGAAAAATGG + Intergenic
989289123 5:39741136-39741158 CAGGGAGAAGGCAGGAAAGAGGG - Intergenic
990113822 5:52363993-52364015 GTGGGAGGCTGGAGGAGAGCTGG + Intergenic
990180149 5:53151853-53151875 TTGGGAGACTTAAGGAAAAATGG + Intergenic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
990395071 5:55369509-55369531 CTGGTACAGTGGAGGATAGAGGG + Intronic
990437458 5:55807916-55807938 CAGGGAGAATGGAAGAAAGTTGG - Intronic
990517335 5:56542415-56542437 TGGGGAGACTGGAGGAGACAGGG + Intronic
991416175 5:66395473-66395495 GTGGGAGACTAGAGGAAATGGGG + Intergenic
993092304 5:83441409-83441431 CTGGGTGGCTGGAGTCAAGATGG - Intergenic
993422783 5:87722026-87722048 CTGGGAGGTTGGAAGCAAGATGG + Intergenic
993683971 5:90915579-90915601 TTGTGAGATTGGTGGAAAGAGGG + Intronic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
994985357 5:106926526-106926548 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995154789 5:108898115-108898137 CTGGGAGACAGCAGGAAGGTAGG + Intronic
995471125 5:112503286-112503308 CTGGGAGATTGCTGGCAAGATGG + Intergenic
995497744 5:112765445-112765467 GTGAGTGACTGGAGCAAAGACGG - Intronic
996312625 5:122123796-122123818 CTCTGAGACTGGTGGAAAGAAGG + Intergenic
996907264 5:128615349-128615371 CTGGGAGACTGGATGAGTTATGG + Intronic
997028082 5:130090011-130090033 CTAGGAGCATGAAGGAAAGAAGG - Intronic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
998752534 5:145339122-145339144 CTAGCAGACTGGAGGCAAGATGG + Intergenic
999420566 5:151438730-151438752 CTGGGAGAGTGCATGAGAGATGG - Intronic
999645317 5:153711836-153711858 CTAGGAGAATGGAGGAAAATGGG + Intronic
999673230 5:153975425-153975447 CTGGGACAGTGAAGGAAACATGG + Intergenic
1000089563 5:157918439-157918461 CTTGGAGATTAGAGGCAAGATGG + Intergenic
1001093251 5:168756944-168756966 CTGGGAGAATGGAAAACAGAAGG + Intronic
1001571481 5:172733185-172733207 CTGGGAGAGAGGAGGCAGGATGG + Intergenic
1001580880 5:172797427-172797449 CTTGGAAACTGGGGGAGAGAGGG - Intergenic
1001763930 5:174230125-174230147 CTGGGAGACAGCAGTACAGATGG - Intronic
1001899822 5:175417375-175417397 CTGGGACACAGGATTAAAGATGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002512118 5:179727540-179727562 CAGAGAGAGTGGAGAAAAGAAGG + Intronic
1002653038 5:180717777-180717799 CTGGTAGAAAAGAGGAAAGAGGG - Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1004530939 6:16455101-16455123 CTAGGAGACAGAAGGAAGGAAGG + Intronic
1004934074 6:20490648-20490670 CTTGGAGCCTGGAGCAAAGCAGG - Exonic
1004987724 6:21101709-21101731 TTTGGAGACTGGGGGAAAAAAGG - Intronic
1005438924 6:25844174-25844196 TTGGGACACTGGAGTAAAGGAGG - Intronic
1005479791 6:26244756-26244778 GCAGGAGACTGGAGGAAAGGAGG + Intergenic
1006096474 6:31659618-31659640 CTGGGAGACTGGAGGCTGGAGGG - Exonic
1006104933 6:31710749-31710771 GTGGGGGACTGAAGGAAAGGAGG + Intronic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006679806 6:35788659-35788681 CTGGGAGGCAAGAGAAAAGAGGG + Intronic
1006727620 6:36211231-36211253 CAGGGAGAAGGGAGGACAGAAGG - Intronic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1006925176 6:37650055-37650077 CTGGGAGCCAGAAGGAAAGCTGG + Intronic
