ID: 1102576488

View in Genome Browser
Species Human (GRCh38)
Location 12:113859179-113859201
Sequence TAGTTACCCCACAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102576488_1102576495 -10 Left 1102576488 12:113859179-113859201 CCCACTTCCCTGTGGGGTAACTA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1102576495 12:113859192-113859214 GGGGTAACTATGCACTGGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 106
1102576488_1102576501 29 Left 1102576488 12:113859179-113859201 CCCACTTCCCTGTGGGGTAACTA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1102576501 12:113859231-113859253 AAGCAGCCAGGCTCCGGTTGAGG 0: 1
1: 0
2: 1
3: 11
4: 122
1102576488_1102576498 17 Left 1102576488 12:113859179-113859201 CCCACTTCCCTGTGGGGTAACTA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1102576498 12:113859219-113859241 TGCCTAGTACACAAGCAGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1102576488_1102576502 30 Left 1102576488 12:113859179-113859201 CCCACTTCCCTGTGGGGTAACTA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1102576502 12:113859232-113859254 AGCAGCCAGGCTCCGGTTGAGGG 0: 1
1: 0
2: 0
3: 11
4: 131
1102576488_1102576500 23 Left 1102576488 12:113859179-113859201 CCCACTTCCCTGTGGGGTAACTA 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1102576500 12:113859225-113859247 GTACACAAGCAGCCAGGCTCCGG 0: 1
1: 0
2: 1
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102576488 Original CRISPR TAGTTACCCCACAGGGAAGT GGG (reversed) Intronic
901509033 1:9705667-9705689 AAGTAACCCCACAGGAAAATGGG + Intronic
901529001 1:9842139-9842161 TGGTTACCACCCAGGGAACTAGG + Intergenic
912321460 1:108717527-108717549 AAATTACCCCACAGGCAATTGGG + Intronic
916894149 1:169144128-169144150 TAGTTTCCCTACATGGAATTAGG + Intronic
917651125 1:177078286-177078308 CAGTGACCCCACAGGGATGAAGG - Intronic
918747456 1:188223161-188223183 TTGTTATCACATAGGGAAGTAGG - Intergenic
920576462 1:207064521-207064543 TTGTGACCCCACAGGGAATAAGG - Intronic
920934393 1:210417812-210417834 TATTTTCCCCACTGGGAATTTGG - Intronic
921096892 1:211894630-211894652 TAGCAACCCCAAAGGGAAGGAGG + Intergenic
1067032577 10:42888285-42888307 TAGTCACCCTTCAGGGCAGTGGG + Intergenic
1068803577 10:61169831-61169853 TATTTACAAAACAGGGAAGTGGG + Intergenic
1069565266 10:69459815-69459837 TGGGTACCCCAGAGGGCAGTGGG + Intronic
1073072225 10:100801949-100801971 TAGTTCCCTCACAGGGTTGTCGG + Intronic
1074324272 10:112432672-112432694 TAGTTGCCTCCCAGGGAACTAGG - Intronic
1075832764 10:125425330-125425352 TTGTTACCAGACAGGGAAGGAGG - Intergenic
1076489261 10:130845878-130845900 TAGATACCCCAGAGGGAGGATGG + Intergenic
1078454520 11:11464851-11464873 CAATAACCCCACAAGGAAGTAGG - Intronic
1082712932 11:56576731-56576753 TTGTTACCCCACAGGCACTTAGG + Intergenic
1083667771 11:64284986-64285008 TAGTTTCCCCCCAGTGAAGTGGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085631054 11:78117124-78117146 TACTTACCTCACAGGGACATTGG - Intronic
1088217259 11:107525050-107525072 TATTAATCCAACAGGGAAGTTGG - Intronic