1006989193 6:38199012-38199034 CAGGAAGACTGGTTGAAAGAAGG + Intronic
1007152710 6:39710213-39710235 CTAGCACCCTGGAGGAAAGAGGG + Intronic
1007217765 6:40253770-40253792 CTGGGATACTGGTGCCAAGAAGG + Intergenic
1007309598 6:40934896-40934918 CTGGGAGAGTGGGAGCAAGAAGG + Intergenic
1007533628 6:42564662-42564684 ATGGGAGGCTGGGGGAAAGGAGG - Intronic
1007749905 6:44065469-44065491 CTGGGAGCCTAGAAGACAGAGGG + Intergenic
1008612570 6:53197743-53197765 CTGGGATACTAAAGGAAGGAAGG + Intergenic
1008969162 6:57346659-57346681 CAGGGAACTTGGAGGAAAGAGGG - Intronic
1009158140 6:60248477-60248499 CAGGGAACTTGGAGGAAAGAGGG - Intergenic
1009727707 6:67556953-67556975 CTGGGAGAATGGAAGCAAGTTGG - Intergenic
1010052856 6:71527924-71527946 CTGGGAGTCTTTAAGAAAGAAGG - Intergenic
1010350638 6:74870219-74870241 CTGGGGGAAAGGAGGAAATAAGG - Intergenic
1010439412 6:75875996-75876018 CAGGGTGACTGAAGGAGAGAAGG - Intronic
1010807647 6:80257862-80257884 CTGGGAGTCCGAAGGAAAAAAGG - Intronic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011676645 6:89741370-89741392 CTTGGAGGCTAGAAGAAAGATGG - Intronic
1012607030 6:101170205-101170227 CTGAGAGACTACATGAAAGAAGG - Intergenic
1013117325 6:107113555-107113577 CTTGGATTCTAGAGGAAAGATGG - Intronic
1013514364 6:110872471-110872493 CTGGAAATCTGGGGGAAAGATGG + Intronic
1015342513 6:132118013-132118035 CAGGCCGACTGGAGAAAAGATGG - Intergenic
1015754945 6:136597496-136597518 GTTGGAGACTGGAGGCAGGATGG - Intronic
1015823667 6:137289788-137289810 CTGTGAGACTGGGAGAGAGAGGG + Intergenic
1016355362 6:143212367-143212389 CAGGGAGGCTGGGGTAAAGAAGG - Intronic
1016395302 6:143617631-143617653 CTGCTAGACTGGAGGGAGGAAGG - Intronic
1016569804 6:145498663-145498685 CAGGGAGAATGGAGAAAAGCAGG - Intergenic
1016641488 6:146354307-146354329 GTGGGACACAGGATGAAAGAGGG - Intronic
1016683132 6:146853373-146853395 CTGGGGGTCTGGAGGAAATGAGG - Intergenic
1016945639 6:149530203-149530225 ATGCAAGACTGGGGGAAAGAGGG + Intronic
1017520432 6:155197108-155197130 CTGGGAGACTTCTGGAAGGAGGG - Intronic
1018503298 6:164436881-164436903 TTGGGAGACTTGGAGAAAGATGG + Intergenic
1018565659 6:165148987-165149009 CTGGAAGGCTGGAGGTAAGTTGG - Intergenic
1019718069 7:2550714-2550736 CTGGGAGGGAGGAGGAAACAGGG + Intronic
1020149677 7:5672166-5672188 CTGGGAGACAGATGGAAAGCAGG + Intronic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1021164120 7:17313147-17313169 CTGGTAGTCTGGAGGAAATTTGG - Intronic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1022417366 7:30189777-30189799 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
1022533375 7:31080775-31080797 CGGGGAGAGGGGAGGAAGGAAGG - Intronic
1022811614 7:33874116-33874138 CTTTCAGACTGGAGGAAATAAGG - Intergenic
1023932106 7:44712364-44712386 CTGGGAGACAGTAGGTCAGAGGG + Intergenic
1024397596 7:48887372-48887394 CTGGGAGACTAGATCAGAGAAGG + Intergenic
1025737296 7:64162042-64162064 CAGGGAGATTGGAAGCAAGATGG + Intronic
1025876015 7:65480274-65480296 CTGGCAGAGTGGAGCCAAGATGG + Intergenic