1090352427 11:126115818-126115840 TCATTACCCCACAGGGCAGTGGG - Intergenic
1090788168 11:130068730-130068752 CAGTTTACCCACAGGGAACTGGG + Intergenic
1090935333 11:131336803-131336825 TAGTTAAGTCACAGAGAAGTTGG - Intergenic
1092143443 12:6199664-6199686 TAGTTGCCCCAGAGGGAAAAAGG - Intergenic
1092872630 12:12819687-12819709 TGGTTTCCACACAGGGAACTTGG - Intronic
1094364003 12:29661137-29661159 TATCTACCTCACAGGAAAGTTGG + Intronic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1097218914 12:57435354-57435376 GAGTGACCCCAGAGGGATGTGGG - Intronic
1102576488 12:113859179-113859201 TAGTTACCCCACAGGGAAGTGGG - Intronic
1104993864 12:132642168-132642190 CTGTTACTCCACAGGTAAGTGGG - Exonic
1107057067 13:36117904-36117926 TAGATAGCCCAGTGGGAAGTGGG - Intronic
1107939722 13:45372877-45372899 CAGTTACTCTACAGGGAACTGGG - Intergenic
1108007406 13:45963633-45963655 GAGTTATCCCACAGAAAAGTTGG - Exonic
1108806899 13:54169431-54169453 TAGTTACCCCTCAAGAAAGGAGG + Intergenic
1114783709 14:25570033-25570055 TACTTACCCTTCAGGGCAGTGGG + Intergenic
1115270412 14:31545227-31545249 TATTTACCCCTCAAGGAGGTTGG - Intronic
1115442724 14:33454685-33454707 TAGTTTCACCACAGGGGATTCGG + Intronic
1115479127 14:33844457-33844479 TAGTTCAGCCACAGTGAAGTTGG - Intergenic
1117770624 14:59130605-59130627 TAGTTACCCACCAGGGATGACGG + Intergenic
1122408254 14:101512962-101512984 TGGTCACCCCACAGGGCAGATGG + Intergenic
1126900962 15:53313871-53313893 TGGTTCCACCACAGGGAGGTAGG - Intergenic
1133376485 16:5291575-5291597 TTGTTAACCCACAGAGCAGTGGG + Intergenic
1137546905 16:49411014-49411036 TAGGTCCCCCACAGGCAGGTGGG - Intergenic
1137933750 16:52613531-52613553 TAGTTACTACACAGGGTTGTTGG + Intergenic
1138275121 16:55728797-55728819 AAGTTACCCCAGATGGATGTTGG - Intergenic
1139309900 16:66019500-66019522 TAGTTCCCCCACACAGGAGTGGG + Intergenic
1141494498 16:84397965-84397987 CAGTTACCCCTCAGGTAGGTAGG + Intronic
1141829687 16:86503044-86503066 TGTTCACCCCACAGGGAAGAGGG - Intergenic
1143102452 17:4511943-4511965 AAGTCACACCACAGGGAAGTAGG - Intronic
1146482628 17:33217215-33217237 TGGTTACCCCAAATGGATGTGGG + Intronic
1146703470 17:34981542-34981564 TACCTACCTCACAGGGTAGTTGG - Intronic
1146916242 17:36680188-36680210 TATTTTCCCCAGAGGGAAGCGGG + Intergenic
1149356039 17:55840308-55840330 TAGATTCCCCAGAGGGAAGATGG + Intronic
1149394175 17:56221959-56221981 AAGTTTCCACACAGGGCAGTAGG - Intronic
1150450565 17:65263645-65263667 TACCTACCCCATAGGGGAGTTGG - Intergenic
1152899468 17:82931785-82931807 TATTTACCCCACAGAAAAGGAGG - Intronic
1153711742 18:7806976-7806998 TAGCTACCCCAAAGGGAGGTGGG - Intronic
1156007683 18:32462999-32463021 TAGTCACCCCACTGTGCAGTAGG - Intronic
1157344897 18:46819409-46819431 TAGTTACTCCACATGTAATTTGG - Intronic
1157483715 18:48072731-48072753 TCGGTTCCCCACAGGGAGGTGGG - Intronic
1157496911 18:48162697-48162719 AAGTTCCCCCACAGGAAAATAGG + Intronic
1159996982 18:74974667-74974689 TTAGTACCCCACATGGAAGTTGG + Intronic
1160318683 18:77870345-77870367 TAGACATGCCACAGGGAAGTCGG - Intergenic
1163205967 19:15802979-15803001 TCATTACCCCCCAGGGCAGTGGG - Intergenic