1026217841 7:68365247-68365269 CTGGGAGGCTAGAGGATGGAGGG + Intergenic
1026221306 7:68399923-68399945 CATGGAGACTGGTGGACAGAGGG - Intergenic
1026287960 7:68980260-68980282 CTTGGAGGCTAGAGGCAAGATGG - Intergenic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1026790051 7:73325609-73325631 CTGGGAAAGGGGAGGAGAGAAGG - Intronic
1027364885 7:77447142-77447164 CAGGGAGAGGGGAGGAAATAAGG - Intergenic
1027522640 7:79229396-79229418 CTTGTAGGTTGGAGGAAAGATGG - Intronic
1027731339 7:81877236-81877258 CTGGGAGAATTGGGGGAAGAGGG + Intergenic
1027870649 7:83702583-83702605 CTGGTAGACTGGAGGGAAATGGG - Intergenic
1028146579 7:87326785-87326807 CTGGGAGGCTAGACGCAAGATGG - Intergenic
1028283504 7:88964510-88964532 CCAGGAGTCAGGAGGAAAGATGG + Intronic
1028458329 7:91062530-91062552 CTGGGGGAGTGGAGCCAAGATGG - Intronic
1028653126 7:93172428-93172450 CTGGGAGGCTAGAAGCAAGAAGG + Intergenic
1028946535 7:96586257-96586279 CTGGAATTCTGTAGGAAAGAAGG - Intronic
1029702402 7:102256057-102256079 CTGGGAGACTGGAGGGAGTCGGG - Exonic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1031820922 7:126500369-126500391 ATGGAAGACAGGAGGAGAGAAGG + Intronic
1031869408 7:127075799-127075821 CTGGGATCCTGAAAGAAAGAGGG + Intronic
1032022821 7:128419466-128419488 GTGGGAGAGTGGGGGAAAGGAGG + Intergenic
1032151500 7:129433845-129433867 CTGGGAGACTGGAGGTCTAAGGG - Intergenic
1032557201 7:132848886-132848908 CTGGGAGCATTGAGTAAAGACGG - Intronic
1033142518 7:138840271-138840293 CTGGGAGCCTGGAAGGAACATGG + Exonic
1033231801 7:139604072-139604094 CTGGCGGACTGGAGGTAAGCAGG - Exonic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033756844 7:144403422-144403444 CTGGGAGACTGGAGGCGGGCAGG + Intronic
1035093242 7:156331544-156331566 AGGGGCAACTGGAGGAAAGACGG + Intergenic
1035689457 8:1550261-1550283 CCGGGAGACTCGAGGATTGACGG + Intronic
1036499182 8:9297662-9297684 ATGAGAGACAGAAGGAAAGAAGG + Intergenic
1036725614 8:11218318-11218340 GTGGGAGACAGGGGAAAAGAGGG - Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037599790 8:20384373-20384395 CTGGCAGCCTGGGGGCAAGATGG + Intergenic
1037839244 8:22232267-22232289 CTGGAAGAATGGGGGAAAGGCGG - Exonic
1037847330 8:22295161-22295183 CTCGAAGAAAGGAGGAAAGAAGG - Intronic
1038004849 8:23421031-23421053 ATGGGAGACTGGAGGAACCCAGG + Intronic
1038073138 8:24040291-24040313 CTGGGAGATGAGAGGATAGAAGG - Intergenic
1038245913 8:25855890-25855912 CTGGGAGACAGAAAGAGAGACGG - Intronic
1038428403 8:27480411-27480433 TTTGGAGACTGAAGGAAGGAAGG + Intergenic
1038573649 8:28685368-28685390 AAGGGAGACAGGAAGAAAGAAGG - Intronic
1038673490 8:29601506-29601528 CTGGGTAACTTGATGAAAGAGGG - Intergenic
1039172920 8:34769132-34769154 CTTGGAGAATGGATGAAGGAAGG - Intergenic
1039421165 8:37442392-37442414 ATGGAAGACAGGAGGGAAGAAGG - Intergenic
1039511896 8:38098597-38098619 GCCTGAGACTGGAGGAAAGAAGG - Intergenic
1039722330 8:40177467-40177489 GTGTGAGACTGGAAGAGAGAGGG - Intergenic
1040870098 8:52091850-52091872 ATGGGAGTCATGAGGAAAGATGG - Intergenic