1165587048 19:36926560-36926582 TATTTATCCCACAGGAATGTTGG + Intronic
1165631760 19:37307193-37307215 TATTTACGCCCCAGGGAAGGAGG + Intergenic
1166141986 19:40810173-40810195 TAGTTTCCCTACAGGGAGATTGG + Intronic
927705038 2:25291533-25291555 TAGCCACCCCACAGGGAAAAGGG - Intronic
928436625 2:31258627-31258649 TGGTTACTCCTCAGAGAAGTGGG + Intronic
930288821 2:49467853-49467875 GACTCACCCCTCAGGGAAGTGGG + Intergenic
931201855 2:60105398-60105420 CAGTTACCACACAGCTAAGTAGG - Intergenic
932855231 2:75226855-75226877 TAGTTAAGCCACTGGGATGTGGG - Intergenic
933781417 2:85804499-85804521 TGCTTACCCCTCAGGGAAGGTGG + Intergenic
934683832 2:96305917-96305939 TAGTTACCTCAAACGGAAATGGG - Intergenic
935785057 2:106541278-106541300 TAGTGACCCCCTATGGAAGTAGG + Intergenic
939413804 2:141866084-141866106 TAGTGACCCCCCAGGGAAGAGGG + Intronic
946957730 2:224950366-224950388 TACTTACCTCACAGGGTTGTTGG - Intronic
947682962 2:232052533-232052555 GAGTTGCCCAACAGGGAAGAGGG - Intronic
1169398821 20:5261936-5261958 CAGTTAATCCACAAGGAAGTGGG - Intergenic
1169485921 20:6032556-6032578 TATTTTCACCACAGGGAAGGAGG - Intronic
1169563186 20:6824291-6824313 TACCTACCGCACAGGGAAGTAGG - Intergenic
1170588727 20:17754967-17754989 CAGTTATCCCATAGGCAAGTGGG - Intergenic
1174270277 20:49363424-49363446 TTGTTACCCCATAGGGATGTGGG - Intergenic
1175105433 20:56611430-56611452 TATTTCACCCACAGGGAAGTTGG - Intergenic
1176728716 21:10467888-10467910 TACTTACCTCACAGGGATGTTGG + Intergenic
1177334889 21:19710590-19710612 TAGTGACAACACAGGCAAGTAGG - Intergenic
1180076901 21:45467676-45467698 CAGTTCCACCACAGGGAAGGAGG - Intronic
1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG + Intronic
1183320667 22:37163423-37163445 TAGATACCCCAAAGAGAAATGGG + Intronic
1184524914 22:45016486-45016508 TCGTCACCCCACAGGGCAGGTGG - Intergenic
951204922 3:19916138-19916160 TGGCTACCCCACAGGGCATTAGG - Intronic
952215306 3:31272256-31272278 GAGTCACCCCACACTGAAGTGGG - Intergenic
954025558 3:47780808-47780830 TATTTACACAAAAGGGAAGTTGG + Intronic
956564742 3:70623828-70623850 TAATTTCCCCAAAAGGAAGTTGG - Intergenic
959728245 3:109570112-109570134 TATTTAGCCCACTGGGGAGTTGG + Intergenic
961043487 3:123693546-123693568 TGGTTGCCCCAGAGAGAAGTGGG + Intronic
961287536 3:125818467-125818489 TTGTTAACCCACAGAGCAGTGGG + Intergenic
961390011 3:126546820-126546842 CAGTTAGCCCATAGAGAAGTAGG - Intronic
963002985 3:140700635-140700657 GAGCTACCCTAAAGGGAAGTAGG + Intronic
968962486 4:3752671-3752693 AAGGGACCCCATAGGGAAGTCGG + Intergenic
969332296 4:6482264-6482286 TATTCACCTCACAGGGAAGCTGG - Intronic
970925909 4:21452096-21452118 GACTTAACCCACAGGGACGTAGG + Intronic
973773684 4:54227581-54227603 TAGTTGCCCCAGAGGGTAGGAGG - Intronic
977127104 4:93183765-93183787 ATGTTACCACTCAGGGAAGTTGG + Intronic
977399314 4:96511260-96511282 GACTTACCCCTCAGGGCAGTAGG - Intergenic
980885465 4:138757821-138757843 AGGTTACCCCACAAGGGAGTGGG - Intergenic
982338284 4:154265846-154265868 TATATCCCCCACAGGGAAGGGGG - Intronic
984411570 4:179404433-179404455 AAGTTTGCCCACAGTGAAGTAGG - Intergenic
984640271 4:182157339-182157361 AAGTTATTCCACAGGGAAGGAGG - Intronic
985570104 5:640089-640111 TGGTTTCCACACAGGGCAGTCGG + Intronic
986628860 5:9749592-9749614 TAGTAAACCCACAGGGAATGTGG + Intergenic
988598422 5:32616824-32616846 TAGTGACCCCACAGTGAACCAGG - Intergenic
989659765 5:43787284-43787306 TACTTGCCCCCCAGGGAAGGTGG - Intergenic
989814779 5:45722664-45722686 TAGTTCCCCCACAGGATACTGGG + Intergenic
990476430 5:56165597-56165619 TGCTTACTTCACAGGGAAGTAGG - Intronic
991480228 5:67070022-67070044 TACTGATCCCACAAGGAAGTGGG - Intronic
994454915 5:99993701-99993723 TAGTTAGCCCTTAGAGAAGTAGG - Intergenic
995182551 5:109242195-109242217 AAGTTCCCCCACAGAGATGTGGG - Intergenic
1001067834 5:168553258-168553280 AAGGTACCCCAAAGGGGAGTAGG + Exonic
1001143618 5:169165162-169165184 TTGCTACCCAACAGGGATGTTGG + Intronic
1005612050 6:27535676-27535698 TTGTTACCCTAAAGGGCAGTGGG + Intergenic
1006399204 6:33806586-33806608 CAGTTTCCCCACATGTAAGTTGG - Intergenic
1009266479 6:61561726-61561748 TACTTACCCCTCAGGGCAGTGGG + Intergenic
1014727578 6:124990953-124990975 TAGCTACCCGAGAGGGAGGTGGG + Intronic
1016151235 6:140745385-140745407 TATTTACCCTTCAGGGCAGTAGG - Intergenic
1016171777 6:141026564-141026586 GTGTTCCCCCACAGGGAACTAGG - Intergenic
1016408851 6:143760652-143760674 AAGTGACCCCACAGGGCACTGGG - Intronic
1022223564 7:28340016-28340038 GACTTACCCCTCAGGGTAGTGGG + Intronic
1022973158 7:35535680-35535702 TCTTTACCCCACAGGGAGATTGG + Intergenic
1028161559 7:87491764-87491786 CCATTACCCCAGAGGGAAGTGGG + Intergenic
1028594965 7:92538551-92538573 TAATTACCTCACATGGAAGTAGG - Intergenic
1028708842 7:93883721-93883743 TAGTAACCCCAAAGGGAAGCTGG - Intronic
1030370463 7:108694029-108694051 GACTTACCCTTCAGGGAAGTGGG + Intergenic
1031194526 7:118595728-118595750 TAGTTACCTCACAGCCAAGCAGG - Intergenic
1031224892 7:119023490-119023512 TAGTTACCCCACTGTGCATTAGG - Intergenic
1033134536 7:138773715-138773737 TAGTTACTAGACAGGGCAGTAGG - Intronic
1033704747 7:143875960-143875982 ATGTTACCCCACTGGGGAGTTGG - Intronic
1034106634 7:148496114-148496136 TCCTTACCCCACAGGATAGTTGG + Intergenic
1034601378 7:152260054-152260076 TACTTACCTCACAGGGATGTTGG - Intronic
1044119689 8:88379601-88379623 TCATTACCCCATAGGAAAGTGGG + Intergenic
1046351724 8:113023985-113024007 TAGTTACCCTACAGTGCAATAGG + Intronic
1048080537 8:131121837-131121859 AAGTTTCCCCAGAGGAAAGTGGG - Intergenic
1049472415 8:142782422-142782444 TAGTTTCCCCATACGGAAGTGGG + Intergenic
1059008403 9:110429509-110429531 TATCTTCCCCATAGGGAAGTAGG + Intronic
1203585529 Un_KI270746v1:66182-66204 TACTTACCTCACAGGGATGTTGG - Intergenic
1187452735 X:19413050-19413072 TAGTTAAACCTTAGGGAAGTGGG - Intronic
1194386109 X:93256979-93257001 TAGTTAACCCAGATAGAAGTCGG - Intergenic
1194835035 X:98671842-98671864 TACTTACCCTTCAGGGCAGTGGG + Intergenic
1195823357 X:108970677-108970699 TATTTACCCTTCAGGGCAGTTGG - Intergenic
1197161062 X:123322282-123322304 TAGTTACCATATAGGTAAGTGGG - Intronic
1197948185 X:131863119-131863141 AACTTACCCAACAGGGAAATGGG + Intergenic