1040909774 8:52506067-52506089 CTGGCAGACTGGAAGAACTAAGG + Intergenic
1041146516 8:54881706-54881728 CTGGCAGACGGGTGGAAAGGTGG + Intergenic
1041699014 8:60767027-60767049 CTGGAAGATAGGAGGAGAGAGGG + Intronic
1042042223 8:64604712-64604734 ATGTAGGACTGGAGGAAAGATGG + Exonic
1042194747 8:66222508-66222530 CTGGGAGACTGGAGACAAGGAGG - Intergenic
1043034580 8:75179550-75179572 GTGGGAGACTGGGGCCAAGAAGG - Intergenic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1044462711 8:92464657-92464679 CTGGTAGAATGGCTGAAAGAGGG + Intergenic
1044503728 8:92992234-92992256 CTGGGGGAGTGGAGGAGAAATGG + Intronic
1044689785 8:94865417-94865439 AAGGCACACTGGAGGAAAGATGG - Intronic
1045459654 8:102414467-102414489 CTGGGAGCCCTGAGGAAGGAAGG + Intergenic
1046395163 8:113631983-113632005 CTTGGAGACTCCAGGAATGAAGG + Intergenic
1046524963 8:115371866-115371888 CGGGGAGAATGGAAGAAAGTTGG + Intergenic
1046727578 8:117691792-117691814 CTGGGGAACTGGAGGAATGGTGG + Intergenic
1046911987 8:119638725-119638747 GTGGGAGAACGGAGGAATGACGG - Intronic
1047153958 8:122296272-122296294 AGGGAAGAATGGAGGAAAGAAGG + Intergenic
1047264186 8:123290439-123290461 CTGGCAGACTGAAGGCCAGAGGG + Intergenic
1047731934 8:127735586-127735608 CAGGGAGAGTGGAGGAAAGAAGG - Intronic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048453367 8:134554145-134554167 CTGGGAGTCAGGAGCAAGGAGGG - Intronic
1048977637 8:139681886-139681908 CAGGGAGACACCAGGAAAGATGG + Intronic
1049004396 8:139845617-139845639 CGGGGAGCATGGAGGAAAGGAGG - Intronic
1049169442 8:141149921-141149943 TTGGGAGACTGGGAGAAAGCAGG + Intronic
1049359808 8:142207109-142207131 ATGGGTGAATGGGGGAAAGATGG + Intergenic
1050933716 9:11366426-11366448 CTGGGAGAAGGGAGGAAGAAGGG + Intergenic
1050970927 9:11872594-11872616 CTGTGAGCCTGGAGAACAGATGG + Intergenic
1051723565 9:20065260-20065282 CTGGGAGACTGCTGGAAGCAGGG - Intergenic
1052090439 9:24320648-24320670 TTGGGAGTCTGGAGGAGAGTGGG + Intergenic
1052484063 9:29072976-29072998 ATGGGAGATAGGAGGAGAGAGGG - Intergenic
1052864678 9:33457731-33457753 CTGGGAGAATAGAGGAGAGCTGG + Intergenic
1052866303 9:33466505-33466527 CTGGGTGACTGGAGCAGAGGTGG + Intronic
1053010671 9:34631042-34631064 CTGGAAGACTGGAGAGCAGAGGG + Intergenic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053727306 9:41017089-41017111 CCAGGGGACTGGAGAAAAGAAGG - Intergenic
1055249152 9:74281554-74281576 CAGGGAGACAGGATGAGAGAGGG + Intergenic
1055634700 9:78264994-78265016 CTTGAGGACTGGAGGAAAGGTGG + Intronic
1055703451 9:78971811-78971833 GAGGGAGAATGGAGAAAAGAAGG + Intergenic
1056740223 9:89248083-89248105 CTGTGAGGTTGGAAGAAAGACGG + Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1059806123 9:117802516-117802538 ATGGGATTCTGGAGGAAAAATGG + Intergenic
1060292634 9:122318493-122318515 CTGGCAGACTGGTGGAAGGCAGG + Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060840810 9:126791929-126791951 AGGGGAGACTGGAGGGAAGGAGG - Intergenic
1060984852 9:127814002-127814024 CTGGGACACTGCGGGACAGAGGG + Exonic
1061218515 9:129235697-129235719 CTGGGACGCTGGAGGGATGAGGG - Intergenic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061724477 9:132574443-132574465 TTGGGAGATTGGAGGGATGAAGG - Intergenic
1061931230 9:133834184-133834206 CAGGGAGTCAGGAGGAAACATGG - Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062059567 9:134487693-134487715 CCAGCAGACTGAAGGAAAGAGGG - Intergenic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062699734 9:137892627-137892649 CTGTGAGACTGCAGGCAGGAGGG + Intronic
1185767049 X:2733752-2733774 CTAGGACACTGCAGGGAAGAGGG - Intronic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186342863 X:8661905-8661927 CGGGGAAACTGCAAGAAAGAGGG + Intronic
1186501599 X:10055262-10055284 CTTTGAGAATGGAGGAAGGAAGG + Intronic
1187145565 X:16633839-16633861 CTGCCAGACTGTTGGAAAGAAGG - Intronic
1187257983 X:17658568-17658590 CTAGAAGACTAGAGGAATGATGG - Intronic
1187296395 X:18005346-18005368 CTGGAAGATGGGAGGAGAGAGGG + Intergenic
1187546223 X:20255317-20255339 CTGGGGGAATGGAGGAAATGGGG + Intronic
1187901385 X:24029480-24029502 CCGGGAGACTGGGCGAAAGAGGG + Intergenic
1188321617 X:28745286-28745308 ATGGAAGACTGAAGGAAACAGGG - Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1189057316 X:37711615-37711637 GTGGGAGAGGGGAGGAAACAAGG - Intronic
1189625767 X:42895262-42895284 CTGGGAGACTGGGGGCAGGACGG + Intergenic
1189643909 X:43105558-43105580 CTTGGAGCCTGGGGGACAGAGGG - Intergenic
1190255849 X:48761799-48761821 CTGGCAGCCTGGAGGGCAGATGG - Exonic
1190317126 X:49158220-49158242 CTTGGAGAGTGGATGAGAGATGG + Intergenic
1190723716 X:53172360-53172382 CTGGGGCACTGGAAGTAAGATGG - Intergenic
1191140029 X:57106972-57106994 ATGGGAGACTGGAGGAACCCAGG + Intergenic
1191701438 X:64047075-64047097 CACGGAGAATGAAGGAAAGAAGG + Intergenic
1191720173 X:64222696-64222718 CTGAGAGACTTTAGGAAGGAAGG - Intergenic
1191796773 X:65029690-65029712 ATGTGAGACTGGAGGAATAAGGG + Intronic
1192155521 X:68743639-68743661 CTTGGAGCGTGGAGGAAGGAAGG - Intergenic
1192262064 X:69511403-69511425 GGGGGAGGCAGGAGGAAAGAGGG - Intronic
1193029227 X:76879993-76880015 CTGAGAAACTGGAGCCAAGATGG + Intergenic
1193297813 X:79852943-79852965 CTGGCAGGCTGGGGGAGAGAAGG - Intergenic
1193620977 X:83752027-83752049 CTGGGAGAATGGAACAAAGTTGG + Intergenic
1193962491 X:87942851-87942873 TTGGGAGACTGGTGTAGAGAAGG + Intergenic
1195501956 X:105612602-105612624 CTGGAAGAAGGCAGGAAAGACGG + Intronic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195883022 X:109612374-109612396 CTAGGAGAGTGGAGGCAAGGTGG - Intergenic
1196108179 X:111918196-111918218 CTCAGAGACTGGAGGAAAAAAGG + Intronic
1197467341 X:126820981-126821003 CTGGCAGGCTGGAGGCAGGAGGG + Exonic
1197986755 X:132274341-132274363 GTGGGAGACTGGGGGCAAGGTGG - Intergenic
1198819375 X:140630455-140630477 CTTGGAGAGTGGGGGAAATAGGG - Intergenic
1199846332 X:151695077-151695099 CTGGCCGAGTGGAGGAAGGAGGG - Intergenic
1199986428 X:152955356-152955378 CTGGGAAACAGGAGGACAGTGGG + Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1201733780 Y:17235306-17235328 TTTGGAGACTAAAGGAAAGATGG - Intergenic